CN106520914A - Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials - Google Patents
Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials Download PDFInfo
- Publication number
- CN106520914A CN106520914A CN201510577835.8A CN201510577835A CN106520914A CN 106520914 A CN106520914 A CN 106520914A CN 201510577835 A CN201510577835 A CN 201510577835A CN 106520914 A CN106520914 A CN 106520914A
- Authority
- CN
- China
- Prior art keywords
- probe
- detection
- carnis
- quantitative
- derived material
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to oligonucleotide primers and a probe used for precise and quantitative detection of ovine-derived materials, and a kit comprising the primers and the probe. The invention further relates to a digital PCR detection method used for quantitative detection of ovine-derived materials. The method involves use of the specific oligonucleotide primers and the fluorescent mark probe specific to the mutton single-copy nuclear gene. The invention further relates to the application of the specific oligonucleotide primers and the fluorescent probe specific to the mutton single-copy nuclear gene in quantitative detection of ovine-derived materials. By means of the digital PCR detection method, the content of ovine-derived materials in a sample can be determined precisely and sensitively.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to be used for the oligonucleotide primers and fluorescence labeling probe of sheep derived material detection, test kit comprising the primed probe, for determining the application of the digital pcr detection method of sheep derived material and the specific oligonucleotide primer of sheep derived material in sample and probe in detection sheep derived material.
Background technology
Meat products occupy significant proportion in resident's food consumption, but China's meat adulteration sell-fake-products behavior in recent years is rampant, and the masses are abhored to this.Public security in 2004 and the administration for industry and commerce have cracked " adulterated Carnis caprae seu ovis " case of the productions such as a collection of use fox, mink and duck meat, cause public opinion extensive concern.The Beijing News the reporter discovered, in each Carnis caprae seu ovis wholesale market in Beijing, be flooded with and pretend to be Carnis caprae seu ovis.Make a desperate move without good businessman, acquired wealth unjustly by making and selling adulterated Carnis caprae seu ovis greatly.At present, the phenomenon for obscuring meat kind on market is still very universal, wherein mixes Carnis Gallus domesticus, duck meat, beef, Carnis Sus domestica, other meats and plant source protein etc. in Carnis caprae seu ovis extremely product of common occurrence.
But, as the detection of current meat only has qualitative method, relevant national standard can only also carry out composition qualitative detection, it is impossible to carry out accurate quantitative analysis detection.Therefore, although many laboratorys of department subordinate such as at present quality supervision, food medicine supervision all possess certain meat DNA identification technologies, but can only identify that " adulterated meat " is inner which meat mixed, but can not analyze which kind of meat account for how many ratios.Due to lacking Carnis caprae seu ovis quantitative approach and relevant criterion, cause the large quantities of adulterated sample that public security department discovers and seizes carry out substantive differentiation, judge that to the later stage responsibility of illegal manufacturer is impacted, many illegal retailers are able to escape and punish.
Quantitative study is carried out using real-time fluorescence PCR technology to Meat ingredients in food at present once to have been reported that, no matter using TaqMan
Probe or SYBR Green dyestuffs carry out digital pcr detection, initial target gene can be carried out tentatively quantitatively with the standard curve of template amount by drawing Ct values.But, Meat ingredients detection by quantitative is carried out using Real-Time Fluorescent Quantitative PCR Technique there is problems with：(1) all need while carry out the amplification of concentration known standard substance and make standard curve, to improve testing cost and workload is excessive due to carrying out detection operation every time；(2) coded sequence singly copied in meat cellular genome is degraded in food processing process seriously, causes detection sensitivity too low；(3) difference of PCR amplification efficiencies may result in the deviation of quantitative result；(4) impurity or DNA degradation for introducing DNA solution during DNA extraction have impact on PCR dynamic amplification procedures etc..
Therefore, this area needs a kind of quick, detection method of the sheep derived material that specificity is good, sensitivity is high, carries out the detection of sheep derived material in food.
Digital pcr (digital polymerase chain reaction, dPCR) realizes the absolute quantitation of unique DNA as more accurate and more sensitive DNA detection by quantitative new technique.DPCR is the DNA absolute quantification methods set up on the basis of ordinary numbers PCR, the problems such as solving standard curve used by ordinary numbers PCR and produce impact to measurement result, and can reduce its matrix effect brought.The characteristics of dPCR has measurement independence with without the need for any caliberator.At present, the technology Preliminary Applications in meat detection by quantitative.As China is to the increasingly strong of meat adulteration power of test demand, the Meat ingredients detection by quantitative that appears as of dPCR technologies opens new approach so that in food, the quantitative analyses of Meat ingredients are possibly realized with tracing to the source.Important directions of the accurate quantitative measurement technology development of meat product will be become using the accuracy and practical value of dPCR skill upgrading quantitative detecting methods.
The content of the invention
It is an advantage of the invention to provide the specific oligonucleotide primer and fluorescence labeling probe of accurate detection by quantitative sheep derived material.
It is a further object of the invention to provide precisely quantitative determining the digital pcr detection kit of sheep derived material.
It is a further object of the invention to provide precisely quantitative determining the digital pcr detection method of sheep derived material.
The present invention's further an object is that, there is provided application of the specific oligonucleotide primer and probe of sheep derived material in sheep derived material in accurate detection by quantitative food.
For foregoing invention purpose, the present invention provides technical scheme below：
The present inventor is according to the housekeeping gene replication in the single-copy nuclear gene group of Carnis caprae seu ovis
Protein A1 devise can specificity differentiate the oligonucleotide primers of sheep derived material to and probe, one section shorter of Carnis caprae seu ovis specific gene fragment can be gone out by efficient specific amplified from sample DNA.An embodiment of the invention, the present invention is provided to the specific oligonucleotide primer pair of digital pcr method detection sheep derived material and fluorescence labeling probe, the primer pair and probe are according to housekeeping gene replication
Protein A1 sequences in different plant species have diversity the characteristics of and design.The primer pair is made up of forward primer and downstream primer, and the forward primer is Mutt-F5：CACCTCTTTCCAAGCATCCAGGTA（SEQ
ID No.1）, the downstream primer is Mutt-R5：GCTCACTCCTCCAGCCTAGCAAG（SEQ ID No.2）；The probe is Mutt-P5：CTGGGTGAGCGTGGCACATGGAGGC（SEQ
ID No.3）, fluorescent quenching group BHQ1 is connected with 3 ' ends of probe, 5 ' ends are connected with a fluorescent reporter group FAM.In one embodiment, the Carnis caprae seu ovis specific detection compositionss that the present invention is provided, the compositionss include specific oligonucleotide primer pair and probe.In a preferred embodiment, the invention provides for the compositionss of digital pcr method detection by quantitative sheep derived material, the compositionss include Carnis caprae seu ovis specific oligonucleotide primer pair and probe, to being made up of forward primer and downstream primer, the base sequence of the forward primer is SEQ to wherein described Carnis caprae seu ovis specific primer
ID No.1, the base sequence of the downstream primer is SEQ ID No.2；The base sequence of the probe is SEQ ID No.3, is connected with fluorescent quenching group BHQ1 at 3 ' ends of probe, and 5 ' ends are connected with a fluorescent reporter group FAM.
Another embodiment of the invention, the present invention provides the digital pcr quantitative detecting method of sheep derived material, methods described includes using specific oligonucleotide primer pair and the probe for sheep derived material, the primer pair and probe to be according to housekeeping gene replication
Protein A1 sequences in different plant species have diversity the characteristics of and design.In one embodiment, in the digital pcr quantitative detecting method of the sheep derived material of the present invention, the Carnis caprae seu ovis specific oligonucleotide primer pair for being used is made up of forward primer and downstream primer, the base sequence of the forward primer is SEQ ID No.1, and the base sequence of the downstream primer is SEQ ID No.2；The base sequence of the probe is SEQ
ID No.3, are connected with fluorescent quenching group BHQ1 at 3 ' ends of probe, and 5 ' ends are connected with a fluorescent reporter group FAM.In one embodiment, described PCR amplification conditions are 95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 circulations；98℃10 min（1℃/s）.
In one embodiment, Carnis caprae seu ovis digital pcr quantitative detecting method of the invention is still further comprised and determines the step of detection by quantitative of specific oligonucleotide primer and probe combinations is limited.In one embodiment, the digital pcr detection method detection by quantitative goes out sheep derived material detection is spacing to be more than 5 copies.
Another embodiment of the invention, the present invention is provided to the accurate test kit of detection by quantitative sheep derived material, the test kit includes the present invention and detects for digital pcr method specific oligonucleotide primer pair and probe and the operation instructions of sheep derived material.In the test kit preferred embodiment of the present invention, the sheep derived material detection by quantitative specific oligonucleotide primer pair of the present invention is according to housekeeping gene replication protein
A1 sequences in different plant species have diversity the characteristics of and design.In one embodiment, the Carnis caprae seu ovis specific oligonucleotide primer pair of the test kit is made up of forward primer and downstream primer, and the base sequence of the forward primer is SEQ
ID No.1, the base sequence of the downstream primer is SEQ ID No.2；The base sequence of the test kit middle probe is SEQ ID No.3, is connected with fluorescent quenching group BHQ1 at 3 ' ends of probe, and 5 ' ends are connected with a fluorescent reporter group FAM.Another embodiment of the invention, the present invention is provided to the accurate test kit of detection by quantitative sheep derived material, the test kit includes the specific oligonucleotide primer pair and probe and the operation instructions that differentiate sheep derived material for digital pcr method of the present invention.In a preferred embodiment of test kit, Carnis caprae seu ovis specific oligonucleotide primer pair SEQ in the test kit, is included
ID No.1, SEQ ID No.2 and Carnis caprae seu ovis specific probe SEQ ID No.3, in Carnis caprae seu ovis replication
3 ' ends of protein A1 housekeeping gene probes are connected with fluorescent quenching group BHQ1, and 5 ' ends are connected with a fluorescent reporter group FAM.In preferred embodiments, the operation instructions of the test kit include the description to the digital pcr amplification condition for quick detection sheep derived material.In a preferred embodiment, the PCR amplification conditions for being given in the description of the test kit are 95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 circulations；98℃10 min（1℃/s）.In a specific embodiment, the present invention also includes reference substance for the test kit of sheep derived material detection by quantitative.Preferably, reference substance includes negative controls and positive reference substance.In one embodiment, negative control is aseptic double-distilled water.
Further embodiment of the invention, the present invention provide the application for the specific oligonucleotide primer and probe of digital pcr method detection sheep derived material in sheep derived material in detection food of the present invention.In a preferred embodiment, the present invention provides specific oligonucleotide primer pair SEQ ID No.1, the SEQ ID No.2 and Carnis caprae seu ovis specific probe SEQ of sheep derived material in fruit juice
ID No.3, are connected with fluorescent quenching group BHQ1 at 3 ' ends of Carnis caprae seu ovis ITS gene probes, and 5 ' ends are connected with a fluorescent reporter group FAM.In another embodiment, the present invention also provides the application of the test kit in detection by quantitative sheep derived material of the present invention.Preferably, in the above-mentioned application of the present invention, the test kit includes the Carnis caprae seu ovis specific oligonucleotide primer pair of the present invention and probe.It is furthermore preferred that in the above-mentioned application of the present invention, the test kit includes the application of the Carnis caprae seu ovis specific oligonucleotide primer pair of the present invention and probe in detection sheep derived material.
The present invention is basic by detection of the DNA of Carnis caprae seu ovis, according to replication
The characteristics of protein A1 gene orders have diversity in different mammalian species, comparison analyze Carnis caprae seu ovis replication
Protein A1 gene orders.According to these primers, using the sheep derived material in digital pcr standard measure detection sample.
Digital pcr technology (digital
Polymerase chain reaction, dPCR it is) by micro-example classification is made big multiple dilutions and subdivision, until after testing molecule number contained in each subdivision sample is not over 1, all subdivision samples are entered into performing PCR amplification simultaneously under the same conditions again, a kind of technology for being counted according to Poisson distribution principle one by one, is a kind of absolute quantitation measuring method.
The digital pcr detection method of the present invention using the detection of complete stopped pipe, without the need for PCR post processings, it is to avoid cross-contamination and false positive.The method of the present invention has dexterously used DNA efficient amplifications, the specificity of nucleic acid hybridization and the quick of detection technique of fluorescence and the sensitivity of round pcr, has the advantages that simple to operate, time saving and energy saving, reliable results and accurately sensitive.The present invention according to test kit made by primer sequence, for the qualitative and quantitative analysis of such product, with sensitivity height, high specificity, result is reliable and stable and avoids cross-contamination from causing false-positive advantage.Using the PCR detection method and PCR detection kit of the present invention, accurate detection by quantitative can be carried out to sheep derived material, be suitable on domestic and international market the detection by quantitative of sheep derived material in meat productss the characteristics of which is special sensitive.
Description of the drawings
Fig. 1 is the gel electrophoresis figure for showing testing sample DNA extraction effect, and the sample of wherein each swimming lane is as follows：M：DNA molecular amount labelling (2000)；1：Carnis caprae seu ovis；2：Carnis Gallus domesticus；3：Duck meat；4：Pigeon meat；5：Carnis Anseris domestica；6：Beef；7：Equus caballus (L.); 8：Carnis Sus domestica；9：Carnis Equi Asini；10：Carnis Leporis；11：Carnis Canitis；12：Big rat meat；13：Little rat meat；14：Fox meat；15：Blank（Aseptic double-distilled water）.
Fig. 2 is shown the result by real-time fluorescent PCR amplification Carnis caprae seu ovis replication protein A1 gene orders, it is the amplification curve of meat samples wherein above baseline, is Carnis Gallus domesticus, duck meat, pigeon meat, Carnis Anseris domestica, beef, Equus caballus (L.), Carnis Sus domestica, Carnis Equi Asini, Carnis Leporis, Carnis Canitis, big rat meat, little rat meat, fox meat and blank below baseline（Aseptic double-distilled water）.
Fig. 3 is the result figure of the accurate detection by quantitative Carnis caprae seu ovis of display digit PCR and other meat compositions, is wherein from left to right followed successively by Carnis caprae seu ovis, Carnis Gallus domesticus, duck meat, pigeon meat, Carnis Anseris domestica, beef, Equus caballus (L.), Carnis Sus domestica, Carnis Equi Asini, Carnis Leporis, Carnis Canitis, big rat meat, little rat meat, fox meat and blank（Aseptic double-distilled water）.
Fig. 4 is that the sensitivity to the accurate detection by quantitative sheep derived material of digital pcr is evaluated, and carries out 10 times of dilutions of 3 gradients again, be followed successively by blank in figure from left to right after meat samples genomic DNA first to be carried out 5 times of dilutions（Aseptic double-distilled water）, stock solution dilute 1000 times, stock solution dilute 100 times, stock solution dilute 10 times, stock solution dilute 2 times.
Fig. 5 is that the digital pcr technology set up using the present invention carries out quantitative result figure to commercially available meat samples.Blank is followed successively by from left to right（Aseptic double-distilled water）, positive control（Fresh mutton）, mutton roll, mutton cubes roasted on a skewer, mutton meatballs, mutton soup.
Specific embodiment
By way of embodiment, the present invention is further illustrated, but the present invention is not limited only to following examples.
Embodiment
1
The present embodiment is the extraction quality by agarose gel electrophoresis method for detecting test sample STb gene.
Method used in the present embodiment is to prepare the agarose gel of 2 %, takes 2 μ L DNA samples and adds bromophenol blue to mix, with DL2000 DNA
Ladder Marker as reference, 100 V constant pressures electrophoresis 20
min.Gel is imaged with gel imaging system Jing after EB dyeing.
In the present embodiment, the extraction quality of sample Carnis caprae seu ovis, Carnis Gallus domesticus, duck meat, pigeon meat, Carnis Anseris domestica, beef, Equus caballus (L.), Carnis Sus domestica, Carnis Equi Asini, Carnis Leporis, Carnis Canitis, big rat meat, little rat meat, the STb gene of fox meat is have detected, and aseptic double-distilled water is used as blank.
As shown in figure 1, all samples can appear above band in 2000 bp, show all testing sample DNA extraction successes.
Embodiment
2
The present inventor's first passage real-time fluorescence PCR（Sonde method）Amplification Carnis caprae seu ovis replication
Protein A1 genes.The Carnis caprae seu ovis replication protein A1 gene primers probe sequence for being used is Mutt-F5：CACCTCTTTCCA
AGCATCCAGGTA（SEQ ID No.1）, GCTCACTCCTCCAGCCTAGCAAG（SEQ
ID No.2）, FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1（SEQ ID No.3）.
1. the detection key instrument for being used：
Micropipettor（eppendorf）, quantitative real time PCR Instrument（AB7500）, high speed tabletop centrifuge (12 000 r/min), electrophresis apparatuses (DYY22C types) etc..
2. main agents are detected：
2 × TaqMan Universal PCR Master Mix (ABI), primed probe（Thermofisher）Deng.
3. key step is detected：
Real-time fluorescence PCR reaction system：
2×Mastermix 12.5μL
Forward primer（10mM） 1.0μL
Downstream primer（10mM） 1.0μL
Probe（10mM）
0.5μL
Template DNA 50ng
Plus aseptic double-distilled water to cumulative volume is 25 μ L
Note：Corresponding blank is set up in PCR detections every time（Replace whether DNA profiling, detectable are contaminated with the ultra-pure water for preparing reaction system）；
4 real-time fluorescence PCR response parameters：
95℃ 10 min
95℃ 15
s
60℃ 1
min
Note：PCR each reagent and response parameter should be made the appropriate adjustments by different instruments.
As shown in Figure 2, during using real-time PCR detection Carnis caprae seu ovis replication protein A1 genes, meat samples may occur in which amplification curve, and fluorescence curve do not occur in the various animals nearer with Carnis caprae seu ovis sibship such as Carnis Gallus domesticus, duck meat, pigeon meat, Carnis Anseris domestica, beef, Equus caballus (L.), Carnis Sus domestica, Carnis Equi Asini, Carnis Leporis, Carnis Canitis, big rat meat, little rat meat, fox meat and blank, show that the primed probe is more special to Carnis caprae seu ovis.
Embodiment
3
The present embodiment is the copy number of the primer probe sequence Jing digital pcr detection by quantitative Carnis caprae seu ovis genes of the replication protein A1 genes by using Carnis caprae seu ovis.The Carnis caprae seu ovis replication protein A1 gene primers probe sequence for being used is Mutt-F5：CACCTCTTTCCA
AGCATCCAGGTA（SEQ ID No.1）, GCTCACTCCTCCAGCCTAGCAAG（SEQ
ID No.2）, FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1（SEQ ID No.3）.
1. the detection key instrument for being used：
Micropipettor（eppendorf）, droplet type digital pcr instrument（Bio-rad, QX200）, high speed tabletop centrifuge (12
000 r/min) etc..
2. main agents are detected：
2 × TaqMan Master Mix (Bio-rad), primed probe（Thermofisher）Deng.
3. key step is detected：
Digital pcr reaction system：
2×Mastermix 10 μL
Forward primer（10mM） 1.0μL
Downstream primer（10mM） 1.0μL
Probe（10mM）
0.5μL
5.0 μ L of template DNA
Aseptic double-distilled water
2.5μL
Note：Corresponding blank is set up in PCR detections every time（Replace whether DNA profiling, detectable are contaminated with the ultra-pure water for preparing reaction system）；
4. digital pcr response parameter：
95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 circulations；98℃10 min（1℃/s）
Note：PCR each reagent and response parameter should be made the appropriate adjustments by different instruments.
As shown in Figure 3, during using the accurate detection by quantitative Carnis caprae seu ovis of digital pcr and other samples, successfully detect Carnis caprae seu ovis amount be 2641copies/ μ L, and without amplification, other samples such as Carnis Gallus domesticus, duck meat, pigeon meat, Carnis Anseris domestica, beef, Equus caballus (L.), Carnis Sus domestica, Carnis Equi Asini, Carnis Leporis, Carnis Canitis, big rat meat, little rat meat, fox meat and blank show that the method can accurately detect the content of meat samples.
Embodiment
4
It is identical with the method described in embodiment 3, carried out after meat samples genomic DNA only first to be carried out 5 times of dilutions again after 10 times of dilutions of 3 gradients as template, using Carnis caprae seu ovis replication
Protein A1 gene primers probe sequence is Mutt-F5：CACCTCTTTCCA
AGCATCCAGGTA（SEQ ID No.1）, GCTCACTCCTCCAGCCTAGCAAG（SEQ
ID No.2）, FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1（SEQ ID No.3）Digital pcr detection by quantitative is carried out, with assay method sensitivity.
As shown in figure 4, working as blank（Aseptic double-distilled water）During without amplified signal, content after stock solution dilutes 2 times, 10 times, 100 times and 1000 times is respectively 3984copies/ μ L, 796 copies/ μ L, 81 copies/ μ L and 7.8 copies/ μ L, shows the quantitative sensitivity of the accurate quantitative detecting method of sheep derived material 7.8
Below copies/ μ L.
Embodiment
5
The present embodiment provides the test kit of accurate detection by quantitative sheep derived material.The test kit includes the specific oligonucleotide primer pair and probe and the operation instructions that differentiate sheep derived material for digital pcr method of the present invention.The test kit includes primer pair SEQ
ID No.1, SEQ ID No.2 and Carnis caprae seu ovis specific probe SEQ ID No.3, in Carnis caprae seu ovis replication
3 ' ends of protein A1 housekeeping gene probes are connected with fluorescent quenching group BHQ1, and 5 ' ends are connected with a fluorescent reporter group FAM, give PCR amplification conditions in the operation instructions, and the condition is 95 DEG C, 5min（1℃/s）；94 DEG C of 15 s, 60 DEG C of 1 min（1℃/s）, totally 50 circulations；98℃10 min（1℃/s）.For different instruments, response parameter makes the appropriate adjustments.
It is identical with the method described in embodiment 3, using commercially available mutton roll, mutton cubes roasted on a skewer, mutton meatballs and mutton soup genomic DNA as template, using aseptic double-distilled water as test kit negative controls, using fresh mutton as test kit positive reference substance, digital pcr detection by quantitative is carried out.
As shown in figure 5, in negative control without amplification, the content of positive control fresh mutton is 486
During copies/ μ L, in mutton roll and mutton cubes roasted on a skewer, Carnis caprae seu ovis content is respectively 4243copies/ μ L and 26 copies/ μ L, and does not detect sheep derived material in mutton meatballs and mutton soup.
Although being described to specific embodiments of the present invention, those skilled in the art will appreciate that can be variously changed to the present invention and modification on the premise of without departing from the scope of the present invention or spirit.Thus, this invention is intended to cover to fall all these changes and modification in appended claims and its range of equivalency.
Claims (5)
1. specific oligonucleotide primer pair and fluorescence labeling probe compositionss that digital pcr method detects sheep derived material are used for, and wherein described primer pair is Mutt-F5：CACCTCTTTCCA AGCATCCAGGTA, Mutt-R5：GCTCACTCCTCCAGCCTAGCAAG,
The probe is CTGGGTGAGCGTGGCACATGGAGGC.
2. compositionss according to claim 1, are wherein connected with fluorescent quenching group BHQ1 at 3 ' ends of probe, and 5 ' ends are connected with a fluorescent reporter group FAM.
3., by the test kit of digital pcr method detection by quantitative sheep derived material, the test kit includes primer combination of probe thing and operation instructions described in claim 1-2.
4. the digital pcr method of detection by quantitative sheep derived material, methods described include that usage right requires primer combination of probe thing and the test kit described in claim 3 described in 1-2.
5. the application of the primer combination of probe thing described in claim 1-2 and the test kit described in claim 3 sheep derived material in detection meat productss.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510577835.8A CN106520914A (en) | 2015-09-11 | 2015-09-11 | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510577835.8A CN106520914A (en) | 2015-09-11 | 2015-09-11 | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106520914A true CN106520914A (en) | 2017-03-22 |
Family
ID=58346753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510577835.8A Pending CN106520914A (en) | 2015-09-11 | 2015-09-11 | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106520914A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063229A (en) * | 2015-09-14 | 2015-11-18 | 苗丽 | Specific primers and probe by fluorogenic quantitative PCR (Polymerase Chain Reaction) for detecting sheep-derived ingredients in meat products and kit thereof |
| CN106591478A (en) * | 2017-01-23 | 2017-04-26 | 珠海出入境检验检疫局检验检疫技术中心 | Fluorescent PCR primers for detection of Saiga tatarica-derived ingredient and detection method using the same |
| CN106995852A (en) * | 2017-05-12 | 2017-08-01 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | The real-time fluorescence PCR detection method of sheep derived component in food and feed is detected using single-copy nuclear gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1490609A (en) * | 2002-10-15 | 2004-04-21 | 曹际娟 | Probe sequence and reagent box for real time fluorescent PCR oringinal determination of ox and sheep |
-
2015
- 2015-09-11 CN CN201510577835.8A patent/CN106520914A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1490609A (en) * | 2002-10-15 | 2004-04-21 | 曹际娟 | Probe sequence and reagent box for real time fluorescent PCR oringinal determination of ox and sheep |
Non-Patent Citations (2)
| Title |
|---|
| C. FLOREN等: "Species identification and quantification in meat and meat products using droplet digital PCR (ddPCR)", 《FOOD CHEMISTRY》 * |
| 王珊等: "微滴式数字PCR与实时荧光PCR检测羊肉制品中羊源和猪源性成分方法的比较", 《肉类工业》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063229A (en) * | 2015-09-14 | 2015-11-18 | 苗丽 | Specific primers and probe by fluorogenic quantitative PCR (Polymerase Chain Reaction) for detecting sheep-derived ingredients in meat products and kit thereof |
| CN105063229B (en) * | 2015-09-14 | 2019-01-04 | 苗丽 | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products |
| CN106591478A (en) * | 2017-01-23 | 2017-04-26 | 珠海出入境检验检疫局检验检疫技术中心 | Fluorescent PCR primers for detection of Saiga tatarica-derived ingredient and detection method using the same |
| CN106995852A (en) * | 2017-05-12 | 2017-08-01 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | The real-time fluorescence PCR detection method of sheep derived component in food and feed is detected using single-copy nuclear gene |
| CN106995852B (en) * | 2017-05-12 | 2020-08-11 | 上海出入境检验检疫局动植物与食品检验检疫技术中心 | Real-time fluorescence PCR detection method for detecting sheep-derived components in food and feed by using single-copy nuclear gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xu et al. | Multiplex TaqMan locked nucleic acid real-time PCR for the differential identification of various meat and meat products | |
| CN104673900B (en) | A method of differentiating animal derived materials in meat or meat products | |
| CN105274099B (en) | The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed | |
| CN106148559A (en) | The multiple PCR primer system of a kind of five kinds of animal derived materials of synchronous detecting and detection method | |
| CN107058498B (en) | Triple real-time fluorescence PCR method for detecting bovine, ovine and porcine derived components | |
| CN108977582B (en) | A kind of real-time fluorescence quantitative RT-PCR detection method of avian infectious bronchitis virus | |
| CN101724713A (en) | Method for detecting different subtype avian influenza viruses and special kit thereof | |
| CN106520914A (en) | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials | |
| CN109762939A (en) | For detecting the primer and probe and kit of mandarin fish rhabdovirus | |
| CN104630336A (en) | Gene chip for microbiological exploration and application method of gene chip | |
| CN116004777A (en) | High-flux detection primer group, chip, kit and detection method of microbial antibiotic resistance gene | |
| CN111057782A (en) | Method for detecting number of soil bacteria based on real-time fluorescent quantitative PCR | |
| CN112852988A (en) | Microdroplet digital PCR detection method for simultaneously detecting penicillium and fusarium | |
| CN110004218A (en) | A kind of nearly edge meat of a sheep detection method based on species specificity STR-SSR | |
| CN105132588A (en) | Method for detecting sweet potato leaf curl viruses and special primer set thereof | |
| CN105039598A (en) | Detection kit for ORF1a2 gene of Middle East respiratory syndrome coronavirus | |
| CN101962675A (en) | Primer group and kit for detecting origin of meat in food with multiple PCR (Polymerase Chain Reaction) | |
| CN104630333B (en) | Constant-temperature amplification detection primer, kit and the method for Queensland nut anaphylactogen | |
| CN106434976B (en) | Method for identifying true and false of Chinese yam and special primer | |
| CN102534038A (en) | High-sensitivity rapid detection kit for campylobacter jejuni | |
| CN110894550A (en) | RAA constant temperature fluorescence detection method and reagent for eel Herpes Virus (HVA) | |
| CN109136390A (en) | It is a kind of at the same identify chicken, duck, sheep Species origin PCR-STR method | |
| CN113684316A (en) | Novel coronavirus detection kit based on digital PCR and application | |
| CN108359746B (en) | Method and primer for detecting cell cross contamination caused by Hela cells | |
| CN107488706A (en) | The primed probe and method and kit precisely quantitatively detected for fox derived component digital pcr |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170322 |