CN116042914A - Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus - Google Patents
Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus Download PDFInfo
- Publication number
- CN116042914A CN116042914A CN202211155152.XA CN202211155152A CN116042914A CN 116042914 A CN116042914 A CN 116042914A CN 202211155152 A CN202211155152 A CN 202211155152A CN 116042914 A CN116042914 A CN 116042914A
- Authority
- CN
- China
- Prior art keywords
- electrode
- asfv
- spce
- solution
- nps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/416—Systems
- G01N27/48—Systems using polarography, i.e. measuring changes in current under a slowly-varying voltage
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to the field of detection of swine infectious viruses, and discloses a preparation method and application of a disposable electrochemical sensor of African swine fever virus ASFV based on in-situ loop-mediated isothermal amplification LAMP. The electrochemical workstation is used for collecting current signals, and a simple, economical and efficient method is provided for diagnosis of ASFV. The method comprises the following steps: step 1, constructing a miniature pool; step 2, preparing a modified electrode; step 3, constructing an electrochemical biosensor for detecting ASFV based on a loop-mediated isothermal amplification technology; and 4, electrochemically detecting ASFV. The electrochemical biosensor based on the LAMP strategy constructed by the invention combines LAMP and electrochemical detection to replace the traditional fluorescence sensing detection scheme, so that the whole detection system is miniaturized and simplified. In addition, the electrochemical detection method disclosed by the invention takes the current value as the signal output, has stable performance, realizes the sensitive detection of ASFV, and simultaneously electrodeposits gold nanoparticles on the screen printing electrode, thereby further improving the sensitive detection of detection.
Description
Technical Field
The invention belongs to the field of porcine infectious virus detection, and mainly relates to a method for detecting a disposable electrochemical biosensing of African Swine Fever Virus (ASFV) based on loop-mediated isothermal amplification (LAMP).
Background
African swine fever is an acute, highly fatal swine infectious disease caused by ASFV. ASFV is not infectious to humans, but is very deadly to pigs and various wild boars. The disease first appears in 1921 in kennia, africa, and since 2007, swine fever has occurred, spread and spread in many countries and regions of the world. In 2018, the first african swine fever occurred in china, and then viruses spread rapidly to most areas of china. As no effective ASFV vaccine and pharmaceutical treatment has been developed to date, ASFV causes great economic losses to the country and animal husbandry, in a very serious situation. ASFV is a large double stranded DNA virus with a genome length of about 170-190kbp, encoding about 150-200 proteins. The research shows that p54 coded by E183L gene is an important structural protein of ASFV and plays an important role in rapid invasion and adsorption of susceptible cells, so that the detection of p54 is of great significance. The most commonly used method for detecting p54 is an enzyme-linked immunosorbent assay, but the method is complex in operation and low in specificity and sensitivity. Therefore, the establishment of a rapid and sensitive p54 protein ASFV detection method has important value for realizing the early detection and separation of ASFV and reducing the loss of pig industry.
In recent years, LAMP has attracted considerable attention as a powerful tool for nucleic acid amplification. LAMP, which is a method for replacing PCR, overcomes the defects of the traditional PCR, does not need a thermal cycling device to regulate the temperature to carry out a complex temperature change process, and has higher specificity because 4 primers are used and can identify 6-8 independent areas which are specific to a specific target area. In addition, the LAMP has high LAMP speed and high amplification efficiency under the action of DNA polymerase. Therefore, by combining the advantages of LAMP, simple, rapid and accurate gene detection can be realized.
Electrochemical sensing is widely used in clinical laboratories because of its simple operation and excellent analytical performance. Because of these advantages, the LAMP technique can be combined with electrochemical techniques to construct further biosensing tools for sensitive detection. Under the push of the existing electrochemical sensing technology and the research of the LAMP technology, we are dedicated to developing a portable and disposable electrochemical biosensor based on the LAMP and the electrochemical technology for detecting ASFV. LAMP is introduced into an electrochemical sensor, in-situ amplification is realized on the surface of a screen-printed carbon electrode (SPCE), and a redox probe is introduced for signal output. In addition, gold nanoparticles (AuNPs) are electrodeposited on the electrode, so that a current signal can be amplified, and the sensitivity of the sensor is remarkably improved.
Therefore, the portable throwable electrochemical biosensor which uses the electrodeposition AuNPs on the SPCE electrode as the substrate for LAMP in-situ amplification is constructed, and the sensor can be used for ultrasensitive detection of ASFV p54 genome DNA, and has high specificity and high accuracy. The related technology has not been reported.
Disclosure of Invention
The invention aims to provide ASFV sensitive detection based on LAMP strategy electrochemical biosensing, which integrates the advantages of rapidness, simplicity, low cost and the like, combines LAMP with an electrochemical technology, and deposits Au NPs on SPCE to construct a biosensing tool for further application.
The invention combines LAMP signal amplification and electrochemical sensing to construct a portable disposable electrochemical biosensor for detecting ASFV based on LAMP in-situ amplification. The invention modifies primer with sulfhydryl group on electrode to carry out subsequent in situ LAMP, uses dsDNA/Au NPs/SPCE as electrode interface, realizes the purposes of low cost, simple process and rapid detection of ASFV, provides a simple, economical and efficient method for ASFV diagnosis, and simultaneously provides a new idea for constructing novel biosensing detection by combining LAMP with electrochemistry.
A preparation method of a disposable electrochemical sensor based on in-situ amplification African swine fever virus comprises the following steps:
step 1, electrode pretreatment:
containing 0.5. 0.5M H in 5mL 2 SO 4 And cleaning a screen printing carbon electrode SPCE in a solution of 0.1M KCl, performing Cyclic Voltammetry (CV), setting the scanning range to be-0.2-1.5V and the scanning speed to be 100mV/s, obtaining a stable cyclic voltammetry curve, eluting with secondary water, and drying with nitrogen for later use;
the surface of the screen printing carbon electrode SPCE is provided with a central electrode area and a peripheral non-electrode area; the electrode area comprises a carbon working electrode (diameter 3 mm), a carbon auxiliary electrode and an Ag/AgCl reference electrode;
covering a layer of Polydimethylsiloxane (PDMS) film (thickness 3-5 mm) on the non-electrode area of the SPCE pretreated in the step 1 to form a micro-cell;
step 3, preparing a modified electrode:
electrodepositing gold nano-particles Au NPs on the carbon working electrode in the electrode area of the SPCE in the step 2 to prepare an Au NPs modified SPCE working electrode, which is marked as Au NPs/SPCE;
step 4, construction of electrochemical biological sensing:
dripping the Primer mixed solution on the surface of an Au NPs/SPCE electrode, after reacting for a period of time, leaching with PBS to remove excessive unbound primers, and finally obtaining an electrode with the primers, which is marked as Primer/Au NPs/SPCE;
step 5, in situ LAMP of ASFV:
and (3) uniformly mixing the nucleic acid amplification reaction solution and the ASFV standard sample, then dripping the mixture on the surface of the Primer/Au NPs/SPCE electrode prepared in the step (4), and then placing the electrode on a heater for incubation for a period of time to obtain an amplification product dsDNA/Au NPs/SPCE connected by sulfhydryl groups, thereby forming the in-situ amplification-based disposable electrochemical sensor of the African swine fever virus.
In step 3, the specific operation of electrodepositing Au NPs is:
in freshly prepared 2mM HAuCl 4 In the solution, the low potential and the high potential are respectively-0.2V and 1.2V, the scanning speed is 100mV/s, -0.2V is the initial potential and the end potential, au NPs/SPCE is obtained by electro-deposition for 40 circles, ultra-pure water is used for leaching, and nitrogen is used for drying.
In the step 4 of the process, the process is carried out,
4 primers of ASFV p54 gene (Genbank: MN 207060.1) were designed using primer V5 on-line software: thiol-modified forward inner primer SH-FIP, reverse inner primer BIP, forward outer primer F3, reverse outer primer B3, synthesized by Shanghai, inc.;
the 4 primer sequences are respectively as follows:
SH-FIP：SH-TGCTGGTCTGTTTGTTGCCGGGGAGCGACTACAGCAAGTG；
BIP：AGACTAGTCATGGCAACTGGCGCGGATGAGCAGGAGCACT；
F3：TCCACAACCAGGTACCTCTA；
B3：AGTGACTGTCGTGTAAGGCT；
in step 4, the preparation steps of the primer mixture solution are as follows:
SH-FIP, BIP, F solution and B3 solution with the concentration of 100 mu M are mixed into primer solution according to the volume ratio of 8:8:1:1, and then the primer solution is mixed with trehalose solution and double steam water according to the volume ratio of 1:1:4 to form primer mixed solution;
the amount of the primer mixture was 6. Mu.L, the reaction time was 2 hours, and the reaction temperature was 37 ℃.
In the step 5 of the process,
the volume ratio of ASFV standard sample to nucleic acid amplification reaction solution is 1:4, wherein the ASFV standard sample concentration is 10 -12 -10 -6 The mixed liquid drop adding amount of g/L, nucleic acid amplification reaction liquid and ASFV is 5 mu L;
the heating and incubation temperature is 63 ℃ and the time is 45min; nucleic acid amplification reaction solutions were purchased from Shanghai rapid-invasive diagnostic products Co.
The application of the disposable electrochemical biosensor based on the loop-mediated isothermal amplification for detecting ASFV, which is prepared by the invention, comprises the following specific steps:
(S1) to the resulting micro cell constructed in the non-electrode region of the sensor, 5.0mM of [ Fe (CN) was added 6 ] 3-/4- And 0.1M KCl in PBS buffer, and the CV signals were collected using an electrochemical workstation; making a standard curve of the current value and the logarithmic value of the ASFV standard sample concentration;
(S2) uniformly mixing an ASFV positive sample solution with unknown concentration and a nucleic acid amplification reaction solution, then dripping the mixture on the surface of a Primer/Au NPs/SPCE electrode, then placing the electrode on a heater for incubation for a period of time to obtain an amplified product dsDNA/Au NPs/SPCE connected by sulfhydryl, collecting a current signal by adopting an S1 method, and substituting the current signal into a standard curve to obtain the concentration of the ASFV positive sample.
In the step (S1), the testing range is-0.2-0.6V and the scanning speed is 100mV/S during CV measurement; the PBS buffer solution used was 100mm in concentration, ph=7.4;
in the step (S2), the volume ratio of the ASFV positive sample solution to the nucleic acid amplification reaction solution is 1:4, the mixed liquid drop adding amount of the nucleic acid amplification reaction liquid and the ASFV is 5 mu L; the incubation temperature was 63℃and the time was 45min.
The beneficial effects of the invention are as follows:
the invention takes SPCE as a substrate, a region for depositing Au NPs as a working electrode, and successfully establishes a method for detecting ASFV by electrochemical biosensing based on in-situ LAMP, which has the following characteristics and advantages:
(1) The invention takes SPCE as a working electrode and comprises a carbon working electrode (3 mm), a carbon auxiliary electrode and an Ag/AgCl reference electrode. The electrochemical workstation is adopted to detect the current signal, and the output performance is stable.
(2) The invention deposits Au NPs on the working electrode of SPCE, further improves the sensitivity of the prepared biosensor.
(3) The electrochemical biological sensing detection method provided by the invention realizes the sensitive detection of ASFV, which is 10 -12 -10 -6 In the g/L range, the logarithmic value of ASFV concentration (lg C p54 ) And the current signal output value of the electrochemical workstation shows good linear relation.
(4) The invention constructs a novel electrochemical biosensor based on LAMP, which is used as an alternative scheme of fluorescence-based optical sensing detection, so that a detection system is miniaturized and simplified. In particular, the combination of LAMP and electrochemical detection provides a simple, economical and rapid method for nucleic acid-based molecular diagnosis.
Drawings
FIG. 1 is a mechanism diagram of a constructed electrochemical biosensing;
FIG. 2 shows CV spectra (A) of electrodes before modification (a) and after modification (b) of AuNPs in an impedance solution and modified electrodes at 0.5. 0.5M H 2 SO 4 CV pattern in (B)
FIG. 3 (A) XPS spectra of Au 4f corresponding to bare SPCE (a) and AuNPs modified SPCE (B), XPS spectra of Au 4f of (a) before (B) primer modification and (B) electrode after modification;
FIG. 4 (A) different ASFV p54 concentrations (a-h: 10 -13 ，10 -12 ，10 -11 ，10 -10 ，10 -9 ，10 -8 ，10 -7 ，10 -6 g/L) CV response of the biosensor after LAMP reaction; (B) A plot of ASFV standard sample concentration versus value versus current signal.
Detailed Description
The present invention will be described in detail with reference to examples, but the present invention is not limited to these examples.
FIG. 1 is a schematic diagram of a mechanism of a constructed electrochemical biosensing.
Example 1:
(1) Preparation of modified electrode
Containing 0.5. 0.5M H in 5mL 2 SO 4 And cleaning SPCE in 0.1M KCl solution, performing CV scanning until an overlapped cyclic voltammogram is obtained by scanning, setting the scanning range to-0.2-1.5V, and the scanning speed to 100mV/s, eluting with secondary water, and drying with nitrogen for later use; covering a layer of Polydimethylsiloxane (PDMS) film with the thickness of 3mm on the non-electrode area of the surface of the SPCE after pretreatment to form a micro-cell; au NPs were electrodeposited on the working electrode region of SPCE to produce Au NPs modified SPCE working electrode (Au NPs/SPCE), the characterization of which is shown in a of fig. 2 and 3.
As can be seen from the curve in FIG. 2A, the bare SPCE electrode (curve a) did not observe a distinct redox peak, as compared to the AuNPs surface-modified electrode(Curve b) there is a pronounced redox peak current, which is mainly due to the excellent conductivity properties of AuNPs. In addition, the electrodes before and after AuNPs modification were subjected to 0.5M H 2 SO 4 As can be seen from fig. 2B, two distinct peaks are observed from the CV diagram of AuNPs-SPCE, an oxidation peak of gold occurring around 1.2V, and another reduction peak of gold occurring at 0.6V, as compared to the bare electrode.
In FIG. 3A, au 4f XPS spectra of bare SPCE and Au NPs-SPCE directly demonstrate successful deposition of Au NPs on the SPCE surface. The curve of bare SPCE has no characteristic peak of Au (curve a of FIG. 3A), whereas the XPS spectrum of Au NPs-SPCE has a pair of peaks at 84.0 and 87.7eV (curve b of FIG. 3A), corresponding to Au atom 4f 7/2 And 4f 5/2 Energy level, indicating that Au is electrodeposited on the SPCE surface.
(2) Construction of electrochemical biosensing
SH-FIP, BIP, F solution and B3 solution with the concentration of 100 mu M are mixed into primer solution according to the volume ratio of 8:8:1:1, and then the primer solution is mixed with trehalose solution and double steam water according to the volume ratio of 1:1:4 to form primer mixed solution;
dropping 6 mu L of the Primer mixture solution on the surface of an Au NPs/SPCE electrode, reacting for 2 hours at 37 ℃, eluting with PBS to remove excessive unbound Primer, finally obtaining an electrode with the Primer (Primer/Au NPs/SPCE), adding the Primer mixture solution on the surface of the Au NPs-SPCE electrode, fixing the Primer mixture solution through Au-S covalent bond and adsorption, and fixing the P 2p XPS spectrum demonstrates that the primer had immobilized on the Au NPs-SPCE electrode surface, a characteristic peak of P appeared (curve b), whereas SPCE did not have a characteristic peak of P (curve a). (3) in situ LAMP of ASFV:
and (3) uniformly mixing a nucleic acid amplification reaction solution and an ASFV standard sample, dripping 5 mu L of the mixture on the surface of the Primer/Au NPs/SPCE electrode prepared in the step (4), and then placing the electrode on a heater for incubation at 63 ℃ for 45min to obtain an amplification product dsDNA/Au NPs/SPCE connected by sulfhydryl groups, thereby forming the in-situ amplification-based disposable electrochemical sensor of the African swine fever virus.
Electrochemical biosensing detection ASFV based on in-situ loop-mediated isothermal amplification
ASFV standard samples of different concentrations were mixed with the nucleic acid amplification reaction solution in a ratio of 1:4, after which 5. Mu.L of ASFV-containing standard sample at a concentration of 10 -13 ，10 -12 ，10 -11 ，10 -10 ，10 -9 ，10 -8 ，10 -7 ，10 -6 And g/L of the mixed solution is respectively dripped on the surfaces of the Primer/Au NPs/SPCE electrodes to carry out in-situ LAMP reaction. Finally, dsDNA/Au NPs/SPCE was placed in a solution containing 5.0mM [ Fe (CN) 6 ] 3-/4- And 0.1M KCl in PBS buffer, CV signals were collected using an electrochemical workstation.
Under the optimized condition, the performance of the prepared electrochemical biosensor is analyzed, and the detection result is shown in fig. 4:
FIG. 4A shows the concentration of ASFV p54 (a-h: 10 -13 ，10 -12 ，10 -11 ，10 -10 ，10 -9 ，10 -8 ，10 -7 ，10 -6 g/L) the CV response of the biosensor after LAMP reaction, as expected, the current signal decreased with increasing p54 concentration. FIG. 4B is a graph of ASFV standard concentration vs. current signal, resulting in a linear relationship between current signal and p54 concentration logarithm, where the linear equation is current signal=15.64-5.68× (lgC (g/L) (R) 2 =0.996). Linear concentration range of 10 -12 -10 -6 g/L (about 1.6X10) 0 -1.6×10 6 copies/μL)。
Claims (10)
1. The preparation method of the disposable electrochemical sensor based on the in-situ amplification African swine fever virus is characterized by comprising the following steps:
step 1, electrode pretreatment:
in the presence of H 2 SO 4 Cleaning a screen printing carbon electrode SPCE in a KCl solution, performing cyclic voltammetry scanning to obtain a stable cyclic voltammetry curve, eluting with secondary water, and drying with nitrogen for later use;
the surface of the screen printing carbon electrode SPCE is provided with a central electrode area and a peripheral non-electrode area; the electrode area comprises a carbon working electrode, a carbon auxiliary electrode and an Ag/AgCl reference electrode;
step 2, constructing a miniature pool:
covering a layer of Polydimethylsiloxane (PDMS) film on the non-electrode area of the SPCE pretreated in the step 1 to form a micro-cell;
step 3, preparing a modified electrode:
electrodepositing gold nano-particles Au NPs on the carbon working electrode in the electrode area of the SPCE in the step 2 to prepare an Au NPs modified SPCE working electrode, which is marked as Au NPs/SPCE;
step 4, construction of electrochemical biological sensing:
dripping the Primer mixed solution on the surface of an Au NPs/SPCE electrode, after reacting for a period of time, leaching with PBS to remove excessive unbound primers, and finally obtaining an electrode with the primers, which is marked as Primer/Au NPs/SPCE;
step 5, in situ LAMP of ASFV:
and (3) uniformly mixing the nucleic acid amplification reaction solution and the ASFV standard sample, then dripping the mixture on the surface of the Primer/Au NPs/SPCE electrode prepared in the step (4), and then placing the electrode on a heater for incubation for a period of time to obtain an amplification product dsDNA/Au NPs/SPCE connected by sulfhydryl groups, thereby forming the in-situ amplification-based disposable electrochemical sensor of the African swine fever virus.
2. The method of claim 1, wherein,
in step 1, H is contained 2 SO 4 And KCl in solution, H 2 SO 4 Is 0.5M and KCl is 0.1M; containing H 2 SO 4 And KCl in an amount of 5mL; the cyclic voltammetry scanning range is set to be-0.2-1.5V, and the scanning rate is 100mV/s; the diameter of the carbon working electrode is 3mm;
in step 2, the thickness of the polydimethylsiloxane PDMS film is 3-5mm.
3. The method of claim 1, wherein,
in step 3, the specific operation of electrodepositing Au NPs is: in freshly prepared 2mM HAuCl 4 In the solution, adoptThe low potential and the high potential are respectively-0.2V and 1.2V, the scanning speed is 100mV/s, the-0.2V is the initial potential and the termination potential, 40 circles of Au NPs/SPCE are obtained by electrodeposition, the Au NPs/SPCE is leached by ultrapure water, and the Au NPs/SPCE is dried by nitrogen for standby.
4. The method of claim 1, wherein,
in step 4, 4 primers of the ASFV p54 gene were designed using primer V5 on-line software: thiol-modified forward inner primer SH-FIP, reverse inner primer BIP, forward outer primer F3 and reverse outer primer B3; the sequences of the 4 primers are respectively as follows:
SH-FIP：SH-TGCTGGTCTGTTTGTTGCCGGGGAGCGACTACAGCAAGTG；
BIP：AGACTAGTCATGGCAACTGGCGCGGATGAGCAGGAGCACT；
F3：TCCACAACCAGGTACCTCTA；
B3：AGTGACTGTCGTGTAAGGCT。
5. the method of claim 1, wherein in step 4, the primer mixture solution is prepared by the steps of:
SH-FIP, BIP, F solution and B3 solution with the concentration of 100 mu M are mixed into primer solution according to the volume ratio of 8:8:1:1, and then the primer solution is mixed with trehalose solution and double steam water according to the volume ratio of 1:1:4 to form primer mixed solution;
the amount of the primer mixture was 6. Mu.L, the reaction time was 2 hours, and the reaction temperature was 37 ℃.
6. The method of claim 1, wherein,
in the step 5, the volume ratio of the ASFV standard sample to the nucleic acid amplification reaction solution is 1:4, wherein the ASFV standard sample concentration is 10 -12 -10 -6 g/L。
7. The method of claim 1, wherein,
in the step 5, the mixed liquid drop adding amount of the nucleic acid amplification reaction liquid and the ASFV is 5 mu L; the temperature of the heated incubation was 63℃for 45min.
8. Use of the in situ amplified african swine fever virus-based disposable electrochemical sensor prepared by the preparation method of any one of claims 1 to 7 for detecting ASFV.
9. The use according to claim 8, characterized by the specific steps of:
(S1) to a micro cell constructed in a non-electrode region of the sensor obtained in claim 1, a solution containing 5.0mM of [ Fe (CN) 6 ] 3-/4- And 0.1M KCl in PBS buffer, and the CV signals were collected using an electrochemical workstation; making a standard curve of the current value and the logarithmic value of the ASFV standard sample concentration;
(S2) uniformly mixing an ASFV positive sample solution with unknown concentration and a nucleic acid amplification reaction solution, then dripping the mixture on the surface of a Primer/Au NPs/SPCE electrode, then placing the electrode on a heater for incubation for a period of time to obtain an amplified product dsDNA/Au NPs/SPCE connected by sulfhydryl, collecting a current signal by adopting a step S1 method, and substituting the current signal into a standard curve to obtain the concentration of the ASFV positive sample.
10. The use according to claim 9, wherein in step (S1), the measurement is carried out at a CV measurement in the range of-0.2 to 0.6V, at a scan rate of 100mV/S; the PBS buffer solution used was 100mm in concentration, ph=7.4;
in the step (S2), the volume ratio of the ASFV positive sample solution to the nucleic acid amplification reaction solution is 1:4, the mixed liquid drop adding amount of the nucleic acid amplification reaction liquid and the ASFV is 5 mu L; the incubation temperature was 63℃and the time was 45min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211155152.XA CN116042914A (en) | 2022-09-22 | 2022-09-22 | Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211155152.XA CN116042914A (en) | 2022-09-22 | 2022-09-22 | Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116042914A true CN116042914A (en) | 2023-05-02 |
Family
ID=86120641
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211155152.XA Pending CN116042914A (en) | 2022-09-22 | 2022-09-22 | Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116042914A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116908265A (en) * | 2023-09-11 | 2023-10-20 | 常州先趋医疗科技有限公司 | Preparation method of electrochemical biosensor for detecting LAMP amplification products of nucleic acids |
-
2022
- 2022-09-22 CN CN202211155152.XA patent/CN116042914A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116908265A (en) * | 2023-09-11 | 2023-10-20 | 常州先趋医疗科技有限公司 | Preparation method of electrochemical biosensor for detecting LAMP amplification products of nucleic acids |
| CN116908265B (en) * | 2023-09-11 | 2023-12-12 | 常州先趋医疗科技有限公司 | Preparation method of electrochemical biosensor for detecting LAMP amplification products of nucleic acids |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10605761B2 (en) | Electrochemical biosensor based on aptamer/nano silver probe and EXO I enzyme | |
| CN109738500B (en) | The preparation method of nano-complex and its label-free aptamer electrochemistry gamma interferon sensor | |
| CN110716040B (en) | Preparation and application of MXene nanosheet photo-thermal amplification-based adjacent hybridization dual-mode immunosensor | |
| CN110736777B (en) | electrochemical-ELISA immunosensor based on rolling circle amplification DNA enzyme and covalent organic framework | |
| WO2020114124A1 (en) | Electrochemiluminescence biosensor based on luminol double catalyzed by aunps and mxenes | |
| CN110146566A (en) | Modified electrode, combination product and its electroluminescent chemiluminescence biosensor and application | |
| CN114295694B (en) | Electrochemiluminescence aptamer sensor for detecting breast cancer HER-2 and detection method thereof | |
| CN111440851A (en) | Electrochemical biosensor for detecting miRNA and preparation method and application thereof | |
| CN108051492B (en) | A method of based on controllable self assembly forceps constructions Electrochemical Detection single-stranded target DNA | |
| CN109115845A (en) | Self energizing miRNA biosensor and its application based on PEFC | |
| CN116042914A (en) | Preparation method and application of in-situ amplification-based jettisonable electrochemical sensor for African swine fever virus | |
| CN113686934A (en) | CRISPR/Cas12a-RCA electrochemical sensor detection system and application thereof | |
| Wang et al. | Ultrasensitive electrochemical DNA biosensor based on a tetrahedral structure and proximity-dependent surface hybridization | |
| CN109613095A (en) | Terminal enzyme (DNA) electrochemica biological sensor preparation method and application based on i-motif change of configuration | |
| Cheng et al. | Hairpin probes based click polymerization for label-free electrochemical detection of human T-lymphotropic virus types II | |
| Raoof et al. | Development of a DNA biosensor based on MCM41 modified screen-printed graphite electrode for the study of the short sequence of the p53 tumor suppressor gene in hybridization and its interaction with the flutamide drug using hemin as the electrochemical label | |
| CN105567808B (en) | The copper nano particles synthetic method and its application in Electrochemical Detection that rolling circle amplification product is template | |
| CN109682875B (en) | Nucleic acid electrochemical detection system and detection method for hepatocellular carcinoma screening | |
| CN110591904A (en) | Device for detecting miRNA | |
| CN114441616A (en) | Method for modifying new coronavirus biological probe on electrochemical biosensor | |
| Zhang et al. | Enzyme‐free Recycling Amplification‐based Sensitive Electrochemical Thrombin Aptasensor | |
| CN104316705B (en) | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone | |
| CN107228892B (en) | Electrochemistry mercury ion sensor of temperature-controllable and preparation method thereof | |
| CN110470712A (en) | A kind of miRNA detection device based on generation DNA nano flower in channel | |
| Zhang et al. | Target‐cycling synchronized rolling circle amplification strategy for biosensing Helicobacter pylori DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |