CN112410441A - Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 - Google Patents
Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 Download PDFInfo
- Publication number
- CN112410441A CN112410441A CN202110041863.3A CN202110041863A CN112410441A CN 112410441 A CN112410441 A CN 112410441A CN 202110041863 A CN202110041863 A CN 202110041863A CN 112410441 A CN112410441 A CN 112410441A
- Authority
- CN
- China
- Prior art keywords
- bee
- primer
- cysticercosis
- colony
- larva
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to a method for identifying anti-saccular-larva character of a bee colony by using an SNP marker KZ288479.1_95621, which comprises the steps of sampling Chinese bee larva individuals, extracting DNA of bee larva samples, synthesizing primers, detecting and identifying the anti-saccular-larva character of the Chinese bees by PCR, and according to the frequency of C genes of the worker bee larva individuals randomly collected from the bee colony and appearing in the SNP marker KZ288479.1_95621P C And frequency of T geneP T Whether the difference is obvious or not is judged, and the anti-cysticercosis character of the Chinese bees is identified. The invention provides a SNP (KZ 288479.1-95621) marker related to the resistance of the Chinese bee larvae to the saccular larvae disease from the molecular level, scientifically, accurately and quickly identifies the resistance of Chinese bee colonies to the saccular larvae disease, can greatly shorten the breeding period of the Chinese bees resistant to the saccular larvae disease, and quickens the breeding speed of the bees.
Description
Technical Field
The invention relates to a method for identifying anti-saccular larva character of a bee colony by using an SNP marker KZ 288479.1-95621, in particular to a method for identifying anti-saccular larva character of Chinese bees by using an SNP marker KZ 288479.1-95621, and belongs to the technical field of biology.
Background
The epidemic of bee viral diseases is an important problem affecting the healthy development of the bee-keeping industry, and causes global economic loss. Bee Sacbrood virus (SBV) threatens Chinese bee ((SBV))Apis cerana ceranaChinese bee for short) is one of the main diseases of health. Bees are susceptible to a variety of pathogens, among which sacbrood viruses and other factors present serious threats to the health of the bee population. The cysticercosis virus is most susceptible to larvae and can also infect adult bees. Sacbrood viruses are ubiquitous in bee populations, particularly in Chinese bees. The sacbrood virus can cause the death of individual bees and even the disappearance of the entire colony. At present, no medicine capable of effectively curing the cysticercosis without influencing the quality of bee products is reported, and the best solution is to culture a disease-resistant variety. Therefore, we have carried out the research on the disease-resistant molecular markers of Single Nucleotide Polymorphisms (SNPs) associated with Chinese bee sacbrood disease. So far, Chinese bee science and technology workers are dedicated to the relevant research of the medium bursal disease resistant bees, so as to discover the medium bursal disease resistant mechanism, the genetic markers related to the medium bursal disease resistant behavior and the like, strengthen the work of breed conservation and breeding of the medium bursal disease resistant bee species and fully play the advantages of excellent bee species resources in China. The research on the anti-middle cystic disease state, the molecular marker significance, the SNP technology and the application thereof in the bee research field and the like is summarized as follows:
1. advances in the study of genetic markers
(1) Genetic markers: is an allele or genetic material (guo chun swallow, 2014) whose phenotype is easily recognized, and the genetic marker is developed through an initial morphological marking stage, then through a cytological marking stage, a biochemical marking stage and an immunological marking stage, and is generally subjected to five stages till the molecular marker which is widely used at present. The external morphological marker and the anatomical morphological marker belong to morphological markers and are external morphological features which can be identified by naked eyes. Cytological markers are analyses of the morphology, number, etc. of chromosomes. The biochemical marker is a genetic marker for individual biochemical traits in organisms, such as isozyme markers which are frequently used in the field of bee science. The immunological marker is a genetic marker based on immunological characteristics such as leukocyte antigen and erythrocyte antigen. The development of molecular markers has been mainly experienced in first generation Restriction Fragment Length Polymorphisms (RFLPs), second generation microsatellite markers (STRs), third generation Single Nucleotide Polymorphisms (SNPs) and initial fourth generation gene Copy Number Variations (CNVs). Compared with SNPs, CNVs are still in the development stage at present, although compared with SNPs, the detection technology without the CNVs has no SNPs maturity, but the CNVs have more nucleoside content and higher mutation rate, the CNVs can detect important sites which cannot be detected by SNPs, and the two methods have complementarity (Liu-format etc., 2016; xu-Fang, 2012).
(2) The characteristics and application of RFLPs are as follows: RFLPs analysis technology can be widely applied to the research of DNA polymorphism without considering the influence of recessive phenomenon and environment. However, the content of the RFLPs polymorphism information is low, the operation is complicated, the demand on DNA samples is high, and the quality requirement is high (guo chun yan, 2014).
(3) Biochemical genetic markers: isoenzymes are one of the biochemical markers that can produce multiple enzyme forms due to genetic differences. Much studied in the bee field is Malate Dehydrogenase (MDH), which is encoded by three alleles: MDHI, MDHII and MDHII, only MDHII shows polymorphism in different types and developmental stages of bees. Guanying Hui et al (1994) found that the MDH II heterozygosity of Italian bee No. 1 in Zhe nong is higher than that of other two Italian bees (Hubei Italian bee and Italian bee in original species), and newly found that aa and ab genotypes which are not existed in other two low-yield Italian bees of royal jelly can be used as biochemical genetic markers of high-yield bee species of royal jelly. In addition, the genotype frequency, the gene frequency and the heterozygosity of the MDHI of the three bee subspecies of the western bee are very different, and the result shows that different bee species can be identified from the biochemical genetic perspective by measuring the gene frequency and the heterozygosity of the MDHI. Pleuroptera pallidum (1997) reported that MDH II polymorphisms of Italian bee No. 1, Zhejiang Nongda, and other four Italian bees are significantly different. In conclusion, the malate dehydrogenase II (MDHII) of the bee can possibly become a genetic marker of biochemical level related to the high yield character of the royal jelly.
(4) Molecular genetic markers: genetic polymorphisms refer to two or more genotypes or alleles that are ubiquitous in an organism. Zhe nong Da No. 1, Pinghu and Xiaoshan royal jelly bees are all royal jelly high-yield bee species, Zhang ya Juan et al (2001) obtain a common specific DNA fragment W316bp by carrying out random amplification polymorphic DNA-PCR (RAPD-PCR) analysis on bees of the three bee species, and the phenomenon indicates that the DNA fragment is possibly related to the royal jelly high-yield character. The gene polymorphism of 3 royal jelly high-yield bee species and royal jelly low-yield bee Carniella canadensis is analyzed simultaneously by adopting RAPD-PCR technology in Lianli et al (2002), and as a result, W316bp is not found in the Carniella canadensis, but is detected in 3 royal jelly high-yield bee species, and further proves that W316bp can be used as a genetic marker of the royal jelly high-yield bee species. The Dyson et al (2003) not only studied 3 high-yield bee species of royal jelly, but also studied local Italian bees, black ring system bees and the like, and verified the W316bp by adopting a characteristic sequence amplification region (SCARs) method, the result is consistent with the previous study, and the W316bp is probably a molecular marker related to the high-yield character of the royal jelly.
Microsatellite DNA is a simple nucleotide repeat sequence universally existing in the genome of organisms, and a microsatellite marker is a genetic marker widely applied to animal and plant breeding. "Zhe nong Da No. 1" Italian bee, protospecies Italian bee and local Italian bee are western bee species which are bred more in China, and have different royal jelly producing capacities, the Lijiake et al (2003) analyzes 10 microsatellite loci of the 3 bees, finds that the allele factors of the microsatellite loci amplified in each bee are different, and shows polymorphism, wherein the specific allele of the "Zhe nong Da No. 1" Italian bee is the most, and finds 7 microsatellite markers which can be used as royal jelly high-yield bee species according to the analysis result of allele frequency.
Panjiao and the like (2012) adopt a gene chip technology covering bee genomes to analyze bee species with high yield and low yield of royal jelly, 369 differential expression genes are screened, wherein 201 up-regulated expression genes are screened, 168 down-regulated expression genes are screened, and the genes are discovered to possibly participate in biological processes related to royal jelly secretion of bees, such as olfactory system, nervous system, motor system, gland function development and the like through bioinformatics analysis. Further qPCR detection and correlation analysis indicated that there were 3 genes (ii) ((iii))dop2、SsRbetaAndhex71) Closely related to the high yield character of the royal jelly, and the molecular marker can be used as the molecular marker of the high yield character of the royal jelly.
Most of the researches related to the bee royal jelly high-yield traits are carried out before the bee genome sequencing is completed, the adopted method is more traditional, and the screening range has certain limitation, so that the questions are put forward by scholars. More reliable are 3 molecular markers screened by Panjiao et al (2012) in the bee genome range by adopting a gene chip technology, but the method for detecting the RNA of the bees needs to extract and use a fluorescence quantitative instrument, so that the identification process is complicated, the cost is higher, and the popularization of the method is not facilitated.
Therefore, the bee shape is researched from the gene level by adopting a powerful, mature and more scientific molecular research technology, so that the method for identifying the excellent production performance of the bees with simple operation, high reliability and low cost is especially important.
2. SNP technique
Single Nucleotide Polymorphisms (SNPs), referred to as 3 rd generation DNA molecular markers, refer to the difference in individual nucleotides between different alleles of the same locus, often single nucleotide substitutions, and often between purine bases (a and G) and pyrimidine bases (C and T). SNP markers, which help to distinguish the difference between the genetic material of two individuals, are considered to be one of the best genetic markers for application. At present, SNP information of a genome can be accurately obtained through steps of extracting genome DNA, randomly breaking, adding a linker, sequencing on a computer, bioinformatics analysis and the like, and SNP molecular markers related to specific characters are screened out.
Liu Yuan Zhen et al (2016) verified and screened an SNP molecular marker SNP-3 capable of evaluating the chalk disease resistance of bee colonies. The mark is located atMRJP5Within the second intron region of the gene, the C allele frequency in a chalkbrood-resistant (CR) bee colony: (P C ) Significantly greater than the frequency (P) in chalkbrood disease resistant (CS) bee colonies<0.05), and T site of SNP-C2587245P C High colony chalkbrood disease incidence is small; chalkbrood disease resistance of different bee colonies of royal jelly high-quality and high-yield chalkbrood disease resistance bee species and T site of SNP-C2587245P C The gene frequencies are matched, and further support that the SNP-3 marker can pass through the detection of bee colonyP C The chalk disease resistance of the bee colony is identified to be strong and weak, and the bee colony is a queen bee with a C/C genotype and shows stronger chalk disease resistance, so that the T of the SNP-C2587245 can be used as a molecular marker for breeding chalk disease resistant bee species; the exploration result of the SNP typing method shows that the sequencing method, the probe method and the PCR method related to the research only can accurately identify the T genotype of the SNP-C2587245 and carry out genotype analysis on the region where the T genotype is located by the sequencing method at present.
In conclusion, the research results and literature of the SNP molecular marker related to the Chinese bee anti-cysticercosis trait are not reported.
As a new generation of biotechnology, SNP technology has been used in the field of human diseases with high practical value. The anti-saccular larva disease property of adult apis cerana is identified by adopting the SNP technology, so that the anti-saccular larva disease bees can be accurately, efficiently and quickly selected for breeding, and a good foundation is laid for breeding anti-saccular larva disease bee species by molecular assisted breeding of the apis cerana.
Disclosure of Invention
The invention aims to provide a method for identifying anti-saccular larva character of a Chinese bee colony by using an SNP marker KZ 288479.1-95621, which identifies the anti-saccular larva character of adult Chinese bees by using an SNP technology, so that the anti-saccular larva bees are accurately, efficiently and quickly selected for breeding, and a good foundation is laid for breeding anti-saccular larva bee species by the Chinese bees.
The purpose of the invention is realized by the following technical scheme:
the method for identifying the anti-cysticercosis bees by adopting the SNP locus KZ 288479.1-95621 is strictly screened and verified. Chinese bee larvae are taken as research objects, bee larva sample DNA is extracted, then the DNA is sent to Beijing Baimaike biotechnology company to carry out haplotype sequencing and molecular marker development by adopting Illumina NOVA HisSeq X-Ten technology, and genome-wide association analysis (GWAS) is further carried out. Collecting Chinese bee sacbrood disease resistance and sacbrood disease infection bee larva samples, verifying the preliminarily screened SNPs by PCR and DNA sequencing technology, and screening KZ288479.1_95621 as a molecular marker related to Chinese bee sacbrood disease resistance.
> KZ288479.1_95621 SNP position detected on the genome of Apis cerana cerana 1>1000
TGTTATCAATTGAATTAATCAATTCATCAATTGAAATCATAAATATATTTCTTGACCTATCTATTCTATATTTCTTCTAATAATCCTTGTTCCTTTCTACCGTCATCTTTCTTACAAAAAGCTATCGATAGCATATACATTACACGCGAATTCCCTTATCTCCTGATAATTTACATCCTGCGATCAAATCAACCGGTAGTCGCACGCGAGCATGCATTTTCTCTCAACTTATCCGCGCATCACGCGTGAAACGAATCGAAAATACGTCAGTGATCTCCACGATCCCGACACATTGCACTTTCGTTCGTGTTCGAGCATCACTTTTCCAAAGAAACGCCCTCGAACGGTGAAAGCTGTGCGCGGTCCCCTCTCGATTATTTCCTCGATCATTTCCTTGAAGGCGCCGCGCGTGTGGGTGATGACTTGAGAAAAGAAAAAAGACTGGAGGGGCTTTAAAAGAAATTTAATTCTCGACTTGCCTATCGTCTTCCGCCTCTATTGTGAAACGAGGCGAATCAATGCTTCAAGATAGTGTGCATTATCAGTTTCACTGGAGTCGGATGCTTATCAAATCTGGTGGTTTATCTCGAAGTGTATATTCTTCAAACATTTCATTGCTGTTATTCGAAGTGATGCGATGTCATGTGAATCTACGTAGTTAAATTGCGCGCTTGATAGGTACGAAGAGAGAAATTCGAGAAGTTTTTTTGATATGAGCTTCGTGCAAATGCATGTTTCTGAAGAGATAAGATAAAAAATAAAGAGATGGATTGAAATAATTGACTACAATTGGTTGAGATTTGTTATTTAAAGGATTCGAAAAAGAAATATTTTTTATTTCAAGATTAAAAATAATTTGAAACTTAATATAATCATTATAGCAAATTTTAAATATATGATACATACATCAATCCTATTATATATATAATCCTAATAATATGCATTATATATATAATATTAATTAATATTAAACATAAATAATAAAAAGAGTGATTTTTTG。
The method for identifying the anti-cysticercosis trait of Chinese bees by using the SNP marker KZ 288479.1-95621 comprises the following steps:
(1) sampling bee larvae: collecting worker bee larva individuals from detected Chinese bee colonies, randomly sampling, representing the whole bee colony by 100 larvae per colony, and freezing the bee sample in a refrigerator at-80 deg.C for later use;
(2) extraction of bee larva DNA: respectively carrying out tissue disruption on the larvae frozen in the step (1), extracting genome DNA, and measuring the concentration and purity of the DNA;
(3) synthesizing a primer: the sequences of Primer pairs Primer-F and Primer-R are as follows:
Primer-F：5’-CCTTGTTCCTTTCTACCGTCA-3’；
Primer-R：5’-AAACATGCATTTGCACGAAG-3’；
(4) and (3) PCR detection: carrying out PCR by taking the larva DNA in the step (2) as a template and taking Primer-F and Primer-R as primers;
the reaction system is as follows: total volume 25 μ L, reaction mixture Mix 12.5 μ L, Primer-F0.4 μ L, Primer-R0.4 μ L, DNA template 2 μ L, ddH2O 9.7 μL；
The reaction conditions were: pre-denaturation at 94 ℃ for 1:15 min/s; denaturation at 94 ℃ for 15 s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 1 min for 35 cycles; extending for 5 min at 72 ℃;
carrying out agarose gel electrophoresis detection on the PCR reaction product, and sequencing the PCR reaction solution with the target band;
(5) identifying the anti-cysticercosis character of the bee colony: performing sequence alignment analysis on the sequencing result of step (4) by using software such as Burrows-Wheeler Aligner version (0.7.5a-r405) according to the C allele frequency of bee colonyP C And (4) identifying the anti-cysticercosis character of the bee colony. When C allele of bee colonyWhen the gene frequency is obviously greater than the T allele frequency, the bee colony is a sacbrood-resistant bee colony, and the significance refers to the statistical P<0.05. The SNP marker is genome locus KZ 288479.1-95621 related to the resistance of the bee to the sacbrood disease.
The invention has the advantages and beneficial effects that:
1. the ability of apis cerana to resist cysticercosis is influenced by genotype and there are colonies with significantly higher resistance to specific alleles than susceptible colonies against cysticercosis. The frequency of the SNP marker allele C geneP C The difference between the larvae resistant to the sacbrood disease and the larvae infected with the sacbrood disease is very obvious, namely the C allele frequency in the larvae resistant to the sacbrood disease is obviously higher than the T allele frequency in the larvae infected with the sacbrood disease, and whether the Chinese bees have the ability of resisting the sacbrood disease can be conveniently, quickly and accurately identified according to the result.
2. Judging the ability of the bee colony to resist the cysticercosis according to the statistical indexes: randomly collected bee larva individuals in bee colony are at the SNP locus P C > P T （P<0.05) of the anti-cysticercosis bee colony, P C < P T （P<0.05) are susceptible bee colonies. Therefore, the bee colony for resisting the cysticercosis is selected, the disease resistance of the bee colony is improved, and the income of a beekeeper is increased. The method for identifying the Chinese bee anti-saccular larva trait by using the SNP marker related to the bee anti-saccular larva trait can greatly improve the efficiency.
3. The method mainly grasps the anti-saccular-larvae mechanism of the bees from the molecular level in a laboratory at present, detects the molecular genetic markers related to the anti-saccular-larvae character, and combines the molecular genetic markers to assist the breeding technology of the bee varieties, thereby not only ensuring the accuracy of selection, but also accelerating the breeding speed of the bee varieties, greatly improving the success rate of breeding the anti-saccular-larvae bee species, and safely, effectively and quickly identifying the anti-saccular-larvae bee species.
Drawings
The attached figure is a genotype judgment reference peak map of a SNP marker KZ 288479.1-95621 related to the resistance of bees to the sacbrood disease. Wherein:
the SNP marker genotype marked in the box in FIG. 1 is homozygous CC, and is mainly present in the anti-cysticercosis bee colony;
the SNP marker genotype marked in the box in FIG. 2 is homozygous TT and is mainly present in susceptible bee colonies;
the SNP marker genotype marked in the box in FIG. 3 is heterozygous CT, and is found in both anti-cysticercosis and susceptible bee colonies.
Detailed Description
The invention is further illustrated by the following examples.
Example 1
The main reagents adopted by the invention are as follows (all chemical reagents are analytically pure):
absolute ethyl alcohol, isopropanol, chloroform, ultrapure water, all-gold Trans DNA Marker I, all-gold 2X easy Taq PCR SuperMix, all-gold agarose, all-gold Gelstain, 50X TAE electrophoresis buffer solution for crude production, a ribonucleic acid rapid extraction kit SK8222, synthesis of an upstream primer and a downstream primer, and nuclease A.
The instrument used in the invention is mainly as follows:
axygen 1.5 mL centrifuge tube, Axygen PCR tube, microwave oven, electronic balance, oscillator, small centrifuge, water bath, micro-pipette, electrophoresis apparatus, ABI 96-well PCR apparatus, Shanghai Baozi technology Limited gel imaging analyzer, high speed centrifuge, low temperature refrigerator, autoclave, NanoDrop 2000, etc.
A method for identifying the anti-cysticercosis behavior of Chinese bees by using an SNP marker KZ 288479.1-95621 comprises the following steps:
(1) sampling bees: collecting 100 larvae of bees resisting cysticercosis and infected cysticercosis, collecting larvae of worker bees, placing each larva in a centrifugal tube, and freezing at-80 deg.C for storage;
(2) extraction of bee sample DNA (using animal genome rapid extraction kit from Bio-chemical company, SK 8222)
(3) Synthesizing a primer: the sequences of Primer pairs Primer-F and Primer-R are as follows
Primer-F：5’-CCTTGTTCCTTTCTACCGTCA-3’，
Primer-R：5’-AAACATGCATTTGCACGAAG-3’。
It was diluted to 10. mu. mol/. mu.L and stored at-20 ℃ after use.
(4) And (3) PCR detection: and (3) carrying out PCR by taking the DNA of each bee individual in the step (2) as a template and taking Primer-F and Primer-R as primers, carrying out agarose gel electrophoresis detection on a PCR reaction product, and sequencing the PCR reaction solution with a target band.
PCR reaction (25. mu.L):
Mix: 12.5 μL
Primer-F: 0.4 μL
Primer-R: 0.4 μL
Template: 2 μL
ddH2O: 9.7 μL
reaction conditions are as follows:
(5) screening of SNP markers and analysis of obtained sequencing results:
the DNA sequence of the PCR product is shown below, and the position of this SNP (KZ 288479.1-95621) marker in the sequence is markedC/ C。
5’-CGTCACGCTATCGATAGCATATACATTACACGCGAATTCCCTTATCTCCTGATAATTTACATCCTGCGATCAAATCAACCGGTAGTCGCACGCGAGCATGCATTTTCTCTCAACTTATCCGCGCATCACGCGTGAAACGAATCGAAAATACGTCAGTGATCTCCACGATCCCGACACATTGCACTTTCGTTCGTGTTCGAGCATCACTTTTCCAAAGAAACGCCCTCGAACGGTGAAAGCTGTGCGCGGTCCCCTCTCGATTATTTCCTCGATCATTTCCTTGAAGGCGCCGCGCGTGTGGGTGATGACTTGAGAAAAGAAAAAAGACTGGAGGGGCTTTAAAAGAAATTTAATTCTCGACTTGCCTATCGTCTTCCGCCTCTATC/CGTGAAACGAGGCGAATCAATGCTTCAAGATAGTGTGCATTATCAGTTTCACTGGAGTCGGATGCTTATCAAATCTGGTGGTTTATCTCGAAGTGTATATTCTTCAAACATTTCATTGCTGTTATTCGAAGTGATGCGATGTCATGTGAATCTACGTAGTTAAATTGCGCGCTTGATAGGTACGAAGAGAGAAATTCGAGAGGTTTTTTTGATATGAGCTTCGTG-3’。
And (3) viewing a sequencing peak image of the PCR product, positioning the position of the SNP marker in the peak image, judging the marker in each sample to be the genotype of homozygous CC, heterozygous TT or homozygous CT according to the marker positions in the diagram 1, 2 and 3, and counting.
(6) The SNP marker KZ288479.1_95621 is used for identifying the Chinese bee anti-cysticercosis trait: and (3) carrying out sequence comparison on the PCR sequencing result of the step (4) by using Alignment software, counting the type of the marker peak map, and calculating the genotype and the gene frequency as shown in Table 1. According to the analysis result, if the C allele frequency of the Chinese bee is identified to be obviously greater than the T allele frequency, the Chinese bee can be judged to be the character with strong ability of resisting the saccular larva disease.
TABLE 1 influence of different genotypes on resistance of apis cerana to cysticercosis and distribution of gene frequencies
TABLE 1 passage χ2The Chi-Square Test is obtained by statisticsP=0.0103<0.05, showing that the Chinese bee larvae with different anti-saccular larvae disease abilities have very obvious difference with different genotypes, having statistical significance, showing that the anti-saccular larvae disease ability of the Chinese bee is influenced by the genotypes. Of susceptible groupsP C 、P T Insignificant difference in resistance to cystic larval disease groupsP C Is significantly greater thanP T （72.78% > 27.22）。
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
<120> method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ288479.1_95621
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<400> 1
tccttcggcc tccagaaa 18
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
cgaatgtgga tctcttcgtg t 21
<210> 3
<211> 611
<212> DNA
<213> Sample sequenced and SNP validation
<400> 3
cgtcacgcta tcgatagcat atacattaca cgcgaattcc cttatctcct gataatttac 60
atcctgcgat caaatcaacc ggtagtcgca cgcgagcatg cattttctct caacttatcc 120
gcgcatcacg cgtgaaacga atcgaaaata cgtcagtgat ctccacgatc ccgacacatt 180
gcactttcgt tcgtgttcga gcatcacttt tccaaagaaa cgccctcgaa cggtgaaagc 240
tgtgcgcggt cccctctcga ttatttcctc gatcatttcc ttgaaggcgc cgcgcgtgtg 300
ggtgatgact tgagaaaaga aaaaagactg gaggggcttt aaaagaaatt taattctcga 360
cttgcctatc gtcttccgcc tctatccgtg aaacgaggcg aatcaatgct tcaagatagt 420
gtgcattatc agtttcactg gagtcggatg cttatcaaat ctggtggttt atctcgaagt 480
gtatattctt caaacatttc attgctgtta ttcgaagtga tgcgatgtca tgtgaatcta 540
cgtagttaaa ttgcgcgctt gataggtacg aagagagaaa ttcgagaggt ttttttgata 600
tgagcttcgt g 611
<210> 4
<211> 1000
<212> DNA
<213> KZ288479.1_95621 SNP position detected on the genome of Apis cerana cerana 1>1000
<400> 4
tgttatcaat tgaattaatc aattcatcaa ttgaaatcat aaatatattt cttgacctat 60
ctattctata tttcttctaa taatccttgt tcctttctac cgtcatcttt cttacaaaaa 120
gctatcgata gcatatacat tacacgcgaa ttcccttatc tcctgataat ttacatcctg 180
cgatcaaatc aaccggtagt cgcacgcgag catgcatttt ctctcaactt atccgcgcat 240
cacgcgtgaa acgaatcgaa aatacgtcag tgatctccac gatcccgaca cattgcactt 300
tcgttcgtgt tcgagcatca cttttccaaa gaaacgccct cgaacggtga aagctgtgcg 360
cggtcccctc tcgattattt cctcgatcat ttccttgaag gcgccgcgcg tgtgggtgat 420
gacttgagaa aagaaaaaag actggagggg ctttaaaaga aatttaattc tcgacttgcc 480
tatcgtcttc cgcctctatt gtgaaacgag gcgaatcaat gcttcaagat agtgtgcatt 540
atcagtttca ctggagtcgg atgcttatca aatctggtgg tttatctcga agtgtatatt 600
cttcaaacat ttcattgctg ttattcgaag tgatgcgatg tcatgtgaat ctacgtagtt 660
aaattgcgcg cttgataggt acgaagagag aaattcgaga agtttttttg atatgagctt 720
cgtgcaaatg catgtttctg aagagataag ataaaaaata aagagatgga ttgaaataat 780
tgactacaat tggttgagat ttgttattta aaggattcga aaaagaaata ttttttattt 840
caagattaaa aataatttga aacttaatat aatcattata gcaaatttta aatatatgat 900
acatacatca atcctattat atatataatc ctaataatat gcattatata tataatatta 960
attaatatta aacataaata ataaaaagag tgattttttg 1000
Claims (2)
1. A method for identifying the anti-cysticercosis trait of a bee colony by using an SNP marker KZ 288479.1-95621 is characterized by comprising the following steps: the identification steps are as follows:
(1) sampling bee larvae: collecting worker bee larva individuals from detected Chinese bee colonies, randomly sampling, representing the whole bee colony by 100 larvae per colony, and freezing the bee sample in a refrigerator at-80 deg.C for later use;
(2) extraction of bee larva DNA: respectively carrying out tissue disruption on the larvae frozen in the step (1), extracting genome DNA, and measuring the concentration and purity of the DNA;
(3) synthesizing a primer: the sequences of Primer pairs Primer-F and Primer-R are as follows:
Primer-F：5’-CCTTGTTCCTTTCTACCGTCA-3’；
Primer-R：5’-AAACATGCATTTGCACGAAG-3’；
(4) and (3) PCR detection: carrying out PCR by taking the larva DNA in the step (2) as a template and taking Primer-F and Primer-R as primers;
the reaction system is as follows: total volume 25 μ L, reaction mixture Mix 12.5 μ L, Primer-F0.4 μ L, Primer-R0.4 μ L, DNA template 2 μ L, ddH2O 9.7 μL；
The reaction conditions were: pre-denaturation at 94 ℃ for 1:15 min/s; denaturation at 94 ℃ for 15 s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 1 min for 35 cycles; extending for 5 min at 72 ℃;
carrying out agarose gel electrophoresis detection on the PCR reaction product, and sequencing the PCR reaction solution with the target band;
(5) identifying the anti-cysticercosis character of the bee colony: performing sequence Alignment analysis on the sequencing result of the step (4) by using Alignment software, calculating the gene frequency of the KZ 288479.1-95621 locus of the detected bee colony, and calculating the C gene frequency of the bee colonyP C And (4) identifying the strength of the ability of the bee colony to resist the cysticercosis.
2. The method for identifying the anti-cysticercosis trait of bee colonies by using the SNP marker KZ288479.1_95621 as claimed in claim 1, wherein the SNP marker KZ288479.1_95621 is characterized in that: when the C gene frequency of bee colonyP C Significantly greater than the T allele frequencyP T When the colony is resistant to cysticercosis, the significance refers to statistical P<0.05。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110041863.3A CN112410441A (en) | 2021-01-13 | 2021-01-13 | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110041863.3A CN112410441A (en) | 2021-01-13 | 2021-01-13 | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112410441A true CN112410441A (en) | 2021-02-26 |
Family
ID=74782928
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110041863.3A Pending CN112410441A (en) | 2021-01-13 | 2021-01-13 | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112410441A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112760389A (en) * | 2021-03-18 | 2021-05-07 | 吉林省养蜂科学研究所（吉林省蜂产品质量管理监督站、吉林省蜜蜂遗传资源基因保护中心） | Method for detecting STRs gene frequency of breed conservation honeybees (Apis mellifera) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101956020A (en) * | 2010-04-30 | 2011-01-26 | 中华人民共和国吉林出入境检验检疫局 | PCR (Polymerase Chain Reaction) and fluorescent PCR rapid detection method of bee sacbrood diseases |
| CN104498608A (en) * | 2014-12-20 | 2015-04-08 | 福建农林大学 | Method for verifying anti-chalk disease traits of swarm by SNP marker |
-
2021
- 2021-01-13 CN CN202110041863.3A patent/CN112410441A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101956020A (en) * | 2010-04-30 | 2011-01-26 | 中华人民共和国吉林出入境检验检疫局 | PCR (Polymerase Chain Reaction) and fluorescent PCR rapid detection method of bee sacbrood diseases |
| CN104498608A (en) * | 2014-12-20 | 2015-04-08 | 福建农林大学 | Method for verifying anti-chalk disease traits of swarm by SNP marker |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112760389A (en) * | 2021-03-18 | 2021-05-07 | 吉林省养蜂科学研究所（吉林省蜂产品质量管理监督站、吉林省蜜蜂遗传资源基因保护中心） | Method for detecting STRs gene frequency of breed conservation honeybees (Apis mellifera) |
| CN112760389B (en) * | 2021-03-18 | 2023-09-15 | 吉林省养蜂科学研究所（吉林省蜂产品质量管理监督站、吉林省蜜蜂遗传资源基因保护中心） | Method for detecting STRs gene frequency of Apis mellifera |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109554486B (en) | SNP molecular marker related to grass carp traits and application thereof | |
| CN107400720B (en) | Method for detecting growth traits of cattle under assistance of KLF3 gene CNV marker and special kit thereof | |
| CN106987640A (en) | PIK3CA detection in Gene Mutation primed probe and its kit | |
| CN110894542A (en) | Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN112501312B (en) | Reagent for detecting SNP molecular marker combination related to anti-nervous necrosis virus traits of grouper | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN109280696B (en) | Method for splitting mixed sample by SNP detection technology | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN111088369A (en) | Detection method, primer pair and application of sheep RORA gene insertion/deletion polymorphism | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN113265471B (en) | Method for detecting sheep FASN gene single nucleotide polymorphism and application of method in meat quality early screening | |
| CN111154891B (en) | Primer pair, kit, method and application for detecting sheep IGF2BP1 gene insertion/deletion polymorphism | |
| CN112029868B (en) | Microsatellite marker of portunus trituberculatus and application of microsatellite marker in growth trait association analysis | |
| CN110964790B (en) | Method for detecting tea-goat PIGY gene CNV marker and application thereof | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| CN112210607B (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| CN114410821A (en) | InDel molecular marker for identifying amaranth leaf color character and application thereof | |
| CN111394474A (en) | Method for detecting copy number variation of cattle GA L3 ST1 gene and application thereof | |
| CN113151571B (en) | Primer for detecting puccinia triticina nontoxic gene AvrLr1 molecular marker, and detection method and application thereof | |
| CN114015785B (en) | Microsatellite marker of original seed of blue crab in Bohai sea, primer and application thereof | |
| CN116103413B (en) | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof | |
| CN108866212B (en) | SNP molecular marker for predicting sheep multi-lamb traits and application thereof | |
| WO2023001235A1 (en) | Indel marker of pig growth rate-related gene rps27l and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |