CN110396554B - Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) - Google Patents
Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) Download PDFInfo
- Publication number
- CN110396554B CN110396554B CN201910375164.5A CN201910375164A CN110396554B CN 110396554 B CN110396554 B CN 110396554B CN 201910375164 A CN201910375164 A CN 201910375164A CN 110396554 B CN110396554 B CN 110396554B
- Authority
- CN
- China
- Prior art keywords
- mung bean
- chestnut
- specific gene
- dna
- mung
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR, which adopts a dual-channel detection method, simultaneously detects two fluorescent signals by using a digital PCR system, respectively marks probes for detecting a mung bean species specific gene sequence and a chestnut species specific gene sequence as VIC and FAM, calculates the copy number concentration of the mung bean species specific gene sequence and the chestnut species specific gene sequence in the same PCR reaction system to obtain the percentage of the mung bean to the Chinese chestnut and mung bean DNA copies, and converts the percentage to obtain the mass percentage of the mung bean components to the Chinese chestnut and mung bean components. The method can accurately and quickly detect the mass percentage content of the mung bean components in the chestnut paste, and provide accurate and reliable technical data for authenticity identification of the chestnut paste filling.
Description
Technical Field
The invention belongs to the field of molecular biological detection, and particularly relates to a method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR.
Background
GB/T21270 and 2007 food stuffing clearly stipulate that chestnut paste stuffing is stuffing which is processed by taking chestnuts, oil and sugar as main raw materials, and the content of chestnuts in the stuffing raw materials except the oil and the sugar is not lower than 60%. Because the chestnut paste is simple in manufacturing process, the market admission threshold is low, production enterprises are unsmooth, and some production enterprises adulterate chestnut paste in order to reduce cost and obtain higher profits. The most common adulteration method is to add mung beans in the production of chestnut paste, and some chestnut pastes without chestnuts are even made by using chestnut essence. In 2016, the Chinese chestnut pie sold in the Chinese chestnut cake store of Guangzhou, Fengcheng, reported in south City newspaper, the main raw material is mung bean, and the profit can reach 40% to 50%. In 2015, the on-line Zhejiang reports that the chestnut cake of Wangzao Baomei Yang Jia shop in Hangzhou does not contain chestnut components, but is prepared by blending mung beans, edible milk powder and flour with essence. This behavior seriously hampers fair trade, impairs consumer interest, and affects food safety.
At present, part 9 of a LAMP system detection method for SN/T4419.9-2016 export common food allergens: the chestnut and the mung bean can be qualitatively detected respectively by the chestnut and the mung bean qualitative PCR method for detecting the source components of the mung bean in DB 12/T843-.
In order to guarantee food safety and maintain fair legal trade, a dual digital PCR quantitative detection method for mung bean components in chestnut paste is established, the mung bean components doped in the chestnut paste can be accurately detected, and an accurate and reliable technical basis is provided for true and false identification of the chestnut paste.
Disclosure of Invention
The invention aims to provide a method for accurately and effectively quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) aiming at the defects and shortcomings to be solved.
The purpose of the invention is realized by the following technical scheme:
a method for quantitatively detecting mung bean components in chestnut paste by using dual-channel digital PCR (polymerase chain reaction) comprises the steps of simultaneously detecting two fluorescent signals by using a digital PCR system by using a dual-channel detection method, respectively marking probes for detecting a mung bean species specific gene sequence and a Chinese chestnut species specific gene sequence as VIC and FAM, calculating the copy number concentration of the mung bean species specific gene sequence and the Chinese chestnut species specific gene sequence in the same PCR reaction system to obtain the percentage of DNA (deoxyribonucleic acid) copies of mung beans in Chinese chestnuts and mung beans, and converting to obtain the mass percentage of mung bean components in Chinese nuts and mung bean components.
Preferably, the method of the invention comprises the steps of:
designing and synthesizing primers and probe sequences of the Chinese chestnut species specific gene sequence and the mung bean species specific gene sequence;
step 3, carrying out double digital PCR reaction;
step 4, reading and analyzing a fluorescence signal by adopting FAM and VIC double-channel fluorescence detection;
wherein the mung bean accounts for the percentage of the DNA copies of the Chinese chestnut and the mung bean
Wherein a is the copy number concentration of the mung bean specific gene, and b is the copy number concentration of the Chinese chestnut specific gene.
The mung bean ingredient accounts for the mass percent of the Chinese chestnut and mung bean ingredient, and is obtained by establishing a relational expression of the mung bean ingredient to the copy content and utilizing the copy content.
Preferably, the step 1 comprises the step of extracting sample DNA from the chestnut paste sample by using a kit method.
Preferably, in the step 2, the sequences of the primers and the probes of the chestnut species-specific gene sequence are as follows:
chestnut specific gene-F: AAGCCTAAAATGCGACACTACG (SEQ ID NO. 1);
chestnut specific gene-R: TGTCTCCAAGCCCCAACG (SEQ ID NO. 2);
chestnut specific gene-P: FAM-CCTCCACTGCCTTGACGAGGAAGC-BHQ1(SEQ ID NO. 3).
Preferably, in the step 2, the sequences of the primers and the probes of the mung bean species-specific gene sequence are as follows:
mung bean specific gene-F: GACCGGCAGCTTATGCTTCA (SEQ ID NO. 4);
mung bean specific gene-R: AACAGCGGCTAACTCGATGTC (SEQ ID NO. 5);
mung bean specific gene-P: VIC-CAATTAAAGTCGCATGAGAG-MGB (SEQ ID NO. 6).
Preferably, the double digital PCR reaction includes a microdroplet digital PCR reaction (ddPCR) and a chip digital PCR (chip digital PCR) reaction.
More preferably, the ddPCR reaction conditions are: 95 ℃, 5 minutes, 1 ℃/second; 49 cycles of 94 ℃, 15s, 1 ℃/s, 60 ℃, 1 minute, 1 ℃/s; the reaction product was stored at 12 ℃.
More preferably, the ddPCR reaction system is 20 μ L, and the components are as follows: 2 XddPCR TM10 mu L of premix liquid; 0.8. mu.L each of primers at a concentration of 10 pmol/. mu.L, 0.4. mu.L each of probes at a concentration of 10 pmol/. mu.L, 2. mu.L of DNA template, and water to 20. mu.L.
More preferably, the cdPCR reaction conditions are: at 96 ℃ for 10 minutes; 49 cycles of 60 ℃, 2 minutes, 98 ℃, 30 seconds; 2 minutes at 60 ℃; the reaction product was stored at 10 ℃.
More preferably, the cdPCR reaction system is 15 μ L, and the components are as follows:
7.5 mu L of premix; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.3. mu.L of each probe at a concentration of 10 pmol/. mu.L, 1.5. mu.L of DNA template, and 15. mu.L of water.
The digital PCR is a nucleic acid detection technology based on single-molecule amplification, and is used for quantitatively determining the copy number concentration of a specific gene fragment in a sample on the basis of the Poisson distribution principle, so that result deviation caused by factors such as complex food ingredient composition, processing technology and food state can be avoided. The invention for measuring the content of species components in food by using a digital PCR technology mainly focuses on the aspect of animal-derived components. The method firstly develops the invention of digital PCR quantitative determination of plant-derived components in food, establishes a relational expression of the DNA copy percentage ratio of mung beans to Chinese chestnuts and mung beans and the mass percentage of mung beans to Chinese chestnuts and mung beans in the chestnut paste, determines the DNA copy number concentration of two species in the chestnut paste by using a digital PCR technology, calculates the DNA copy percentage ratio of mung beans to Chinese chestnuts and mung beans, and obtains the mass percentage content of mung beans in the chestnut paste by conversion according to the relational expression.
The Chinese chestnut (Castanea mollissima) is commonly called as chestnut, is a fruit or a seed of a nut plant of the chestnut genus of the fagaceae family of the fagales order, and the Chinese chestnut specific primer probe designed according to the invention can specifically detect the components of the Chinese chestnut. Mung bean (Vigna radiata) is a fruit or a seed of a plant of Vigna genus of Phaseolus of Leguminosae of Rosales, and the mung bean specific primer probe designed according to the invention can specifically detect mung bean components.
The method quantitatively determines the DNA copy number concentration of the Chinese chestnuts and the mung beans, the absolute quantitative limit of the copy number concentration is 6 copies/microliter, and the percentage of the mung beans occupying the DNA copies of the Chinese chestnuts and the mung beans is 1% of the quantitative limit; the quantitative limit of the mass percent of the green bean component in the chestnut paste is 5%. The method can accurately and quickly detect the mass percentage content of the mung bean components in the chestnut paste, and provides accurate and reliable technical data for authenticity identification of the chestnut paste stuffing.
Drawings
FIG. 1 is a graph of data analysis of a copy percentage limit validation experiment (ddPCR).
FIG. 2 is a 2D plot of the results of copy percentage quantitation validation experiments (cdPCR).
FIG. 3 is a mass percent-copy percent relationship (ddPCR).
FIG. 4 is a mass percent-copy percent relationship (cdPCR).
FIG. 5 is a graph of the results of mass percentage limit validation experiments 1D (ddPCR).
FIG. 6 is a 2D plot of the results of mass percent quantitation limit verification experiments (cdPCR).
Detailed Description
The present invention will be described in further detail below with reference to specific examples and drawings, but the embodiments of the present invention are not limited thereto.
The method for quantitatively detecting the mung bean components in the chestnut paste by using the dual digital PCR comprises the following steps:
1. preparation of sample and extraction of genomic DNA template: 10g of samples (Chinese chestnut, mung bean, chestnut paste stuffing and the like) are taken and crushed by a grinder under the crushing condition of 1800 rpm for 3 minutes.
Weighing 30mg of a sample in a 1.5mL centrifugal tube, and extracting the DNA of the sample by a kit method, wherein the kit can be selected from the following components: DNA extraction methods such as Kurabo quickGene DNA extraction kit DT-S, Wizard Genomic DNA purification kit (Promega, A1120), PSS nucleic acid automatic extractor, and the like. These DNA extraction methods are well known to those skilled in the art, and thus DNA of the corresponding samples is extracted separately.
2. Designing and synthesizing a primer and a probe sequence of the Chinese chestnut species specific gene sequence and a primer and a probe sequence of the mung bean species specific gene sequence, wherein the nucleotide sequences of the primers and the probes are as follows:
3. performing a double digital PCR reaction
(1) Instrument for measuring the position of a moving object
QX200TMDroplet Digital PCR System: comprises a thermal cycler (C1000 Touch)TMthermal cycler), droplet generator (droplet generator), droplet analyzer (droplet reader) and membrane sealer (PCR plate sealer)4 sections, purchased from Bio-rad, usa.
QuantStudioTM3D Digital PCR System: including a PCR system (Dual Flat Block)
PCR System 9700), Chip Loader (Digital Chip Loader) and Chip analyzer (Digital PCR Instrument)3 sections, available from Applied Biosystems by Life Technologies, USA.
(2) Reagent
ddPCR：ddPCRTMPremix (Super Mix for Probes, no dUTP), Droplet Generation Oil (Droplet Generation Oil), Droplet analysis Oil (Droplet Reader Oil), Droplet Generation card slot (Droplet Generator DG8 Cartridge), Droplet Generation card slot gel pad (Droplet Generator DG8 mask), and 96-well plate, available from Bio-Rad, usa.
cdPCR：
Premix (3D Digital PCR Master Mix v2), Chip Kit (3D Digital PCR20K Chip Kit v2, including Chip, Chip lid, brush head, oil seal syringe), purchased from Applied Biosystems by Life Technologies, USA.
Both primers and probes were synthesized by Shanghai flash crystal molecular Biotechnology, Inc.
(3) Sample supply book
The operation steps, the amounts of reagents used, the reaction conditions, etc. are the same for each method except that the sample is different. Specific test specimens and experimental data obtained are detailed in the examples below.
(4) Preparation and Dispersion of the reaction System
The ddPCR reaction system is 20 mu L, and the components are as follows: 2 XddPCRTMPremix (MasterMix)10 μ L; 0.8. mu.L each of primers at a concentration of 10 pmol/. mu.L, 0.4. mu.L each of probes at a concentration of 10 pmol/. mu.L, 2. mu.L of DNA template, and water to 20. mu.L. Respectively adding a 20 mu L reaction system and 70 mu L microdroplet generating oil into a microdroplet generating clamping groove, covering a rubber mat, putting into a microdroplet generating instrument for microdroplet generation, transferring all generated microdroplets (about 40 mu L) into a 96-well plate by using a single-channel electric pipetting gun after the microdroplets are generated, sealing the membrane by using a membrane sealing instrument, and then putting into a thermal cycler for PCR reaction.
The cdPCR reaction system is 15 mu L, and the components are as follows:
premix (MasterMix)7.5 μ L; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.3. mu.L of each probe at a concentration of 10 pmol/. mu.L, 1.5. mu.L of the DNA template, and 15. mu.L of water. And automatically loading the prepared 15-microliter reaction system into micropores on the chip by using a chip loader, immediately covering the surface of the chip with sealing oil by using an oil sealing injector after the system is loaded, and sealing the chip. The sealed chip is placed on a PCR system for amplification.
(5) Reaction procedure
ddPCR reaction conditions: 95 ℃ for 5 minutes (1 ℃/s); 49 cycles of 94 ℃ for 15 seconds (1 ℃/sec), 60 ℃ for 1 minute (1 ℃/sec); the reaction product was stored at 12 ℃.
cdPCR reaction conditions: 10 minutes at 96 ℃; 2 minutes at 60 ℃, 30 seconds at 98 ℃ and 49 cycles; 2 minutes at 60 ℃; the reaction product was stored at 10 ℃.
4. Fluorescence signal reading and analysis
The fluorescence reading in the standard adopts FAM and VIC double-channel fluorescence detection.
After the fluorescence collection is finished, determining a fluorescence threshold value according to the reaction heat point diagram, and distinguishing a negative point from a positive point.
ddPCR data reading: after amplification, the 96-well plate was placed in a microdroplet analyzer to read the fluorescence signal and the experimental data was analyzed using QuantaSoft V1.3.2 software.
cdPCR data read: after the amplification is finished, after the chip is restored to the room temperature, the chip is placed in a chip analyzer to read and preliminarily analyze the chip result, and then the chip result is subjected to QuantStaudioTMThe experimental data were analyzed twice by 3D AnalysisSuiteTM Cloud Software.
5. Calculation of copy percentage
And calculating the percentage of the mung beans in the DNA copies of the Chinese chestnuts and the mung beans according to the detection result of the fluorescent signals.
The mung bean accounts for the percentage of the Chinese chestnut and the mung bean DNA copies
a-mung bean specific gene copy number concentration (copies/microliter)
b-chestnut specific gene copy number concentration (copies/microliter).
6. Establishment of mass percent-copy percent relation
The preparation method comprises the steps of taking Chinese chestnuts as a matrix, and doping mung beans with different mass percentages to obtain not less than 5 series mung bean/Chinese chestnut mixed samples in mass percentage. For example, mung bean/chestnut powder mixture samples having mung bean ingredients of 0.1%, 1%, 5%, 10%, 40%, 50%, and 100% by mass were prepared. 3 replicates of each sample, each of which is 30mg, are weighed and subjected to DNA extraction, and after each sample is diluted by 10 times, 1 replicate ddPCR and cdPCR are performed respectively. The mass percent-copy percent relationship was established using data analysis software.
7. Conversion of mass percentage
Substituting the copy percentage of the sample to be detected obtained in the step 5 into the mass percentage-copy percentage relation in the step 6, and converting to obtain the mass percentage content of the mung bean component in the sample to be detected in the Chinese chestnut and mung bean components.
8. Quality control
(1) Quality control of sample testing
a. Calculation of relative standard deviation between sample parallel
The sample digital PCR reaction should be set to be 3 parallels, under the condition that the copy number concentration of the detection result is ensured to be larger than the quantitative detection limit and the positive reaction quantity is lower than 80 percent of the total reaction quantity, the Relative Standard Deviation (RSD) of the copy number concentration of the 3 parallel samples needs to meet the condition that the RSD is not more than 25 percent, and the average value measured by the 3 parallel samples is used as the gene content of the mung bean/Chinese chestnut and mung bean of the sample for subsequent analysis.
b. Control of effective microreaction number
The total number of effective micro-reactions generated during the segmentation of the digital PCR system must not be less than 60% (i.e., 12000) of the theoretical number of platforms; the number of positive systems must not exceed 80% of the total number of systems.
c. Quality control of blank control
The theoretical detection result of the digital PCR blank control should be zero. However, in practical tests, a very small number of positive coefficients are allowed to occur. The positive microreaction coefficient in the blank should be less than 0.03% of the actual effective value.
If one of the above quality control conditions is not satisfied, the test result should be discarded and the digital PCR test should be performed again.
(2) Confirmation of performance index
a. Absolute limit of copy number concentration
And (3) taking RSD not more than 25% as a judgment basis of effective quantitative data, wherein the absolute quantitative limit of the copy number concentration is the lowest copy number concentration when the RSD of the detection result is not more than 25%. And (3) carrying out digital PCR quantitative detection on the DNA of the Chinese chestnuts and the mung beans with the serial dilution concentration, setting 3 parallels for each concentration, and calculating the RSD value of the parallel detection result of each concentration. The absolute quantitative limit of the method to the copy number concentration of DNA of mung beans and Chinese chestnuts is 6 copies/microliter.
b. Copy percentage quantitative limit and recovery
The RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent as the judgment basis of effective quantitative data, and the quantitative limit of the copy percentage is the lowest copy percentage when the RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent. And (3) carrying out digital PCR quantitative detection on the Chinese chestnut and mung bean DNA with the percentage of the serial doped copies, setting 3 copies for each copy percentage, and calculating the RSD value and the recovery rate of the parallel detection result of each copy percentage. The method has the limit of 1% of the quantitative limit of the copy percentage of the mung beans in the DNA of the Chinese chestnut and the mung beans.
c. Mass percent quantitation limit and recovery
And the RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent as the judgment basis of effective quantitative data, and the mass percentage quantification limit is the lowest mass percentage when the detection result RSD is less than or equal to 25 percent and the recovery rate is 80-120 percent. And (3) carrying out DNA extraction and digital PCR quantitative detection on the chestnut paste with the series of mass percent, setting 3 parallels for each mass percent, and calculating the RSD value and the recovery rate of the parallel detection result of each mass percent. The method has the limit of 5% for the mass percentage of the mung beans in the Chinese chestnut and mung bean components.
Example 1: verification of absolute limit of quantitation of copy number
Supplying a sample book: in order to verify the absolute quantitative limit of the copy number of the method, the chestnut and mung bean genome DNA is respectively extracted and serially diluted to obtain 300, 100, 20, 10, 5 and 1 copy/microliter mung bean DNA and chestnut DNA with serially diluted concentration. 3 parallel ddPCR and cdPCR experiments were performed, respectively, and the results are shown in Table 1.
TABLE 1 verification of absolute limits of quantitation of DNA copy numbers of mung beans and chestnuts (ddPCR and cdPCR)
As can be seen from the results shown in Table 1, on the ddPCR platform, when the mung bean DNA copy number concentration is 1.30 copies/microliter, the RSD value between three parallels is more than 25%, when the mung bean DNA copy number concentration is more than or equal to 5.68 copies/microliter, the RSD value between three parallels is less than 25%, and the absolute quantification limit of the mung bean DNA copy number concentration is 5.68 copies/microliter; when the DNA copy number concentration of the Chinese chestnut is 1.03 copies/microliter, the RSD value among the three parallels is more than 25 percent, when the DNA copy number concentration of the Chinese chestnut is more than or equal to 5.27 copies/microliter, the RSD value among the three parallels is less than 25 percent, and the absolute quantification limit of the DNA copy number concentration of the Chinese chestnut is 5.27 copies/microliter. On a cdPCR platform, when the mung bean DNA copy number concentration is 1.25 copies/microliter, the RSD value among three parallels is more than 25 percent, when the mung bean DNA copy number concentration is more than or equal to 5.58 copies/microliter, the RSD value among the three parallels is less than 25 percent, and the absolute quantitative limit of the mung bean DNA copy number concentration is 5.58 copies/microliter; when the DNA copy number concentration of the Chinese chestnut is 1.06 copies/microliter, the RSD value among the three parallels is more than 25 percent, when the DNA copy number concentration of the Chinese chestnut is more than or equal to 5.57 copies/microliter, the RSD value among the three parallels is less than 25 percent, and the absolute quantification limit of the DNA copy number concentration of the Chinese chestnut is 5.57 copies/microliter. For the application of the method, the absolute quantitative limit integer of the DNA copy number concentration of mung beans and Chinese chestnuts is 6 copies/microliter.
Example 2: verification of copy percentage quantitative limit
Supplying a sample book: in order to verify the quantitative limit of the copy percentage of the method, Chinese chestnut DNA with known copy number concentration is used as a matrix, mung bean DNA with known copy number concentration is doped, and mixed samples of Chinese chestnut and mung bean DNA with the serial doping percentage of 0.1%, 1%, 10%, 50% and 95% are obtained. 3 parallel ddPCR and cdPCR experiments were performed, respectively, and the results are shown in FIGS. 1 and 2.
As can be seen from the results shown in FIGS. 1 and 2, for the mung bean genomic DNA samples with copy percentage ratios of 1%, 10%, 50% and 95%, respectively, the detection results on the ddPCR platform were 1.017%, 10.733%, 53.133% and 95.327%, respectively, the RSD values between three replicates were between 0.39% and 12.84%, and the recovery rate was between 100.34% and 107.33%; the detection results on the cdPCR platform are respectively 0.957%, 9.750%, 50.718% and 95.574%, the RSD value between three parallels is 0.66% -10.97%, and the recovery rate is 95.73% -101.44%. For samples with a percentage of copies of 0.1%, the copy number concentration measured was below the absolute limit of quantitation of 6 copies/microliter, and the RSD values and recoveries between the three replicates were all above the valid values, and the results were not valid quantitative data. Thus, the copy percentage of the present method is limited to 1% of quantitation.
Example 3: establishment of mass percent-copy percent relation
Sample supply: in order to establish a mass percent-copy percent relation, Chinese chestnuts are used as a matrix, and mung beans with different mass percentages are mixed to obtain mixed samples of mung beans and Chinese chestnut powder with the mass percentages of 1%, 5%, 10%, 20%, 40% and 50%. 3 replicates of each sample, each of which is 30mg, are weighed and subjected to DNA extraction, and after each sample is diluted by 10 times, 1 replicate ddPCR and cdPCR are performed respectively. The mass percent-copy percent relationship was established using data analysis software and the resulting relationship is shown in fig. 3 and 4. For the sample with the mass percent of 1%, the recovery rate of the copy percent does not meet the judgment basis of effective quantitative data, and the detection result is not effective quantitative data. Therefore, the relational expression is established by using the detection results of 5%, 10%, 20%, 40% and 50% by mass.
The relationship of mass percent-copy percent established on the ddPCR platform is shown in FIG. 3, and is: -2.4288x2+2.6592x +0.1031, where y is the copy percentage and x is the mass percentage. R2Is 0.9976.
The relation between mass percent and copy percent ratio established in the cdPCR platform is shown in FIG. 4, and the relation is: y-3.3024 x2+3.0576x +0.1213, where y is the copy percentage and x is the mass percentage. R2Is 0.9918.
Example 4: verification of mass percent quantitation limit
Supplying a sample book: in order to verify the quantitative limit of the mass percent of the method, Chinese chestnuts are used as a substrate, mung beans with different masses are mixed into the Chinese chestnut paste, and the Chinese chestnut paste samples with the mass mixing ratios of the series of mung beans of 1%, 5%, 10%, 40% and 50% are obtained. 3 replicates of each sample, each of which is 30mg, are weighed and subjected to DNA extraction, and after each sample is diluted by 10 times, 1 replicate ddPCR and cdPCR are performed, respectively, and the obtained experimental results are shown in FIGS. 5 and 6.
Fig. 5 shows a graph (ddPCR) of fig. 1D of the results of the mass% limit verification experiment, in which E02, F02, and G02 are samples of chestnut paste at 5% by mass of mung beans, B02, C02, and D02 are samples of chestnut paste at 10% by mass of mung beans, D01, E01, and F01 are samples of chestnut paste at 40% by mass of mung beans, and a01, B01, and C01 are samples of chestnut paste at 50% by mass of mung beans.
The mass percent quantitation limit verification experiment results 2D plot (cdPCR) is shown in FIG. 6.
The percent copy ratio was calculated from the experimental results and was substituted into the mass percent-percent copy ratio relation of example 3 to convert the mass percent. For the chestnut paste samples with the mung bean mass percentage of 5%, 10%, 40% and 50%, the detection results on the ddPCR platform are 5.44%, 9.15%, 40.56% and 49.52%, the RSD value between the three parallels is 1.09-12.98%, and the recovery rate is 91.53-108.72%. The detection results on the cdPCR platform are 5.51%, 8.75%, 42.05% and 48.15% respectively, the RSD value between three parallels is 0.34% -12.72%, and the recovery rate is 87.54% -110.13%. For the chestnut paste sample with the mass percent of 1%, the recovery rate of the mass percent does not meet the judgment basis of effective quantitative data, and the detection result is not the effective quantitative data. Therefore, the quantitative limit of the mass percent of the method is 5%.
Sequence listing
<110> inspection and quarantine technology center of Guangdong entry-exit inspection and quarantine bureau
<120> method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aagcctaaaa tgcgacacta cg 22
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgtctccaag ccccaacg 18
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cctccactgc cttgacgagg aagc 24
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aacagcggct aactcgatgt c 21
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
Claims (7)
1. A method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR is characterized by comprising the following steps: the method comprises the steps of detecting two fluorescent signals simultaneously by a digital PCR system by adopting a dual-channel detection method, marking probes for detecting a mung bean species specific gene sequence and a Chinese chestnut species specific gene sequence as VIC and FAM respectively, calculating the copy number concentration of the mung bean species specific gene sequence and the Chinese chestnut species specific gene sequence in the same PCR reaction system to obtain the percentage of DNA copy of mung bean in Chinese chestnut and mung bean, and converting to obtain the mass percentage of mung bean components in Chinese chestnut and mung bean components;
the method comprises the following steps:
step 1, extracting DNA of a chestnut paste sample;
designing and synthesizing primers and probe sequences of the Chinese chestnut species specific gene sequence and the mung bean species specific gene sequence;
step 3, carrying out double digital PCR reaction;
step 4, reading and analyzing a fluorescence signal by adopting FAM and VIC double-channel fluorescence detection;
step 5, calculating the percentage of the mung beans in the DNA copies of the Chinese chestnuts and the mung beans according to the detection result of the fluorescent signals, and converting to obtain the mass percentage of the mung bean components in the Chinese chestnuts and the mung beans;
wherein the mung bean accounts for the percentage of the DNA copies of the Chinese chestnut and the mung bean
Wherein a is the copy number concentration of the mung bean specific gene, and b is the copy number concentration of the Chinese chestnut specific gene;
wherein, the mung bean component accounts for the mass percent of the Chinese chestnut and the mung bean component, and is obtained by establishing a relational expression of the copy percent ratio and utilizing the copy percent ratio;
in the step 2, the sequences of the primers and the probes of the Chinese chestnut species specific gene sequence are as follows:
chestnut specific gene-F: AAGCCTAAAATGCGACACTACG, respectively;
chestnut specific gene-R: TGTCTCCAAGCCCCAACG, respectively;
chestnut specific gene-P: FAM-CCTCCACTGCCTTGACGAGGAAGC-BHQ 1;
in the step 2, the sequences of the primers and the probes of the mung bean species specific gene sequence are as follows:
mung bean specific gene-F: GACCGGCAGCTTATGCTTCA, respectively;
mung bean specific gene-R: AACAGCGGCTAACTCGATGTC, respectively;
mung bean specific gene-P: VIC-CAATTAAAGTCGCATGAGAG-MGB.
2. The method according to claim 1, wherein the step 1 comprises extracting sample DNA from the chestnut mash sample by a kit method.
3. The method of claim 1, wherein the dual digital PCR reaction comprises a ddPCR reaction and a cdPCR reaction.
4. The method of claim 3, wherein the ddPCR reaction conditions are: 95 ℃, 5 minutes, 1 ℃/second; 49 cycles of 94 ℃, 15 seconds, 1 ℃/second, 60 ℃, 1 minute, 1 ℃/second; the reaction product was stored at 12 ℃.
5. According to claimThe method is characterized in that the ddPCR reaction system is 20 mu L, and the components are as follows: 2 XddPCRTM10 mu L of premix liquid; 0.8. mu.L each of primers at a concentration of 10 pmol/. mu.L, 0.4. mu.L each of probes at a concentration of 10 pmol/. mu.L, 2. mu.L of DNA template, and water to 20. mu.L.
6. The method of claim 3, wherein the cdPCR reaction conditions are: at 96 ℃ for 10 minutes; 49 cycles of 60 ℃, 2 minutes, 98 ℃, 30 seconds; 2 minutes at 60 ℃; the reaction product was stored at 10 ℃.
7. The method of claim 3, wherein the cdPCR reaction system is 15 μ L, and the components are as follows:
7.5 mu L of premix; mu.L of each primer at a concentration of 10 pmol/. mu.L, 0.3. mu.L of each probe at a concentration of 10 pmol/. mu.L, 1.5. mu.L of DNA template, and 15. mu.L of water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375164.5A CN110396554B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375164.5A CN110396554B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110396554A CN110396554A (en) | 2019-11-01 |
| CN110396554B true CN110396554B (en) | 2022-06-17 |
Family
ID=68323020
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910375164.5A Active CN110396554B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110396554B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060462A (en) * | 2013-01-18 | 2013-04-24 | 天津生物芯片技术有限责任公司 | Gene chip and detection kit for detecting common food allergens |
| US10466246B2 (en) * | 2015-04-29 | 2019-11-05 | Dots Technology Corp. | Compositions and methods for allergen detection |
-
2019
- 2019-05-07 CN CN201910375164.5A patent/CN110396554B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110396554A (en) | 2019-11-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104293778B (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN106811513B (en) | Eucalyptus component real-time fluorescence PCR detection method and kit thereof | |
| CN112322766A (en) | Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology | |
| CN108060241A (en) | A kind of dual digital pcr method that pigeon derived component quantitatively detects | |
| CN111424110B (en) | Kit for identifying gleditsia sinensis and identification and quantification method | |
| CN110396554B (en) | Method for quantitatively detecting mung bean components in chestnut paste by using dual digital PCR (polymerase chain reaction) | |
| CN111718984A (en) | Method for STR typing of forensic mixed DNA sample | |
| CN111979308B (en) | Primer composition, kit and method for identifying early sex of pigeons | |
| CN113699220A (en) | Method for identifying honey and tracing honey producing area by regional plant sources | |
| CN109929946B (en) | Kit for quantitatively detecting cassava components based on micro-drop digital PCR and application thereof | |
| CN110438251B (en) | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) | |
| CN110317858B (en) | Method for quantitatively detecting kidney bean components in lotus paste by using dual digital PCR (polymerase chain reaction) | |
| CN109943627B (en) | Method for quantitatively detecting peanut components in sesame paste and sesame paste by using dual digital PCR (polymerase chain reaction) | |
| CN112725514A (en) | Micro-drop digital PCR (polymerase chain reaction) primer, probe, kit and method for quantitatively detecting cordyceps sinensis | |
| CN110408682B (en) | Method for quantitatively detecting red bean and red bean components in food by using dual digital PCR | |
| CN106701746B (en) | High-throughput malt Purity technology based on Capillary Electrophoresis and SSR marker | |
| CN109680098A (en) | A kind of kit and its application based on droplet digital pcr quantitative detection potato ingredient | |
| CN114622028B (en) | Primer pair combination, kit and detection method for detecting transgenic papaya | |
| CN108085374A (en) | A kind of dual digital pcr method that turkey derived component quantitatively detects | |
| CN106520914A (en) | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials | |
| KR102335806B1 (en) | Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof | |
| CN104962640A (en) | Method for quickly identifying authenticity of conventional cotton varieties by using SSR (Simple Sequence Repeat) marker | |
| CN105803086A (en) | Quantitative detection method for donkey-derived and swine-derived components in donkey-hide gelatin liquid semi-finished product or finished product, composition and kit | |
| CN117757979B (en) | Primer group, kit and identification method for identifying soybean varieties | |
| CN108830046B (en) | Method for estimating DNA content of biotechnological product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 510623 block B, Guangdong check tower, 66 Huacheng Road, Zhujiang New Town, Guangzhou, Guangdong. Applicant after: Guangzhou Customs Technology Center Address before: 510623 block B, Guangdong check tower, 66 Huacheng Road, Zhujiang New Town, Guangzhou, Guangdong. Applicant before: Inspection & Quarantine Technology Center of Guangdong Entry-Exit Inspection & Quarantine Bureau |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |