CN112899351B - Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse - Google Patents
Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse Download PDFInfo
- Publication number
- CN112899351B CN112899351B CN202110146789.1A CN202110146789A CN112899351B CN 112899351 B CN112899351 B CN 112899351B CN 202110146789 A CN202110146789 A CN 202110146789A CN 112899351 B CN112899351 B CN 112899351B
- Authority
- CN
- China
- Prior art keywords
- mouse
- human
- quantitative pcr
- pdx model
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to a double-fluorescence quantitative PCR detection kit for a cell infiltration state of a PDX model mouse. The kit comprises a PCR mixed system, wherein the PCR mixed system comprises a human primer and a probe, and a mouse primer and a probe. The kit can simply, quickly and accurately detect the proportion of the human and mouse cells in the PDX model, and has high detection sensitivity.
Description
Technical Field
The invention belongs to the field of detection of cell infiltration states of PDX (polymer dispersed X) model mice, and particularly relates to a kit for detecting cell infiltration states of PDX model mice by double fluorescent quantitative PCR (polymerase chain reaction).
Background
A human-Derived tumor Xenograft model (PDX) is established by directly transplanting tumor tissues of a Patient into an immune deficient mouse. Compared with the traditional Cell-Derived tumor xenotransplantation (CDX) model, the PDX model better reserves the biological and molecular characteristics and heterogeneity of the tumor of the patient and more truly summarizes the complex tumor heterogeneity and drug response in the body of the patient. Therefore, the PDX model has become a useful tool for cancer mechanism research and drug testing.
PDX models typically involve the treatment of fresh solid tumors or blood samples from patients following surgery or puncture, subcutaneous, kidney capsule or orthotopic transplantation into immunodeficient mice, growth in the microenvironment provided by the mice, and further passage after tumor formation in the mice. The model well retains the growth microenvironment of the parent tumor, is beneficial to better expressing the characters of the parent tumor and maintains the heterogeneity of the tumor. The PDX model has high correlation with clinical pharmacodynamic results, so that the PDX model is widely applied to drug research and development and provides a good in-vivo model for tumor research.
The PDX model mouse is a perfect substitute for a tumor patient, can replace the tumor patient to perform in-vivo pharmacodynamic detection on different treatment medicines or schemes, and is a perfect substitute for a reagent, but more and more evidence shows the limitation of the PDX model. Therefore, the proportion of human and mouse cells in tumor cells must be monitored during passage of the PDX model. At present, most PDX model infiltration state detection adopts whole genome sequencing and then bioinformatics analysis, and the existing patent combines quantitative PCR and digital droplet PCR for detection (patent document CN 107338284A), so that the operation is complex, and no related kit for directly applying the quantitative PCR technology to detect the cell infiltration state of a PDX model mouse exists.
Disclosure of Invention
The invention aims to solve the technical problem of providing a double-fluorescence quantitative PCR kit for detecting the cell infiltration state of a mouse in a PDX model so as to detect the effectiveness of the PDX model.
The invention provides a primer and probe composition for detecting a cell infiltration state of a PDX model mouse by dual fluorescence quantitative PCR (polymerase chain reaction), which comprises a human primer, a probe, a mouse primer and a probe;
the human primers and the probes are as follows:
Human-PSMB 2-F：TCTCGTGCTGTGTCGGAC，
Human-PSMB 2-R：GGAGGCGACAAGAACATAGTC，
Human-PSMB 2-TaqMan：FAM-GGAGTACCTCATCGGTATCCAAGG-BHQ1；
the mouse primers and probes are as follows:
Mouse-Ren 2-F：CTCTGACAATCCTAGGGACTA，
Mouse-Ren 2-R：AAATGACACAATCACTCCAGT，
Mouse-Ren 2-TaqMan：HEX-ACGGCCATAATTAAGGGGT-BHQ1。
the human primers and probes are specific to human DNA template, and the mouse primers and probes are specific to mouse DNA template.
The invention also provides a double-fluorescence quantitative PCR detection kit for the cell infiltration state of the PDX model mouse, which comprises a PCR mixed system, wherein the PCR mixed system comprises the primer and the probe composition.
The kit also comprises standard products and ultrapure water with different cell ratios.
The standard substance with different cell ratios refers to that the ratio of the mouse cell amount to the human cell amount is 1%, 10% and 25%.
The total amount of the human primer and the mouse primer is 5-20mol respectively, and the total amount of the human probe and the mouse probe is 1mol respectively.
The fluorescent quantitative PCR amplification program comprises the following steps: denaturation at 94 ℃ for 5min and circulation.
The reaction conditions of the cycle are as follows: fluorescence was collected at 95 ℃ for 15s, 60 ℃ for 1min, and 72 ℃ for 30s, and at 72 ℃ for 40 cycles.
The invention also provides a detection method for detecting the cell infiltration state of the PDX model mouse by double fluorescence quantitative PCR, which comprises the following steps:
(1) configuring a fluorescent quantitative PCR reaction system, and preparing a sample: 18 mul PCR mixed system, 2 mul sample to be tested (the most suitable sample concentration is 10-25 ng/mul); positive control: 18. mu.l PCR mix system, 2. mu.l standard; negative control: 18. mu.l of PCR mixed system, 2. mu.l of ultrapure water;
(2) and (2) carrying out PCR amplification on the fluorescent quantitative PCR reaction system in the step (1).
The sample to be detected in the step (1) is cell extracted DNA or tissue extracted DNA.
The PCR amplification procedure in the step (2) is as follows: denaturation at 94 ℃ for 5min and circulation.
The parameters of the cycle are optimized reaction conditions: fluorescence was collected at 95 ℃ for 15s, 60 ℃ for 1min, and 72 ℃ for 30s, and 40 cycles were performed at 72 ℃.
Setting a threshold value after the PCR amplification in the step (2) is finished: and setting a threshold at the maximum slope (human Ct value 25-28) of the amplification curve of the positive standard, calculating the delta Ct [ (delta Ct ═ Ct (mouse) -Ct (human) ] of the standard after setting the threshold, and drawing a standard curve of the proportion of the delta Ct and the log sample according to the delta Ct of the three standards. And calculating the proportion of the mouse cells and the human cells in the PDX sample according to the standard curve.
The invention establishes a method for detecting the mouse infiltration state of a PDX model based on double fluorescence quantitative PCR, when the proportional relation of a human and mouse mixed sample in the PDX model is constant, the delta Ct value of the double fluorescence quantitative PCR is basically stable, so that the proportional relation of human and mouse cells in the PDX model can be deduced according to the delta Ct.
The invention selects human and mouse differential genes, wherein the human detection gene is PSMB 2, and the mouse detection gene is Ren 2.
In order to realize double fluorescent quantitative PCR detection of the cell infiltration state of a PDX model mouse, the invention selects two report fluorescent groups marked with different colors by using a TaqMan probe method so as to realize the double detection purpose.
The method has high detection sensitivity and accuracy, can detect the infiltration proportion of about 1 percent, is quick and efficient, and can be produced and popularized in large scale for detecting the effectiveness of the PDX model.
At present, most PDX model infiltration state detection adopts whole genome sequencing and then bioinformatics analysis, and the existing patent uses PCR and then electrophoresis for detection, and the operation is complex. The invention utilizes double fluorescence quantitative PCR to detect in a single tube, and adds a positive standard substance, thereby being capable of large-scale production and application, and the results of different batches are comparable, the operation is simple and convenient, and the results are sensitive and reliable.
Advantageous effects
(1) The invention utilizes double fluorescence quantitative PCR to detect the cell infiltration state of a PDX model mouse, selects TaqMan probes marked with two different colors to respectively mark human DNA and mouse DNA, has high detection sensitivity, and can monitor the infiltration proportion of about 1 percent. The TaqMan probe has strong specificity, avoids acquiring non-specific amplification signals and greatly improves the detection sensitivity.
(2) The quantitative PCR method is operated in a closed tube way in the whole process, has no product cross contamination and is simple to operate.
(3) As long as the proportional relation of human and mouse samples in the PDX model is constant, the invention can directly calculate the proportion of the human and mouse samples in the PDX model through the delta Ct, and the difference between different batches can be corrected due to the existence of the positive standard substance, so that the results of different batches have comparability.
(4) The kit for detecting the mouse cell infiltration state of the PDX model by the double-fluorescence quantitative PCR established by the invention can simply, quickly and accurately detect the human and mouse cell proportion in the PDX model.
Drawings
FIG. 1 is a schematic diagram of the detection of cell infiltration state of a PDX model mouse of the present invention.
FIG. 2 is a calibration curve of the positive standard in example 1 of the present invention.
FIG. 3 is a graph showing the quantitative results of the 1% impregnation ratio in example 2 of the present invention.
Detailed Description
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.
The primers and TaqMan probes were synthesized by general biosystems (Anhui) Inc., and a probe quantitative PCR mix system was purchased from nearshore protein technologies, Inc.
Example 1
A double-fluorescence quantitative PCR detection kit for detecting a cell infiltration state of a PDX model mouse comprises a PCR mixed system, standard products (the ratio of mouse cell amount to human cell amount is 1%, 10% and 25%) and ultrapure water with different cell ratios, wherein the PCR mixed system comprises human primers and probes, mouse primers and probes.
The human primers and probes are:
Human-PSMB 2-F：TCTCGTGCTGTGTCGGAC，
Human-PSMB 2-R：GGAGGCGACAAGAACATAGTC，
Human-PSMB 2-TaqMan：FAM-GGAGTACCTCATCGGTATCCAAGG-BHQ1；
the mouse primers and probes are:
Mouse-Ren 2-F：CTCTGACAATCCTAGGGACTA，
Mouse-Ren 2-R：AAATGACACAATCACTCCAGT，
Mouse-Ren 2-TaqMan：HEX-ACGGCCATAATTAAGGGGT-BHQ1。
the detection method comprises the following steps:
(1) preparing a fluorescent quantitative PCR reaction system, and preparing a sample: 18 μ l PCR mix, 2 μ l test sample, negative control: 18 μ l PCR mix, 2 μ l ultra pure water. The concentrations of human, mouse primer and probe in PCR mixed system (mixed system including human primer and probe, mouse primer and probe, PCR Mix and corrected fluorescence ROX) are all 50 μ M, wherein the upstream and downstream primers are 0.2 μ l each, the probe is 0.02 μ l each, PCR Mix10 μ l, and corrected fluorescence ROX is 0.4 μ l. The sample to be tested is cell extracted DNA or a mixture of tissue extracted DNA (the sample is a standard substance with different cell proportions (the proportion of the mouse cell quantity to the human cell quantity is 1 percent, 10 percent and 25 percent)).
(2) Cell or tissue extracted DNA:
1. each sample was placed into a clean 1.5ml EP tube, 400. mu.l LB lysis buffer and 10. mu.l proteinase K were added, mixed well and incubated at 65 ℃ for 2 hours on a shaker at 200rpm until the sample was completely lysed.
2. Add 400. mu.l GB binding buffer to the tube, blow and mix well 3-5 times. Transferring the mixture to adsorption column, placing the adsorption plate column in collection tube, and standing at room temperature for 10 min.
3. The adsorption plate column was centrifuged at 12000rpm for 2min and the waste liquid was discarded.
4. Add WB rinse buffer 150. mu.l to the column, centrifuge at 12000rpm for 2min and discard the waste.
5. Repeat step 4 twice.
6. Empty adsorption plate column and collection tube were idled, centrifuged at 12000rpm for 2min, and the waste liquid was discarded to completely dry the adsorption membrane.
8. The adsorption plate column was transferred to a new 1.5ml EP tube, 20 to 150. mu.l of eluent TE (eluent was added depending on the amount of DNA) was added to the center of the adsorption film, and the mixture was allowed to stand at room temperature for 10min and centrifuged at 12000rpm for 2 min. The resulting DNA solution was stored at-20 ℃ for a short period or at-80 ℃ for a long period.
(3) The PCR amplification procedure was: denaturation at 94 ℃ for 5min and circulation. The parameters of the cycle are the optimized reaction conditions: fluorescence was collected at 95 ℃ for 15s, 60 ℃ for 1min, and 72 ℃ for 30s, and at 72 ℃ for 40 cycles.
(4) Setting a threshold value after PCR amplification is finished: setting the threshold at the maximum slope of the amplification curve of the positive standard (human Ct value 25-28), and calculating the delta Ct [ delta Ct ═ Ct (mouse) -Ct (human) ] of the standard after setting the threshold]And drawing a standard curve of the ratio of the delta Ct to the log sample according to the delta Ct of the three standards, wherein as shown in figure 2 (a positive standard curve), a linear regression equation of the standard curve is as follows: y is-0.4061 XX +0.4089, correlation coefficient R 2 The number is 0.9998, which indicates that the correlation among the three positive standard substances is good and the detection result is accurate. Wherein X is a delta Ct value, Y is a log value of a human-mouse mixed sample ratio (the sample ratio is mouse cells: human cells) in the PDX model, and the ratio of the mouse cells to the human cells in the PDX sample to be detected can be calculated according to a standard curve.
Example 2
A kit for detecting a cell infiltration state of a PDX model mouse by using a dual-fluorescence quantitative PCR comprises three positive standard substances (1%, 10% and 25%) with different proportions, and is the same as the detection scheme in example 1, wherein a sample to be detected is 1% of the positive standard substances (the proportion of the amount of mouse cells to the amount of human cells is 1%). The kit has high sensitivity, and can detect the infiltration proportion of 1% at least, as shown in figure 3: the green fluorescence was measured for mouse samples and the blue fluorescence was measured for human samples. When the mouse sample only accounts for 1% of the human sample, the signal can still be detected by the fluorescent quantitative PCR.
The PCR amplification procedure of the kit is as follows: denaturation at 94 ℃ for 5min and circulation. The parameters of the cycle are the optimized reaction conditions: fluorescence was collected at 95 ℃ for 15s, 60 ℃ for 1min, and 72 ℃ for 30s, and at 72 ℃ for 40 cycles. The whole PCR process only needs about 2 hours, saves time and labor compared with the traditional bioinformatics analysis after whole genome sequencing, and can quickly obtain experimental data.
SEQUENCE LISTING
<110> university of east China
<120> double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse
<130> 1
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<400> 1
tctcgtgctg tgtcggac 18
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
ggaggcgaca agaacatagt c 21
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence
<400> 3
ggagtacctc atcggtatcc aagg 24
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
ctctgacaat cctagggact a 21
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
<210> 6
<211> 19
<212> DNA
<213> Artificial sequence
<400> 6
Claims (6)
1. A double fluorescence quantitative PCR detection PDX model mouse cell infiltration state primer and probe composition is characterized by comprising human primers, probes, mouse primers and probes;
the human primers and the probes are as follows:
Human-PSMB 2-F：TCTCGTGCTGTGTCGGAC，
Human-PSMB 2-R：GGAGGCGACAAGAACATAGTC，
Human-PSMB 2-TaqMan：FAM-GGAGTACCTCATCGGTATCCAAGG-BHQ1；
the mouse primers and probes are as follows:
Mouse-Ren 2-F：CTCTGACAATCCTAGGGACTA，
Mouse-Ren 2-R：AAATGACACAATCACTCCAGT，
Mouse-Ren 2-TaqMan：HEX-ACGGCCATAATTAAGGGGT-BHQ1。
2. a double-fluorescence quantitative PCR detection PDX model mouse cell infiltration state kit comprises a PCR mixed system, and is characterized in that the PCR mixed system comprises the primer and probe composition of claim 1.
3. The kit of claim 2, further comprising standards and ultrapure water at different cell ratios.
4. The kit of claim 3, wherein the standards of different cell ratios refer to ratios of 1%, 10% and 25% of the amount of murine cells to the amount of human cells.
5. The kit of claim 2, wherein the fluorescent quantitative PCR amplification procedure is: denaturation at 94 ℃ for 5min and circulation.
6. The kit of claim 5, wherein the cycling reaction conditions are: fluorescence was collected at 95 ℃ for 15s, 60 ℃ for 1min, and 72 ℃ for 30s, and at 72 ℃ for 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110146789.1A CN112899351B (en) | 2021-02-03 | 2021-02-03 | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110146789.1A CN112899351B (en) | 2021-02-03 | 2021-02-03 | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112899351A CN112899351A (en) | 2021-06-04 |
| CN112899351B true CN112899351B (en) | 2022-08-26 |
Family
ID=76121720
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110146789.1A Active CN112899351B (en) | 2021-02-03 | 2021-02-03 | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112899351B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2004236573A1 (en) * | 2003-05-12 | 2004-11-18 | Sarah Ferber | Methods of inducing regulated pancreatic hormone production in non-pancreatic islet tissues |
| CN101463389A (en) * | 2008-12-18 | 2009-06-24 | 东华大学 | Multiple quantitative RT-PCR gene expression spectrum analysis method based on fluorescent universal primer |
| WO2019060742A1 (en) * | 2017-09-22 | 2019-03-28 | Kymera Therapeutics, Inc | Protein degraders and uses thereof |
| CN110643727A (en) * | 2019-10-24 | 2020-01-03 | 东华大学 | Dual fluorescence quantitative PCR mycoplasma detection kit |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2265943A4 (en) * | 2008-03-22 | 2011-09-14 | Merck Sharp & Dohme | Methods and gene expression signature for assessing growth factor signaling pathway regulation status |
| US10993418B2 (en) * | 2012-08-13 | 2021-05-04 | Life Genetics Lab, Llc | Method for measuring tumor burden in patient derived xenograft (PDX) mice |
| KR102010632B1 (en) * | 2016-05-03 | 2019-08-13 | 에이비온 주식회사 | Reagent for detecting cross contamination of PDX-model related with human and mouse, the kit comprising the same, and the method for the cross contamination detection |
-
2021
- 2021-02-03 CN CN202110146789.1A patent/CN112899351B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2004236573A1 (en) * | 2003-05-12 | 2004-11-18 | Sarah Ferber | Methods of inducing regulated pancreatic hormone production in non-pancreatic islet tissues |
| CN101463389A (en) * | 2008-12-18 | 2009-06-24 | 东华大学 | Multiple quantitative RT-PCR gene expression spectrum analysis method based on fluorescent universal primer |
| WO2019060742A1 (en) * | 2017-09-22 | 2019-03-28 | Kymera Therapeutics, Inc | Protein degraders and uses thereof |
| CN110643727A (en) * | 2019-10-24 | 2020-01-03 | 东华大学 | Dual fluorescence quantitative PCR mycoplasma detection kit |
Non-Patent Citations (2)
| Title |
|---|
| Distribution of Subspecies of the House Mouse, Mus musculus (Rodentia: Muridae) in East China as Inferred from Mitochondrial D-loop Sequences;Tianzhu Chao等;《Pakistan Journal of Zoology》;20170612;第49卷(第4期);1151-1546页 * |
| 人源性肿瘤组织异种移植模型的研究进展;刘情等;《转化医学动态》;20140420;第3卷(第2期);65-68页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112899351A (en) | 2021-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108753974B (en) | Colorectal cancer tumor marker and detection method and device thereof | |
| CN107523646A (en) | Method based on nucleic acid mass-spectrometric technique detection early diagnosing mammary cancer related gene | |
| CN112899351B (en) | Double-fluorescence quantitative PCR detection kit for detecting cell infiltration state of PDX model mouse | |
| CN106967810B (en) | Method and kit for detecting FGFR3 gene mutation to diagnose bladder cancer | |
| CN108315481A (en) | A kind of diagnostic method and dedicated kit detecting Porcine epidemic diarrhea virus using direct expansion method | |
| CN108085417A (en) | A kind of yak coronavirus detection kit and application based on constant temperature isolation type fluorescent PCR platform | |
| CN111187842A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN104316705B (en) | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone | |
| CN109321569B (en) | Primer probe composition and application thereof | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN113355423B (en) | Primer probe and kit for detecting mutation of EGFR gene L858R and application of primer probe and kit | |
| CN116042914A (en) | Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus | |
| CN109971886A (en) | A kind of kit for detecting CPV nucleic acid, RPA primer pair, probe and method | |
| CN116355995A (en) | Method for detecting distribution of humanized cell products in animal body | |
| CN113106156A (en) | IDH1R132H gene mutation real-time fluorescence quantitative PCR detection reagent and method | |
| CN114480737B (en) | FAdV-4 NP strain specific primer and application thereof in recombinase-mediated isothermal nucleic acid amplification detection | |
| CN110241186A (en) | Detect the binary channels real-time fluorescent quantitative RT-PCR method of GATA3 gene relative expression quantity | |
| CN109337962A (en) | Primer and probe and its kit and method based on fluorescence quantitative PCR detection sturgeon | |
| CN113373266B (en) | Fluorescent RPA primer, kit and detection method for detecting sheep pulmonary adenomatosis virus | |
| CN116064792B (en) | Multi-gene DNA methylation joint detection kit for colorectal cancer diagnosis and application | |
| CN116083581B (en) | Kit for detecting early digestive tract tumor | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| CN111471751B (en) | Method for quantitatively detecting human DNA in animal blood or tissue | |
| CN105969874A (en) | Primer combination for detecting mutation of KRAS gene in trace tissue and application of primer combination | |
| CN113687068A (en) | Tumor single cell double-fluorescence labeling detection kit, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |