CN104316705B - A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone - Google Patents
A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone Download PDFInfo
- Publication number
- CN104316705B CN104316705B CN201410628402.6A CN201410628402A CN104316705B CN 104316705 B CN104316705 B CN 104316705B CN 201410628402 A CN201410628402 A CN 201410628402A CN 104316705 B CN104316705 B CN 104316705B
- Authority
- CN
- China
- Prior art keywords
- electrode
- acridone
- sulfo group
- dinitro
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6806—Determination of free amino acids
- G01N33/6812—Assays for specific amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Electrochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Computational Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone, and as indicator, a kind of preparation method of the electrochemica biological sensor based on " film modified electrode ", " circulation of exonuclease III auxiliary target sequence " and " DNA is long apart from formula self assembly " triple signal amplification techniques is provided, and uses it for ultra-high sensitive, the high specific detection of the relevant target sequence c-erbB-2 related gene of lung cancer. Does is the range of linearity of this sensor 2? aM ~ 50? fM, does detection limit reach 0.5? aM, and can identify preferably complete complementary and mismatch, can realize the detection of super low loading target sequence in clinical practice Sera of Lung Cancer sample.
Description
Technical field
The present invention relates to a kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone, belong toOrganic synthesis field.
Background technology
Lung cancer is one of major malignant tumor threatening in the world human life, and its M & M year by year in recent yearsRise, occupied first of malignant tumour, wherein non-small cell lung cancer (non-smallcelllungcancer, NSCLC) accounts for80% of all lung cancer. At present, obtained greater advance for the research of lung cancer therapy, but 5 years total survival rates of lung cancer still only have15%, even if I A is phase NSCL patient, within postoperative 5 years, survival rate also only has 80%. Therefore, the Rapid&Early diagnosis of lung cancer is for treatment sideSelection and the prognostic evaluation of case are most important.
In recent years, along with the development of the technology such as biochemistry, molecular biology and immunology, constantly dark to lung cancer researchEnter, medical workers are obtaining breakthrough aspect the screening of lung cancer tumor markers, have found at present multiple and lung cancerThe relevant mark such as albumen, gene, particularly tumor markers c-erbB-2 etc. Have researcher to find, c-erbB-2 existsUnconventionality expression in Serum of Patients with Lung Cancer, and stable in properties, become the novel tumor mark of reliable early diagnosis lung cancer just graduallyOne of thing. Many scholars study the gene marker in close relations with NSCLC by PCR method from gene level. AlthoughPCR can realize the quantitative detection of gene expression, but owing to existing, operating process is loaded down with trivial details, cost is high, need special technical staffEtc. shortcoming, limit and detected the application in clinical lung cancerous diagnose. Therefore, develop a kind of easy, quick, sensitive, economic c-ErbB-2 detection technique has extremely wide application prospect, will be expected to solve this clinical urgent reality of NSCLC early diagnosisBorder problem, is extremely important.
Biology sensor is to utilize biologic specificity identifying to survey the sensing of protein, gene, antibody, toxin etc.Detector is Measurement for Biotechnique of new generation. Wherein electrochemica biological sensing is by biomaterial (DNA, enzyme, antigen, thinBorn of the same parents, tissue etc.) as sensing element, electrode is as conversion element, the sensor taking electromotive force or electric current as feature detection signal, itsThe selectivity of biomolecule identification has determined that this sensor has high selectivity. Therefore, scholars have designed much for inspectionSurvey the electrochemica biological sensing strategy of DNA. Although these sensing strategy can realize the sensitive specific detection of DNA, also existFollowing defect: 1) complicated and time consumption, lacks economy. 2) traditional indicator exists expensively, all can do with single double-stranded DNAWith, hybridization check specificity is not high. 3) less stable. 4) some functional group's labeling method, background signal is large, and sensitivity is low.5) false positive and false-negative phenomenon are still inevitable. These electric bio-sensing strategies are wanted to replace clinical in actual sample detectsConventional art, still faces huge difficulty. Therefore, be necessary to continue a kind of electrochemica biological sensing new method of research.
Described below a kind ofly novel have compared with highly-water-soluble and electro-chemical activity for the inventor designs and synthesizesAcridone derivatives-" 5,7-dinitro-2-sulfo group-acridone ", and as hybridization indicator, developed a kind of mensurationThe electrochemical sensor of c-erbB-2 related gene---based on " film modified electrode ", " exonuclease III auxiliary target sequence is followedRing " and the electrochemica biological sensor of " DNA grow apart from formula self assembly " triple signal amplification techniques: 1B is modified to glass carbonElectrode surface, is fixed to hair fastener DNA probe on the terminal carboxyl group of polylysine by covalent modification method. By DNA probe withThe hybridization of target DNA, then after exonuclease III cutting circulation, flexible short oligonucleotide sequence is left on modified electrode surface,It can form super sandwich structure with assist probes Gene A P1 and AP2 hybridization, selects 5,7-dinitro-2-sulfo group-acridoneAs hybridization indicator, it can be embedded in the double-spiral structure of DNA, successfully realizes the electrochemical student of triple signal amplification techniquesThe development of thing sensor. Because polylysine contains carboxyl, be conducive to fixing at electrode surface of DNA, " polylysine is good in additionGood electric conductivity ", " circulation of exonuclease III auxiliary target sequence " and " DNA grows apart from formula self assembly " all greatly strengthened biographyThe detection sensitivity of sensor. Thereby set up the c-erbB-2 related gene testing method of high sensitivity, high specific. From now on,We will be successfully applied on the basis of lung cancer early diagnosis in this new technology, are applied to examining in early days of other types tumourBreak and screen in anti-cancer agent work, thereby the present invention has huge potential using value and profound significance.
Summary of the invention
The object of the present invention is to provide a kind of hybridization indicator 5, the preparation method of 7-dinitro-2-sulfo group-acridoneAnd purposes, provide a kind of based on " film modified electrode ", " circulation of exonuclease III auxiliary target sequence " with " DNA grows apart from formula from groupDress " preparation method of electrochemica biological sensor of triple signal amplification techniques, and use it for the relevant target sequence c-of lung cancerUltra-high sensitive, the high specific of erbB-2 related gene detect.
For achieving the above object, the present invention adopts following technical scheme:
A kind of hybridization indicator 5,7-dinitro-2-sulfo group-acridone, described 5,7-dinitro-2-sulfo group-acridone knotStructure formula is。
A kind of hybridization indicator 5, the preparation method of 7-dinitro-2-sulfo group-acridone, described step is: take 0.6gAcridone, adds the dense H of 5mL2SO4, after stirring and dissolving, be heated to 100 DEG C of reaction 30min, while hot solution is poured into frozen water (0 ~ 4DEG C) in, solid is separated out, and filtration drying obtains light green color solid 2-sulfo group-acridone; Take 0.6g2-sulfo group-acridone, addEnter 3mL36% acetic acid, then add successively the red fuming nitric acid (RFNA) of 0.36mL and the glacial acetic acid of 0.8mL, at 56 ~ 60 DEG C, stir anti-Answer 2h, while hot solution is poured in frozen water, solid is separated out, filter, and with the flushing of 10 ~ 20mL water, and further with absolute ethyl alcoholRecrystallization purifying, obtains yellow needle powder 5,7-dinitro-2-sulfo group-acridone.
A kind of hybridization indicator 5, the application of 7-dinitro-2-sulfo group-acridone on electrochemical sensor.
Described electrochemical sensor preparation method comprises: the 1) pretreatment of electrode
Al by glass-carbon electrode at 0.05 μ m2O3On powder, polish, and successively with absolute ethyl alcohol and the ultrasonic concussion 5 of distilled waterMin, to remove the impurity being attached on electrode surface, with 10mM potassium ferricyanide sign electrode surface, until front and back peak position voltageDifference is less than 80V, and distilled water is cleaned and dried rear taking-up, and nitrogen dries up;
2) preparation of probe modification electrode
Glass-carbon electrode after treatment is placed in to pH8.0, the 0.2MPBS buffer solution containing 0.01M/L lysine, usesCyclic voltammetry electricity closes modifies polylysine film, then with distilled water cleaning down electrode at room temperature dry, obtains the poly-ammonia that reliesAcid modified electrode, is inverted polylysine modified electrode, and surface drips 20 μ L coupling activators, and room temperature nature evaporate to dryness, then usesUltra-pure water cleans 10s, removes the coupling activator that is not combined in modified electrode surface, and nitrogen dries up stand-by; Then at electrode tableFace drips the probe gene P solution of 10 μ L1 μ M hairpin structures, and room temperature nature evaporate to dryness, removes and be not combined in ultra-pure water cleaningThe probe gene P of electrode surface, then use 10mMpH7.0PBS buffer solution for cleaning, drying at room temperature, makes hair fastener probe modification electricityThe utmost point;
3) enzyme auxiliary target sequence circulation
Hair fastener probe modification electrode is placed in to the target sequence c-erbB-2 related gene (1aM ~ 100fM) of a series of concentrationIn solution, under room temperature, hybridize after 1h and clean and dry up, the electrode after hybridization is placed in to the buffer solution of 10U exonuclease IIIIn, react after 30min at 37 DEG C, clean dry up stand-by;
4) DNA is long apart from formula self assembly and Electrochemical Detection
Assist probes AP1 and the AP2 solution of getting respectively 10 μ L1 μ M are (limited by the raw work biotechnology service in ShanghaiCompany is synthetic) drip and be coated in above-mentioned electrode surface, under room temperature, carry out DNA long apart from formula self assembly, after 2h, clean and dry up; Containing respectivelyThere is 5mMK3[Fe(CN)6]/K4[Fe(CN)6] 100mMpH7.0PBS+0.1MKCl cushioning liquid (1:1) surveysThe CV curve of amount different modifying electrode, sweep speed is 0.05V/s, and the sampling interval is 0.001V, and time of repose is 2s; WillThe long electrode after formula self assembly of DNA is placed in containing 100 μ M5, the pH7.0PBS of 7-dinitro-2-sulfo group-acridone DSAIn cushioning liquid, after 20min, clean and dry up; Then electrode is placed in to pH5.0 phosphate PB cushioning liquid and scans CV and sideRipple voltammetry (SWVs) curve.
The condition of described cyclic voltammetry is: voltage-1.0 ~+2.4V, sweep speed is 100mVs-1, characterizes the number of turnsBe 14 circles.
Described coupling activator is the pH7.4 phosphate buffer containing the EDC of 5mM and the NHS of 8mM.
The sweep speed of described CV method is 0.50V/s, and the sampling interval is 0.001V, and time of repose is 2s; Square wave volt-ampereThe scanning potential range of method is-0.2V ~+0.15V, and current potential increment is 0.005V, and amplitude is 0.025V.
Described probe P sequence is 5'-NH2-AAAAATTTATTTGATAGGCGAACTATTTGTTTTTAATATCAAATAATGGTT-3'; Described probe AP1 sequence is 5'-CAAAATATATGATAGGCGAA-3'; VisitPin AP2 sequence is 5'-ATATATTTTGTTCGCCTATC-3';
The invention has the advantages that:
1, synthesized a kind of novel electrochemistry hybridization indicator acridone derivatives-" 5,7-dinitro-2-sulfo group-Acridone " (DSA), it has higher water-soluble and electro-chemical activity, and to single double-stranded selectively stronger.
2,, taking DSA as hybridization indicator, developed a kind of based on " film modified electrode ", " exonuclease III auxiliary target orderRow circulations " and the electrochemica biological sensor of " DNA grows apart from formula self assembly " triple signal amplification techniques, can use it for lung cancer phaseThe ultra-high sensitive, the high specific that close target sequence c-erbB-2 related gene detect.
3, the range of linearity of this sensor is 2aM ~ 50fM, and detection limit reaches 0.5aM, and can identify preferably completelyComplementation and mismatch, can realize the detection of super low loading target sequence in clinical practice Sera of Lung Cancer sample.
Brief description of the drawings
Fig. 1 is electrochemistry hybridization indicator 5, the mass spectrogram of 7-dinitro-2-sulfo group-acridone.
Fig. 2 is different modifying electrode of the present invention [Fe (CN)6]3-/4-Phenogram. In figure on different modifying electrode[Fe(CN)6]3-/4-Characterize: (c) and rear (b), DNA length before film modified electrode (a), the circulation of exonuclease III auxiliary target sequenceApart from formula self assembly (d)
Fig. 3 is electrochemical signals detection figure of the present invention. Electrochemical signals A, the B of variable concentrations target dna, C, D, E, F,G comparison.
Detailed description of the invention
Followingly describe the present invention in conjunction with the accompanying drawings and embodiments:
Embodiment 1
The characterization data of DSA is as follows:
The elementary analysis of DSA: C, 42.83%; H, 1.99%; N, 11.52%. (calculated value: C, 42.75%;H, 1.93%; N, 11.50%); Infrared analysis IR (KBr) ν of DSA: 3410 (υ NH), 1592 (υ C-C), 1642 (υ C=C),1389(υC-NO2),1190(υSO2OH).
The mass spectral analysis FAB-MS:m/z366 ([M+1]+) of DSA.
The hydrogen analysis of spectrum 1HNMR (CDCl3, δ) of DSA: 9.04 (s, ArH), 8.76 (s, ArH), 8.13 (s,ArH),7.85(d,ArH),6.87(d,ArH),4.21(s,NH).
Embodiment 2
Electrochemical sensor of the present invention comprises glass-carbon electrode GCE, and surface is coated with sensitive membrane, ExoIII enzyme, auxiliary orderRow AP1 and AP2. Sensitive membrane is by polylysine PLLy and fixing hair fastener probe gene P(5'-NH2-AAAAATTTATTTGATAGGCGAACTATTTGTTTTTAATATCAAATAATGGTT-3') composition, will fix DNA probeGlass-carbon electrode immerses the PBS(phosphate pH7.0 that contains certain density complementary DNA (T1)) in cushioning liquid, hybridize anti-Should. Electrode after hybridization is placed in to the buffer solution of 10UExoIII enzyme, shears for 37 DEG C and eliminate, because ExoIII can be from 3 ' endThe flush end probe gene P that starts progressively to degrade, is completely degraded until form double-stranded part with T1 hybridization, does not remainingly hybridize with T1Portion gene residue in electrode surface. Meanwhile, T1 is discharged and can continue again to hybridize with another P by complete. SoThe cyclic process of hybridizing, degrade, being hybridized, a T1 just can make many digested degradeds of P. Complete it in above-mentioned circulationAfter, probe gene P can be transformed into flexible short linear structure from hairpin structure. Drip assist probes Gene A P1 at electrode surface(5'-CAAAATATATGATAGGCGAA-3') and AP2(5'-ATATATTTTGTTCGCCTATC-3') solution, under room temperature, carry outDNA is long apart from formula self assembly. Long electrode after formula self assembly is placed in to the pH7.0 containing 5,7-dinitro-2-sulfo group-acridoneIn PBS cushioning liquid, make in its double-spiral structure that is embedded into DNA. After drying up, above-mentioned electrode clean can be used for electrochemistry inspectionSurvey.
The preparation method of the sensor
1) electrochemistry hybridization indicator 5, the preparation of 7-dinitro-2-sulfo group-acridone: take 0.6g acridone, addEnter the dense H of 5mL2SO4, after stirring and dissolving, be heated to 100 DEG C of reaction 30min, while hot solution to be poured in frozen water, solid is separated out,Filtration drying obtains light green color solid 2-sulfo group-acridone; Take 0.6g2-sulfo group-acridone, add 3mL36% secondAcid, then add successively the red fuming nitric acid (RFNA) of 0.36mL and the glacial acetic acid of 0.8mL, stirring reaction 2h at 56 ~ 60 DEG C. While hot by moltenLiquid is poured (0 ~ 4 DEG C) in frozen water into, and solid is separated out. Filter, with the flushing of 10 ~ 20mL water, and further recrystallization is pure with absolute ethyl alcoholChange, obtain yellow needle powder 5,7-dinitro-2-sulfo group-acridone.
2) preparation of polylysine modified glassy carbon electrode: glass-carbon electrode after treatment is placed in to the lysine containing 0.01ML-0.2MPBS (pH8.0) buffer solution in, close and modify polylysine film with cyclic voltammetry electricity, condition is: voltage-1.0~+2.4V, sweep speed is 100mVs-1, characterizing the number of turns is 14 circles, then uses distilled water cleaning down electrode also at room temperatureDry, obtain polylysine modified electrode.
3) designing probe of hair fastener probe P, c-erbB-2 related gene, AP1 and AP2: hair fastener probe P:5'-NH2-AAAAATTTATTTGATAGGCGAACTATTTGTTTTTAATATCAAATAATGGTT-3'(is by the raw work in ShanghaiBiotechnology Services Co., Ltd is synthetic); C-erbB-2 related gene: 5'-AACCATTATTTGATATTAAAACAAATAGGCTTG-3' is the c-that particular sequence DNA(is also synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., LtdErbB-2 related gene); AP1:5'-CAAAATATATGATAGGCGAA-3'(is by the raw work biotechnology in ShanghaiServices Co., Ltd is synthetic); AP2:5'-ATATATTTTGTTCGCCTATC-3'(is by the raw work biotechnology in ShanghaiServices Co., Ltd is synthetic); Probe P is dissolved in TE buffer solution (by 10mMTris, 1.0mMEDTA and 0.10mMNaClPreparation, and be adjusted to pH7.4 with 10mmol/LHCl) make the probe solution of 100 μ M; Target dna is dissolved in to pH7.0PBSIn buffer solution, make the target dna solution of 100 μ M.
4) hair fastener probe gene fixing on modified electrode: polylysine modified glassy carbon electrode is in ethanol, intermediate waterFully unnecessary lysine is removed in washing. Drip 20 μ L coupling activators (containing the EDC of 5mM and 8mM at electrode surface againThe phosphate buffer of the pH7.4 of NHS), room temperature nature evaporate to dryness, then cleans 10s with ultra-pure water, removes not to be combined in and modifies electricityThe extremely coupling activator on surface, nitrogen dries up. Then drip the probe gene P of 10 μ L1 μ M hairpin structures at electrode surface moltenLiquid, is fixed on the probe gene P covalency of end modified amino on the carboxyl of polylysine, and room temperature nature evaporate to dryness, uses ultra-pure waterThe P that is not combined in electrode surface is removed in cleaning, then uses pH7.0PBS buffer solution for cleaning, and drying at room temperature makes hair fastener probe and repaiiesDecorations electrode.
5) enzyme auxiliary target sequence circulation: the target sequence c-erbB-2 that hair fastener probe modification electrode is placed in to a series of concentrationIn related gene solution, under room temperature, hybridize after 1h and clean and dry up. Electrode after hybridization is placed in to 10U exonuclease III'sIn buffer solution, react after 30min at 37 DEG C, clean dry up stand-by.
6) DNA is long apart from formula self assembly: get respectively the assist probes AP1 of 10 μ L1 μ M and AP2 solution and drip and be coated in above-mentioned electrodeSurface, carries out DNA length apart from formula self assembly under room temperature, after 2h, clean and dry up. Containing 5mMK3[Fe (CN) 6 respectively]/K4The circulation that [Fe (CN) 6] 100mMpH7.0PBS+0.1MKCl cushioning liquid (1:1) is measured different modifying electrodeVolt-ampere curve, sweep speed is 0.05V/s, and the sampling interval is 0.001V, and time of repose is 2s. (see from experimental result is knownAccompanying drawing 2), the DNA content of electrode surface is more, and (Ip) is less for peak point current; The DNA content of electrode surface is fewer, peak point current(Ip) larger. This is because DNA phosphoric acid skeleton is electronegative, hinders [the Fe (CN) with like charges6]3-/4-Send out to electrode surfaceRaw redox reaction, causes its electronics transmission to be obstructed, and peak current reduces.
Can obtain required sensor by above method.
Embodiment 3
Above-mentioned electrochemical sensor is for detection of c-erbB-2 related gene, and concrete detection method is: will fix hair fastenerThe glass-carbon electrode of DNA probe immerses and contains certain density complementary DNA solution, carries out hybridization reaction. Electrode after hybridization is putIn the buffer solution of 10U exonuclease III, shear for 37 DEG C and eliminate, probe P is transformed into flexible short-term from hairpin structureProperty structure. Drip assist probes AP1 and AP2 solution at electrode surface, under room temperature, carry out DNA length apart from formula self assembly. To grow apart from formulaElectrode after self assembly is placed in containing in the pH7.0PBS cushioning liquid of 5,7-dinitro-2-sulfo group-acridone, allows its embeddingIn the double-spiral structure of DNA. After above-mentioned electrode clean dries up, can be placed in PB cushioning liquid square wave voltammetry detects.
The present invention uses the square wave voltammetry electrochemical measuring technique of prior art to observe the redox signal of indicatorChange. Experimental result is shown in accompanying drawing 3, and as seen from the figure, in certain limit, along with target dna concentration increases, the two strands that hybridization forms is de-Oxygen ribonucleic acid (dsDNA) amount increases, and the short sequence of flexibility that enzyme is cut generation is more, thereby forms the long amount apart from formula self assembly of DNAMore, indicator embedded quantity is increased, peak current signal strengthens. Indicator 5, the peak electricity of 7-dinitro-2-sulfo group-acridonePosition is-0.028V. The condition of measuring: measuring medium is PB cushioning liquid, pH=5.0. Square wave voltammetry location parameter: current potential increasesAmount is 0.005V, and amplitude is 0.025V. Its range of linearity is: 2aM ~ 50fM. Regression equation is I (μ A)=0.5955Log[C/ (aM)]+0.5814, linearly dependent coefficient r is 0.9947, the lowest detection lower limit of the method to particular sequence DNAFor 0.5aM.
The foregoing is only preferred embodiment of the present invention, all equalizations of doing according to the present patent application the scope of the claims change withModify, all should belong to covering scope of the present invention.
SEQUENCELISTING
<110>Medical University Of Fujian
<120>a kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone
<130>4
<160>4
<170>PatentInversion3.3
<210>1
<211>51
<212>DNA
<213>probe P
<400>1
aaaaatttatttgataggcgaactatttgtttttaatatcaaataatggtt51
<210>2
<211>20
<212>DNA
<213>probe AP1
<400>2
caaaatatatgataggcgaa20
<210>3
<211>20
<212>DNA
<213>probe AP2
<400>3
atatattttgttcgcctatc20
<210>4
<211>33
<212>DNA
<213>c-erbB-2 related gene
<400>4
aaccattatttgatattaaaacaaataggcttg33
Claims (8)
1. a hybridization indicator 5,7-dinitro-2-sulfo group-acridone, is characterized in that: described 5,7-dinitro-2-sulphurBase-acridone structural formula is。
2. an a kind of hybridization indicator 5 as claimed in claim 1, the preparation method of 7-dinitro-2-sulfo group-acridone,It is characterized in that: described preparation method's step is: take 0.6g acridone, add the dense H of 5mL2SO4, after stirring and dissolving, heatingTo 100 DEG C of reaction 30min, solution to be poured in 0 ~ 4 DEG C of frozen water while hot, solid is separated out, and filtration drying obtains light green color solid 2-Sulfo group-acridone; Take 0.6g2-sulfo group-acridone, add 3mL36% acetic acid, then add successively the dense nitre of 0.36mLThe glacial acetic acid of acid and 0.8mL, stirring reaction 2h at 56 ~ 60 DEG C, pours solution in frozen water into while hot, and solid is separated out, mistakeFilter, with the flushing of 10 ~ 20mL water, and with the further recrystallization purifying of absolute ethyl alcohol, obtains yellow needle powder 5,7-dinitro-2-sulfo group-acridone.
3. an a kind of hybridization indicator 5 as claimed in claim 1,7-dinitro-2-sulfo group-acridone is at electrochemical sensingApplication on device.
4. a kind of hybridization indicator 5 according to claim 3,7-dinitro-2-sulfo group-acridone is at electrochemical sensorOn application, it is characterized in that: described electrochemical sensor preparation method comprises: the 1) pretreatment of electrode
Al by glass-carbon electrode at 0.05 μ m2O3On powder, polish, and successively with absolute ethyl alcohol and the ultrasonic concussion of distilled water 5min,To remove the impurity being attached on electrode surface, with 10mM potassium ferricyanide sign electrode surface, until front and back peak position voltage differenceBe less than 80V, distilled water is cleaned and is dried rear taking-up, and nitrogen dries up;
2) preparation of probe modification electrode
Glass-carbon electrode after treatment is placed in to pH8.0, the 0.2MPBS buffer solution containing 0.01M/L lysine, with circulationVoltammetry electricity closes modifies polylysine film, then with distilled water cleaning down electrode at room temperature dry, obtains polylysine and repairDecorations electrode, is inverted polylysine modified electrode, and surface drips 20 μ L coupling activators, and room temperature nature evaporate to dryness, then uses ultrapureWater cleans 10s, removes the coupling activator that is not combined in modified electrode surface, and nitrogen dries up stand-by; Then drip at electrode surfaceAdd the probe gene P solution of 10 μ L1 μ M hairpin structures, room temperature nature evaporate to dryness, removes and is not combined in electrode with ultra-pure water cleaningThe probe gene P on surface, then use 10mMpH7.0PBS buffer solution for cleaning, drying at room temperature, makes hair fastener probe modification electrode;
3) enzyme auxiliary target sequence circulation
Hair fastener probe modification electrode is placed in to the target sequence c-erbB-2 related gene solution of a series of concentration, under room temperature, hybridizesAfter 1h, clean and dry up, the electrode after hybridization is placed in to the buffer solution of 10U exonuclease III, react 30 at 37 DEG CAfter min, cleaning dries up stand-by;
4) DNA is long apart from formula self assembly and Electrochemical Detection
Get respectively the assist probes Gene A P1 of 10 μ L1 μ M and AP2 solution and drip and be coated in above-mentioned electrode surface, under room temperature, carry out DNALong apart from formula self assembly, after 2h, clean and dry up; Containing the 5mMK that mass ratio is 1:1 respectively3[Fe(CN)6]/K4[Fe(CN)6] 100mMpH7.0PBS+0.1MKCl cushioning liquid measure the CV curve of different modifying electrode, scanning speedRate is 0.05V/s, and the sampling interval is 0.001V, and time of repose is 2s; The long DNA electrode after formula self assembly is placed in and is contained100 μ M5, in the 10mMpH7.0PBS cushioning liquid of 7-dinitro-2-sulfo group-acridone, clean and dry up after 20min;Then electrode is placed in to 100mMpH5.0 phosphate PB cushioning liquid and scans CV and square wave voltammetry curve.
5. a kind of hybridization indicator 5 according to claim 4,7-dinitro-2-sulfo group-acridone is at electrochemical sensorOn application, it is characterized in that: the condition of described cyclic voltammetry is: voltage-1.0 ~+2.4V, sweep speed is 100MVs-1, characterizing the number of turns is 14 circles.
6. a kind of hybridization indicator 5 according to claim 4,7-dinitro-2-sulfo group-acridone is at electrochemical sensorOn application, it is characterized in that: described coupling activator is the pH7.4 phosphoric acid buffer containing the EDC of 5mM and the NHS of 8mMLiquid.
7. a kind of hybridization indicator 5 according to claim 4,7-dinitro-2-sulfo group-acridone is at electrochemical sensorOn application, it is characterized in that: the sweep speed of described CV method is 0.50V/s, the sampling interval is 0.001V, time of repose is2s; The scanning potential range of square wave voltammetry is-0.2V ~+0.15V, and current potential increment is 0.005V, and amplitude is 0.025V。
8. a kind of hybridization indicator 5 according to claim 4,7-dinitro-2-sulfo group-acridone is at electrochemical sensorOn application, it is characterized in that: described probe P sequence is 5'-NH2-AAAAATTTATTTGATAGGCGAACTATTTGTTTTTAATATCAAATAATGGTT-3'; Described probe AP1 sequence is 5'-CAAAATATATGATAGGCGAA-3'; Probe AP2 sequence is 5'-ATATATTTTGTTCGCCTATC-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410628402.6A CN104316705B (en) | 2014-11-11 | 2014-11-11 | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410628402.6A CN104316705B (en) | 2014-11-11 | 2014-11-11 | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104316705A CN104316705A (en) | 2015-01-28 |
| CN104316705B true CN104316705B (en) | 2016-05-25 |
Family
ID=52371958
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410628402.6A Expired - Fee Related CN104316705B (en) | 2014-11-11 | 2014-11-11 | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104316705B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104650080B (en) * | 2015-02-13 | 2017-04-05 | 中国科学院化学研究所 | Quinacridone type compounds that N, N pentane replaces and preparation method and application |
| CN105527259B (en) * | 2015-11-06 | 2019-08-30 | 泉州出入境检验检疫局综合技术服务中心 | The detection method of 2-mercaptobenzothiazole in a kind of rubber product |
| CN113552191B (en) * | 2021-07-28 | 2023-11-21 | 江苏师范大学 | Construction method of proportional electrochemical sensor for detecting methylated DNA based on multilayer DNA amplification loop |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1201055A (en) * | 1997-04-25 | 1998-12-09 | 西巴特殊化学品控股有限公司 | Beta-quinacridone pigment |
| CN1521218A (en) * | 2003-01-28 | 2004-08-18 | 余世春 | Process for preparation of quinacridone series pigments |
| US8241915B2 (en) * | 2009-01-14 | 2012-08-14 | Abbott Laboratories | Methods and kits for detecting hemoglobin in test samples |
-
2014
- 2014-11-11 CN CN201410628402.6A patent/CN104316705B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1201055A (en) * | 1997-04-25 | 1998-12-09 | 西巴特殊化学品控股有限公司 | Beta-quinacridone pigment |
| CN1521218A (en) * | 2003-01-28 | 2004-08-18 | 余世春 | Process for preparation of quinacridone series pigments |
| US8241915B2 (en) * | 2009-01-14 | 2012-08-14 | Abbott Laboratories | Methods and kits for detecting hemoglobin in test samples |
Non-Patent Citations (2)
| Title |
|---|
| DNA 电化学生物传感器检测急性早幼粒细胞白血病PML/RARα融合基因的实验研究;庄茜;《中国优秀硕士学位论文全文数据库医药卫生科技辑》;20090115(第1期);E072-92，第6、11页 * |
| 一种吖啶酮衍生物的合成及与蛋白质相互作用的电化学行为研究;陈敬华等;《分析化学》;20081130;第36卷(第11期);第1488-1492页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104316705A (en) | 2015-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Salahandish et al. | Nano-biosensor for highly sensitive detection of HER2 positive breast cancer | |
| US20210247349A1 (en) | METHOD FOR PREPARING RATIOMETRIC ELECTROCHEMICAL miR3123 APTASENSOR BASED ON METAL-ORGANIC FRAMEWORK COMPOSITE | |
| CN106525940B (en) | Electrochemical method based on tetra- serobilas of G--ferroheme compound and polymerization chain type iodine detection single-stranded target DNA concentration | |
| CN105004775B (en) | Curing object point/nanometer sheet compound DNA electrochemical probe and its preparation method and application | |
| WO2016062101A1 (en) | Modified electrode for detecting ndm-1 and preparation method therefor and use thereof | |
| CN102262118A (en) | Bioelectrochemical sensor for detecting tumor markers and preparation method thereof | |
| CN104007155B (en) | A kind of for detecting electrochemical sensor of Trace Hg and its preparation method and application in water body | |
| CN102072931B (en) | Method for preparing biosensor based on silicon nanowires and application of biosensor in detecting DNA | |
| CN107843629B (en) | A kind of preparation method detecting A549 tumour cell electrochemical sensor working electrode | |
| CN110208348A (en) | A kind of lung cancer detection box of the atom transition free radical polymerization reaction mediated as initiator by electrochemistry using Nafion | |
| CN104316705B (en) | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone | |
| CN103743802A (en) | DNA biosensor based on three-dimensional ordered gold doped nano titanium dioxide electrode as well as preparation method and application of DNA biosensor | |
| CN102288656A (en) | Sandwich-type electrochemical sensor for detecting ovarian SKOV-3 cancer cell | |
| CN109115845A (en) | Self energizing miRNA biosensor and its application based on PEFC | |
| Ensafi et al. | A novel diagnostic biosensor for distinguishing immunoglobulin mutated and unmutated types of chronic lymphocytic leukemia | |
| CN104459157A (en) | Preparation method and application of immunosensor based on ferrocene-cuprous oxide cubic nanometer frame mark | |
| CN109613095A (en) | Terminal enzyme (DNA) electrochemica biological sensor preparation method and application based on i-motif change of configuration | |
| CN103487483A (en) | Electrochemical analyzing method for constructing 17beta-estradiol aptamer sensor based on dendritic gold modification BDD electrode | |
| CN104152449A (en) | MiRNA capture probe, modifying electrode thereof, capture probe complementary strand, capture probe complementary strand modified carbon nanotube-gold magnetic nanoparticle compound | |
| Wang et al. | Multivalent aptamer nanoscaffold cytosensor for glioma circulating tumor cells during Epithelial–Mesenchymal transition | |
| CN101368209A (en) | Method for detecting target numerator based on nucleic acid aptamer and PCR amplification | |
| CN109682875B (en) | Nucleic acid electrochemical detection system and detection method for hepatocellular carcinoma screening | |
| CN106525920B (en) | Extend the method that enzyme electrochemical nucleic acid aptamer sensor surveys carcinomebryonic antigen based on end | |
| Ren et al. | Detection of DNA and indirect detection of tumor cells based on circular strand-replacement DNA polymerization on electrode | |
| CN107064258A (en) | The method that electric signal and its electrochemical aptamer sensor measure HER2 of self assembly amplified signal are produced based on DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160525 Termination date: 20171111 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |