CN110438251B - Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) - Google Patents
Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) Download PDFInfo
- Publication number
- CN110438251B CN110438251B CN201910375185.7A CN201910375185A CN110438251B CN 110438251 B CN110438251 B CN 110438251B CN 201910375185 A CN201910375185 A CN 201910375185A CN 110438251 B CN110438251 B CN 110438251B
- Authority
- CN
- China
- Prior art keywords
- peanut
- hazelnut
- specific gene
- species
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for quantitatively detecting peanut components in hazelnut paste by using dual-channel digital PCR (polymerase chain reaction), which adopts a dual-channel detection method, simultaneously detects two fluorescent signals by using a digital PCR system, respectively marks probes for detecting a specific gene sequence of a peanut species and a specific gene sequence of a hazelnut species as VIC and FAM, calculates the copy number concentration of the specific gene sequence of the peanut species and the copy number concentration of the specific gene sequence of the hazelnut species in the same PCR reaction system to obtain the percent ratio of the peanut to the DNA copies of the hazelnut and the peanut, and converts the percent ratio of the peanut components to the hazelnut and the peanut components. The method can accurately and quickly detect the mass percentage content of the peanut component in the hazelnut paste, and provides accurate and reliable technical data for the authenticity identification of the hazelnut paste filling.
Description
Technical Field
The invention belongs to the field of molecular biology detection, and particularly relates to a method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR.
Background
The hazelnut paste is stuffing prepared by taking hazelnuts as a main raw material, and desserts such as cakes, chocolates and the like added with the hazelnut paste are deeply loved by people and have considerable market demand. GB/T21270-containing 2007 food stuffing specifies that the content of nuts in the nut stuffing is not less than 20% (w/w). As the hazelnuts belong to nuts with higher price, the production cost of the hazelnut paste is higher, the food containing the hazelnut paste is more expensive, and illegal manufacturers often use cheap and easily available nut raw materials to counterfeit the hazelnuts to reduce the cost and do not profit. Among them, the most common is the adulteration of hazelnuts by peanuts. This behavior seriously impairs the consumer's interest and hinders fair trade.
At present, the standard detection method of the hazelnut component in the food comprises the following steps of SN/T1961.8-2013 export food allergen component detection part 8: real-time fluorescence PCR method for detecting hazelnut components and SN/T4419.4-2016 Exit food common allergen LAMP series detection method part 4: hazelnut, peanut component detection method includes SN/T1961.2-2007 allergen counter-detection method in food 2: real-time fluorescence PCR method for detecting peanut components and SN/T4419.12-2016 Exit food common allergen LAMP series detection method part 12: peanuts. The method adopts real-time fluorescence PCR and isothermal amplification technology to carry out qualitative detection on hazelnut and peanut, can only solve the problem that whether the hazelnut paste contains peanut components or not, can not effectively distinguish 'unintentional pollution' caused by sharing containers, equipment, production lines and the like in the production and processing process of the hazelnut paste from 'intentional addition' aiming at adulteration, has obvious technical limitation, and can not meet the requirement of the hazelnut paste adulteration.
In order to guarantee food safety and maintain fair legal trade, a dual digital PCR quantitative detection method for the peanut formation in the hazelnut paste is established, the peanut ingredients doped in the hazelnut paste can be accurately quantified, and an accurate and reliable technical basis is provided for the authenticity identification of the hazelnut paste.
Disclosure of Invention
The invention aims to provide a method for accurately and effectively quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) aiming at the defects and shortcomings to be solved.
The purpose of the invention is realized by the following technical scheme:
a method for quantitatively detecting peanut components in hazelnut paste by using dual-channel digital PCR (polymerase chain reaction) comprises the steps of simultaneously detecting two fluorescent signals by using a digital PCR system, respectively marking probes for detecting specific gene sequences of peanut species and specific gene sequences of hazelnut species as VIC and FAM, calculating the copy number concentration of the specific gene sequences of the peanut species and the specific gene sequences of the hazelnut species in the same PCR reaction system to obtain the percent ratio of the peanut to the hazelnut to the peanut DNA copy number of the peanut, and converting to obtain the mass percent of the peanut components to the hazelnut and the peanut components.
Preferably, the method of the invention comprises the steps of:
step 2, designing and synthesizing a primer and a probe sequence of the hazelnut species specific gene sequence and a primer and a probe sequence of the peanut species specific gene sequence;
step 3, carrying out double digital PCR reaction;
step 4, reading and analyzing a fluorescence signal by adopting FAM and VIC double-channel fluorescence detection;
wherein the peanut accounts for several percent of DNA copy of hazelnut and peanut
Wherein a is the peanut specific gene copy number concentration, and b is the hazelnut specific gene copy number concentration.
The peanut component accounts for the mass percent of the hazelnuts and the peanut component, and the mass percent of the peanut component is obtained by establishing a relational expression of the mass percent of the peanut component to the copy percent and utilizing the copy percent.
Preferably, the step 1 comprises extracting sample DNA from the hazelnut paste sample by a kit method.
Preferably, in the step 2, the primer and probe sequences of the filbert species-specific gene sequence are as follows:
filbert specific gene-F: CCGTTTTGTCGTGGATCTACAG (SEQ ID NO. 1);
filbert specific gene-R: CCTTCATCTCCCGAGCCTTAC (SEQ ID NO. 2);
hazelnut-specific gene-P: FAM-CCTGGAGCGGATCAACTTGACCAC-BHQ1(SEQ ID NO. 3).
Preferably, in the step 2, the sequences of the primers and the probes of the peanut species-specific gene sequence are as follows:
peanut-specific gene-F: GCAACAGGAGCAACAGTTCAAGAGG (SEQ ID NO. 4);
peanut-specific gene-R: CGCTGTGGTGCCCTAAGGCCG (SEQ ID NO. 5);
peanut-specific gene-P: VIC-CTCAGGAACTTGCCTCAACAGTGCGGCC-BHQ1(SEQ ID NO. 6).
Preferably, the double digital PCR reaction includes a droplet digital PCR reaction (ddPCR) and a chip digital PCR reaction (cdPCR).
More preferably, the ddPCR reaction conditions are: 95 ℃, 5 minutes, 1 ℃/second; 49 cycles of 94 ℃, 15s, 1 ℃/sec, 60 ℃, 1 minute, 1 ℃/sec; the reaction product was stored at 12 ℃.
More preferably, the ddPCR reaction system is 20 μ L, and the components are as follows: 2 XddPCR TM 10 mu L of the premixed solution; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.4. mu.L of each probe at a concentration of 10 pmol/. mu.L, 2. mu.L of DNA template, and 20. mu.L of water.
More preferably, the cdPCR reaction conditions are: at 96 ℃ for 10 minutes; 49 cycles of 60 ℃, 2 minutes, 98 ℃, 30 seconds; 2 minutes at 60 ℃; the reaction product was stored at 10 ℃.
More preferably, the cdPCR reaction system is 15 μ L, and the components are as follows:
7.5 mu L of premix; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.3. mu.L of each probe at a concentration of 10 pmol/. mu.L, 1.5. mu.L of DNA template, and 15. mu.L of water.
The digital PCR is a nucleic acid detection technology based on single-molecule amplification, and is used for quantitatively determining the copy number concentration of a specific gene fragment in a sample on the basis of the Poisson distribution principle, so that result deviation caused by factors such as complex food ingredient composition, processing technology and food state can be avoided. The invention for measuring the content of species components in food by using a digital PCR technology mainly focuses on the aspect of animal-derived components. The method develops the invention of quantitative determination of plant-derived components in food for the first time by digital PCR, establishes a relational expression of the copy percentage ratio of peanut to hazelnut and peanut DNA and the mass percentage of peanut to hazelnut and peanut components in hazelnut paste, determines the copy number concentration of DNA of two species in the hazelnut paste by using the digital PCR technology, calculates the copy percentage ratio of peanut to hazelnut and peanut DNA, and converts the mass percentage content of peanut components in the hazelnut paste according to the relational expression.
The hazelnut includes Corylus heterophylla (Corylus heterophylla Fisch.) and Corylus heterophylla (Corylus heterophylla Fisch. x. Corylus avellana L.) belonging to the plant of Corylus of Betulaceae, and hybrid Corylus heterophylla is interspecific hybrid cultivated by cross cultivation of Corylus heterophylla and Corylus heterophylla, commonly called as big-fruit hazelnut or big-fruit hybrid hazelnut. The hazelnut specific primer probe designed according to the invention can carry out specific detection on the two hazelnut components. The peanut (Arachis hypogaea Linn.) belongs to fruits or seeds of plants in the genus Arachis in the family Leguminosae, and the peanut specific primer probe designed according to the invention can specifically detect peanut components.
The method quantitatively determines the DNA copy number concentration of the peanuts in the hazelnuts and the peanuts, wherein the absolute quantitative limit of the copy number concentration is 6 copies/microliter, and the percentage of the peanuts in the hazelnuts and the DNA copies of the peanuts is 1% of the quantitative limit; the quantitative limit of the percentage by mass of the peanuts in the hazelnut paste in the hazelnut and peanut components is 5%. The method can accurately and quickly detect the mass percentage content of the peanut component in the hazelnut paste, and provides accurate and reliable technical data for the authenticity identification of the hazelnut paste filling.
Drawings
FIG. 1 is a graph of data analysis of a copy percentage limit validation experiment (ddPCR).
FIG. 2 is a 2D plot of the results of copy percentage quantitation validation experiments (cdPCR).
FIG. 3 is a mass percent-copy percent relationship (ddPCR).
FIG. 4 is a mass percent-copy percent relationship (cdPCR).
FIG. 5 is a graph of the results of mass percentage limit validation experiments 1D (ddPCR).
FIG. 6 is a 2D plot of the results of mass percent quantitation limit verification experiments (cdPCR).
Detailed Description
The present invention will be described in further detail below with reference to specific examples and drawings, but the embodiments of the present invention are not limited thereto.
The method for quantitatively detecting the peanut components in the hazel nut paste by using the dual digital PCR comprises the following steps:
1. preparing a sample and extracting a genome DNA template: 10g of samples (filbert, peanut, hazelnut paste stuffing and the like) are taken, and are crushed and homogenized by a grinder under the conditions of 1800 rpm and 3 minutes.
Weighing 30mg of a sample in a 1.5mL centrifugal tube, and extracting the DNA of the sample by a kit method, wherein the kit can be selected from the following components: DNA extraction methods such as Kurabo QuickGene DNA extraction kit DT-S, Wizard Genomic DNA purification kit (Promega, A1120), and PSS nucleic acid automatic extractor. These DNA extraction methods are well known to those skilled in the art, and thus DNA of the corresponding samples is extracted separately.
2. Designing and synthesizing primer and probe sequences of the hazelnut species-specific gene sequence and primer and probe sequences of the peanut species-specific gene sequence, wherein the nucleotide sequences of the primers and probes are as follows:
3. performing a double digital PCR reaction
(1) Instrument for measuring the position of a moving object
QX200 TM Droplet Digital PCR system: comprises a thermal cycler (C1000 Touch) TM thermal cycler), droplet generator (droplet generator), droplet analyzer (droplet reader) and membrane sealer (PCR plate sealer)4 sections, purchased from Bio-rad, usa.
QuantStudio TM 3D Digital PCR System: including a PCR system (Dual Flat Block)
PCR System 9700), Chip Loader (Digital Chip Loader) and Chip analyzer (Digital PCR Instrument)3 sections, available from Applied Biosystems by Life Technologies, USA.
(2) Reagent
ddPCR：ddPCR TM Premix (Super Mix for Probes, no dUTP), Droplet Generation Oil (Droplet Generation Oil), Droplet analysis Oil (Droplet Reader Oil), Droplet Generation card slot (Droplet Generator DG8 card), Droplet Generation card slot gel pad (Droplet Generator DG8 mask), and 96-well plate, available from Bio-Rad, usa.
cdPCR：
Premix (3D Digital PCR Master Mix v2), Chip Kit (3D Digital PCR20K Chip Kit v2, including Chip, Chip lid, brush head, oil seal syringe), purchased from Applied Biosystems by Life Technologies, USA.
Both primers and probes were synthesized by Shanghai scintillation molecular Biotechnology, Inc.
(3) Sample supply book
The operation steps, the amounts of reagents used, the reaction conditions, etc. are the same for each method except that the sample is different. The specific test specimens and experimental data obtained are detailed in the examples below.
(4) Preparation and Dispersion of the reaction System
The ddPCR reaction system is 20 mu L, and the components are as follows: 2 XddPCR TM Premix (MasterMix)10 μ L; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.4. mu.L of each probe at a concentration of 10 pmol/. mu.L, 2. mu.L of DNA template, and 20. mu.L of water. Respectively adding 20 muL of reaction system and 70 muL of microdroplet generating oil into the microdroplet generating clamping groove, covering the rubber mat, putting into a microdroplet generating instrument for microdroplet generation, and waiting for microdroplet generation junctionAfter that, the resulting droplets (about 40. mu.L) were transferred to a 96-well plate by a single-channel electric pipette, and the plate was sealed by a membrane sealer and then placed in a thermal cycler for PCR reaction.
The cdPCR reaction system is 15 mu L, and the components are as follows:
premix (MasterMix)7.5 μ L; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.3. mu.L of each probe at a concentration of 10 pmol/. mu.L, 1.5. mu.L of DNA template, and 15. mu.L of water. And automatically loading the prepared 15 mu L reaction system into the micropores on the chip by using a chip loader, immediately covering the surface of the chip with the sealing oil by using an oil sealing injector after the system is loaded, and sealing the chip. The sealed chip is placed on a PCR system for amplification.
(5) Reaction procedure
ddPCR reaction conditions: 95 ℃ for 5 minutes (1 ℃/s); 49 cycles of 94 ℃ for 15 seconds (1 ℃/sec), 60 ℃ for 1 minute (1 ℃/sec); the reaction product was stored at 12 ℃.
cdPCR reaction conditions: 10 minutes at 96 ℃; 2 minutes at 60 ℃, 30 seconds at 98 ℃ and 49 cycles; 2 minutes at 60 ℃; the reaction product was stored at 10 ℃.
4. Fluorescence signal reading and analysis
The fluorescence reading in the standard adopts FAM and VIC double-channel fluorescence detection.
After the fluorescence collection is finished, determining a fluorescence threshold value according to the reaction heat point diagram, and distinguishing a negative point from a positive point.
ddPCR data reading: after amplification, the 96-well plate was placed in a microdroplet analyzer to read the fluorescence signal and the experimental data was analyzed using QuantaSoft V1.3.2 software.
cdPCR data read: after the amplification is finished, after the chip is restored to the room temperature, the chip is placed in a chip analyzer to read and preliminarily analyze the chip result, and then the chip result is subjected to QuantStaudio TM The experimental data were analyzed twice by 3D AnalysisSuiteTM Cloud Software.
5. Calculation of copy percentage
Calculating the percentage of the peanuts in the hazelnuts and the DNA copies of the peanuts according to the detection result of the fluorescent signals.
The peanuts account for a few percent of the DNA copies of the hazelnuts and the peanuts
a-peanut specific gene copy number concentration (copies/microliter)
b-Hazelnut specific gene copy number concentration (copies/microliter).
6. Establishment of mass percent-copy percent relation
The preparation method comprises the steps of taking hazelnuts as a matrix, and doping peanuts with different mass percentages to obtain a series of peanut/hazelnut mixed samples with the mass percentage of not less than 5. For example, peanut/hazelnut powder blend samples having peanut components at 1%, 5%, 10%, 20%, 40%, 50%, and 100% by mass were prepared. 3 replicates of each sample, each of which is 30mg, are weighed and subjected to DNA extraction, and after each sample is diluted by 10 times, 1 replicate ddPCR and cdPCR are performed respectively. The mass percent-copy percent relationship was established using data analysis software.
7. Conversion of mass percentage
Substituting the copy percentage of the sample to be detected obtained by calculation in the step 5 into the mass percentage-copy percentage relation in the step 6, and converting to obtain the mass percentage content of the peanut component in the sample to be detected in the hazelnut and peanut component.
8. Quality control
(1) Quality control of sample testing
a. Calculation of relative standard deviation between sample parallels
The sample digital PCR reaction should be set to be 3 parallels, under the condition that the copy number concentration of the detection result is ensured to be larger than the absolute quantitative limit and the number of positive reactions is lower than 80 percent of the total reaction number, the Relative Standard Deviation (RSD) of the copy number concentration of the 3 parallel samples needs to meet the condition that the RSD is not more than 25 percent, and the average value measured by the 3 parallel samples is used as the gene content of peanuts/hazelnuts and peanuts of the sample for subsequent analysis.
b. Control of effective microreaction number
The total number of effective micro-reactions generated during the segmentation of the digital PCR system must not be less than 60% (i.e., 12000) of the theoretical number of platforms; the number of positive systems must not exceed 80% of the total number of systems.
c. Quality control of blank control
The theoretical detection result of the digital PCR blank control should be zero. However, in actual testing, a very small number of positive coefficients were allowed to occur. The positive microreaction coefficient in the blank should be less than 0.03% of the actual effective value.
If one of the above quality control conditions is not met, the test result should be discarded and the digital PCR test is performed again.
(2) Validation of performance indicators
a. Absolute limit of copy number concentration
And (4) taking the RSD not more than 25% as a judgment basis of effective quantitative data, wherein the absolute quantitative limit of the copy number concentration is the lowest copy number concentration when the RSD is not more than 25% of the detection result. And (3) carrying out digital PCR quantitative detection on the hazelnut and peanut DNA with serial diluted concentrations, setting 3 parallels for each concentration, and calculating the RSD value of the parallel detection result of each concentration. The absolute limit of the method for the copy number concentration of the DNA of the peanut and the hazelnut is 6 copies/microliter.
b. Copy percentage quantitative limit and recovery
The RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent as the judgment basis of effective quantitative data, and the quantitative limit of the copy percentage is the lowest copy percentage when the RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent. And (3) carrying out digital PCR quantitative detection on the hazelnut and peanut DNA with the percentage of the serial doped copies, setting 3 copies of each copy percentage, and calculating the RSD value and the recovery rate of the parallel detection result of each copy percentage. The method has the limit of 1% of the quantitative determination of the copy percentage of the peanuts in the hazelnuts and the peanut DNA.
c. Mass percent quantitation limit and recovery
And the RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent as the judgment basis of effective quantitative data, and the mass percentage quantification limit is the lowest mass percentage when the detection result RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent. DNA extraction and digital PCR quantitative detection are carried out on the serial hazelnut paste with the mass percent, 3 parallels are arranged for each mass percent, and the RSD value and the recovery rate of the parallel detection result of each mass percent are calculated. The method has the limit of 5% for the quantitative determination of the mass percentage of the peanuts in the hazelnuts and the peanut components.
Example 1: verification of absolute limit of quantitation of copy number
Test samples were: in order to verify the absolute quantitative limit of the copy number of the method, the genomic DNA of hazelnuts and peanut is respectively extracted and serially diluted to obtain the hazelnuts and peanut DNA with the serially diluted concentrations of 500, 100, 20, 10, 5 and 1 copy/microliter. 3 parallel ddPCR and cdPCR experiments were performed, respectively, and the results are shown in Table 1.
TABLE 1 verification of absolute limits of quantitation of DNA copy numbers of peanut and hazelnut (ddPCR and cdPCR)
As can be seen from the results shown in Table 1, on the ddPCR platform, the RSD values between the three replicates were all greater than 25% when the peanut DNA copy number concentration was 1.23 copies/microliter, and the RSD values between the three replicates were less than 25% when the peanut DNA copy number concentration was 5.23 copies/microliter or greater, with the absolute limit of quantitation for the peanut DNA copy number concentration being 5.23 copies/microliter; the RSD value between the three replicates was greater than 25% when the filbert DNA copy number concentration was 1.19 copies/microliter, and less than 25% when the filbert DNA copy number concentration was 5.07 copies/microliter or greater, with the absolute quantification limit for the filbert DNA copy number concentration being 5.07 copies/microliter. On a cdPCR platform, when the peanut DNA copy number concentration is 1.35 copies/microliter, the RSD value among three parallels is more than 25 percent, when the peanut DNA copy number concentration is more than or equal to 5.76 copies/microliter, the RSD value among the three parallels is less than 25 percent, and the absolute quantitative limit of the peanut DNA copy number concentration is 5.76 copies/microliter; the RSD values between the three replicates were greater than 25% when the concentration of the copy number of the hazelnut DNA was 1.35 copies/microliter, less than 25% when the concentration of the copy number of the hazelnut DNA was 5.55 copies/microliter or greater, and the absolute quantification limit for the concentration of the copy number of the hazelnut DNA was 5.55 copies/microliter. For the application of the method, the absolute quantitative limit integer of the method for the copy number concentration of peanut and hazelnut DNA is 6 copies/microliter.
Example 2: verification of copy percentage quantitative limit
Test samples were: in order to verify the quantitative limit of the copy percentage of the method, the hazelnut DNA with known copy number concentration is taken as a matrix, and the peanut DNA with known copy number concentration is doped to obtain mixed samples of the hazelnut and the peanut DNA, wherein the serial doped copy percentage is respectively 0.1%, 1%, 10% and 50%. 3 parallel ddPCR and cdPCR experiments were performed, respectively, and the results are shown in FIGS. 1 and 2.
As can be seen from the results shown in FIGS. 1 and 2, the detection results on the ddPCR platform were 0.099%, 1.027%, 10.700% and 51.733% for the mixed samples of hazelnut and peanut DNA with copy percentage ratios of 0.1%, 1%, 10% and 50%, respectively, and the RSD values between the three replicates were between 0.29% and 10.40% and the recovery rate was between 98.67% and 107.00%; the detection results on the cdPCR platform are respectively 0.102%, 1.049%, 10.034% and 53.832%, the RSD value between three parallels is 0.859% -4.497%, and the recovery rate is 100.34% -107.66%. For samples with a percentage of copies of 0.1%, the copy number concentration measured was below the absolute limit of quantitation of 6 copies/microliter and the assay results were not valid quantitation data. Thus, the copy percentage of the present method is limited to 1% of quantitation.
Example 3: establishment of mass percent-copy percent relation
Test samples were: in order to establish a mass percent-copy percent relation, hazelnuts are used as a matrix, peanuts with different mass percentages are mixed, and mixed samples of peanut and hazelnut powder with the mass percentages of 1%, 5%, 10%, 20%, 40%, 50% and 100% are obtained. 3 replicates of each sample, each of which is 30mg, are weighed and subjected to DNA extraction, and after each sample is diluted by 10 times, 1 replicate ddPCR and cdPCR are performed respectively. The mass percent-copy percent relationship was established using data analysis software and the resulting relationship is shown in fig. 3 and 4. For the sample with the mass percent of 1%, the recovery rate of the copy percent does not meet the judgment basis of effective quantitative data, and the detection result is not effective quantitative data. Therefore, the relational expression is established by using the detection results of 5%, 10%, 40% and 50% by mass.
The relationship of mass percent to copy percent established on ddPCR platform is shown in FIG. 3, and the relationship is: 100y is (100x-1.615)/1.074, wherein x is the copy percentage and y is the mass percentage. R 2 Is 0.9925.
The relation between mass percent and copy percent ratio established in the cdPCR platform is shown in FIG. 4, and the relation is: 100y is (100x +0.3522)/1.095, wherein x is the copy percentage and y is the mass percentage. R 2 Is 0.9998.
Example 4: verification of mass percent quantitation limit
Test samples were: in order to verify the mass percentage quantification limit of the method, the hazelnut is taken as a matrix, peanuts with different masses are mixed, and the hazelnut paste is prepared, so that a series of hazelnut paste samples with the mass mixing ratios of the peanuts of 1%, 5%, 10%, 40% and 50% are obtained. 3 replicates of each sample, each of which is 30mg, are weighed and subjected to DNA extraction, and after each sample is diluted by 10 times, 1 replicate ddPCR and cdPCR are performed, respectively, and the obtained experimental results are shown in FIG. 5 and FIG. 6.
Fig. 5 shows a diagram (ddPCR) of the mass percentage limit verification experiment result 1D, in which a06, B06, and C06 are 5% by mass of ground nut paste samples, a05, B05, and C05 are 10% by mass of ground nut paste samples, D04, E04, and F04 are 40% by mass of ground nut paste samples, and a04, B04, and C04 are 50% by mass of ground nut paste samples.
The mass percent quantitation limit verification experiment results 2D plot (cdPCR) is shown in FIG. 6.
The percent by mass of copies was calculated from the experimental results and was substituted into the mass percent-percent by mass of example 3-percent by mass of copies relational expression to calculate the mass percent. As can be seen from the results shown in fig. 5 and fig. 6, for the hazelnut paste samples with peanut mass percentages of 5%, 10%, 40% and 50%, the detection results on the ddPCR platform are 4.53%, 10.92%, 40.06% and 49.78%, the RSD value between the three parallels is between 0.73% and 16.68%, and the recovery rate is between 91.56% and 110.49%; the detection results on the cdPCR platform are 5.06%, 10.02%, 39.56% and 50.30% respectively, the RSD value between three parallels is 1.05% -13.79%, and the recovery rate is 98.66% -101.10%. For the hazelnut paste sample with the mass percentage of 1%, the recovery rate of the mass percentage does not meet the judgment basis of effective quantitative data, and the detection result is not effective quantitative data. Therefore, the quantitative limit of the mass percent of the method is 5%.
Sequence listing
<110> inspection and quarantine technology center of Guangdong entry-exit inspection and quarantine bureau
<120> method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccgttttgtc gtggatctac ag 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccttcatctc ccgagcctta c 21
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cctggagcgg atcaacttga ccac 24
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gcaacaggag caacagttca agagg 25
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgctgtggtg ccctaaggcc g 21
<210> 6
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctcaggaact tgcctcaaca gtgcggcc 28
Claims (2)
1. A method for quantitatively detecting peanut ingredients in hazelnut paste by using dual digital PCR is characterized by comprising the following steps: the method comprises the steps of detecting two fluorescent signals simultaneously by a digital PCR system by adopting a dual-channel detection method, marking probes for detecting a specific gene sequence of a peanut species and a specific gene sequence of a hazelnut species as VIC and FAM respectively, calculating the copy number concentration of the specific gene sequence of the peanut species and the copy number concentration of the specific gene sequence of the hazelnut species in the same PCR reaction system to obtain the percentage of the DNA copy of the peanut in the hazelnut and the peanut, and converting to obtain the mass percentage of the peanut component in the hazelnut and the peanut component;
the method comprises the following steps:
step 1, extracting a hazel nut paste sample DNA;
step 2, designing and synthesizing a primer and a probe sequence of the hazelnut species specific gene sequence and a primer and a probe sequence of the peanut species specific gene sequence;
step 3, carrying out double digital PCR reaction;
step 4, reading and analyzing a fluorescence signal by adopting FAM and VIC double-channel fluorescence detection;
step 5, calculating the percentage of the peanuts in the DNA copy of the hazelnuts and the peanuts according to the detection result of the fluorescent signal, and converting to obtain the mass percentage of the peanut components in the hazelnuts and the peanut components;
wherein the peanut accounts for several percent of DNA copy of filbert and peanut
WhereinaIs the specific gene copy number concentration of the peanut,bthe copy number concentration of the specific gene of the hazelnut;
wherein, the peanut component accounts for the mass percent of the hazelnuts and the peanut component, and is obtained by establishing a relational expression of the copy percent ratio of the peanut component and utilizing the copy percent ratio;
the primer and probe sequences of the hazelnut species specific gene sequence are as follows:
filbert specific gene-F: CCGTTTTGTCGTGGATCTACAG, respectively;
filbert specific gene-R: CCTTCATCTCCCGAGCCTTAC, respectively;
hazelnut-specific gene-P: FAM-CCTGGAGCGGATCAACTTGACCAC-BHQ 1;
the primer and probe sequences of the peanut species-specific gene sequence are as follows:
peanut-specific gene-F: GCAACAGGAGCAACAGTTCAAGAGG, respectively;
peanut-specific gene-R: CGCTGTGGTGCCCTAAGGCCG, respectively;
peanut-specific gene-P: VIC-CTCAGGAACTTGCCTCAACAGTGCGGCC-BHQ 1;
the double digital PCR reaction comprises ddPCR reaction and cdPCR reaction;
the ddPCR reaction conditions are as follows: 95 ℃, 5 minutes, 1 ℃/second; 49 cycles of 94 ℃, 15 seconds, 1 ℃/second, 60 ℃, 1 minute, 1 ℃/second; storing the reaction product at 12 ℃;
the ddPCR reaction system is 20 mu L, and the components are as follows: 2 XddPCR TM 10 mu L of the premixed solution; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.4. mu.L of each probe at a concentration of 10 pmol/. mu.L, 2. mu.L of DNA template, and water to 20. mu.L;
the cdPCR reaction conditions are as follows: at 96 ℃ for 10 minutes; 49 cycles of 60 ℃, 2 minutes, 98 ℃, 30 seconds; 2 minutes at 60 ℃; storing the reaction product at 10 ℃;
the cdPCR reaction system is 15 mu L, and the components are as follows: 2 x QuantStudio ® 7.5 mu L of premix; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.3. mu.L of each probe at a concentration of 10 pmol/. mu.L, 1.5. mu.L of DNA template, and 15. mu.L of water.
2. The method according to claim 1, wherein the step 1 comprises extracting sample DNA from the hazelnut paste sample by a kit method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375185.7A CN110438251B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375185.7A CN110438251B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438251A CN110438251A (en) | 2019-11-12 |
| CN110438251B true CN110438251B (en) | 2022-09-23 |
Family
ID=68429473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910375185.7A Active CN110438251B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438251B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110846410A (en) * | 2019-12-20 | 2020-02-28 | 西北民族大学 | Method for detecting walnut allergens in food by real-time fluorescent quantitative PCR |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004101794A1 (en) * | 2003-05-16 | 2004-11-25 | House Foods Corporation | Quantitative pcr detection method for plant of specified genus in food or food raw material |
| AT501347B1 (en) * | 2005-02-09 | 2008-07-15 | Biomay Prod & Handel | METHOD AND SET FOR EVALUATING THE ALLERGENSIBILITY OF AN INDIVIDUAL |
| IT1394096B1 (en) * | 2009-02-27 | 2012-05-25 | Univ Parma | METHOD FOR THE DETECTION OF ALLERGENS. |
| CN103540673B (en) * | 2013-10-30 | 2015-09-09 | 昆明理工大学 | The dual PCR detection method of soybean, peanut composition in Walnut Milk drink |
| CN106191252A (en) * | 2016-07-14 | 2016-12-07 | 安徽出入境检验检疫局检验检疫技术中心 | The primer sets identifying tms5 trans-genetic hybrid rice seed and the method detecting seed purity with it |
| CN108060241B (en) * | 2018-02-13 | 2021-07-16 | 广州海关技术中心 | Double-digital PCR method for quantitatively detecting pigeon-derived components |
-
2019
- 2019-05-07 CN CN201910375185.7A patent/CN110438251B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110846410A (en) * | 2019-12-20 | 2020-02-28 | 西北民族大学 | Method for detecting walnut allergens in food by real-time fluorescent quantitative PCR |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438251A (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lygo et al. | The validation of short tandem repeat (STR) loci for use in forensic casework | |
| CN108728554B (en) | Method for rapidly identifying mutton content by using fluorescence test strip | |
| CN113293227B (en) | SNP molecular marker primer for identifying color traits of waxberry fruits and application thereof | |
| CN112322766A (en) | Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology | |
| CN113621731B (en) | Origin tracing and identification method for Guizhou blueberry honey | |
| CN107058498B (en) | Triple real-time fluorescence PCR method for detecting bovine, ovine and porcine derived components | |
| CN111718984A (en) | Method for STR typing of forensic mixed DNA sample | |
| CN110438251B (en) | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) | |
| CN109929946B (en) | Kit for quantitatively detecting cassava components based on micro-drop digital PCR and application thereof | |
| CN111808983B (en) | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof | |
| CN110408682B (en) | Method for quantitatively detecting red bean and red bean components in food by using dual digital PCR | |
| CN110396554B (en) | Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) | |
| CN109943627B (en) | Method for quantitatively detecting peanut components in sesame paste and sesame paste by using dual digital PCR (polymerase chain reaction) | |
| CN110317858B (en) | Method for quantitatively detecting kidney bean components in lotus paste by using dual digital PCR (polymerase chain reaction) | |
| CN106701746B (en) | High-throughput malt Purity technology based on Capillary Electrophoresis and SSR marker | |
| CN114622028B (en) | Primer pair combination, kit and detection method for detecting transgenic papaya | |
| CN116179752A (en) | Primer group for identifying toxic mushroom species and PCR detection method | |
| CN114150079B (en) | DNA bar code for screening yellow green stropharia rugoso-annulata with high total polysaccharide content | |
| CN106520914A (en) | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials | |
| KR102335806B1 (en) | Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof | |
| CN113122647B (en) | Quantitative identification method for safflower Dajinyuan in mixed tobacco based on fluorescent quantitative PCR technology | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN117757979B (en) | Primer group, kit and identification method for identifying soybean varieties | |
| CN104962640A (en) | Method for quickly identifying authenticity of conventional cotton varieties by using SSR (Simple Sequence Repeat) marker | |
| CN114058724B (en) | Multiple SSR (simple sequence repeat) marker primer and method for identifying premature yuhuan shaddock' early yuwendan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 510623 block B, Guangdong check tower, 66 Huacheng Road, Zhujiang New Town, Guangzhou, Guangdong. Applicant after: Guangzhou Customs Technology Center Address before: 510623 block B, Guangdong check tower, 66 Huacheng Road, Zhujiang New Town, Guangzhou, Guangdong. Applicant before: Inspection & Quarantine Technology Center of Guangdong Entry-Exit Inspection & Quarantine Bureau |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |