CN111808983B - Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof - Google Patents
Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof Download PDFInfo
- Publication number
- CN111808983B CN111808983B CN202010762180.2A CN202010762180A CN111808983B CN 111808983 B CN111808983 B CN 111808983B CN 202010762180 A CN202010762180 A CN 202010762180A CN 111808983 B CN111808983 B CN 111808983B
- Authority
- CN
- China
- Prior art keywords
- rubber tree
- primer
- dna
- variety
- varieties
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a complete set of primer pairs for obtaining a rubber tree variety standard DNA fingerprint atlas database, the rubber tree variety standard DNA fingerprint atlas database constructed by adopting the complete set of primer pairs and a construction method. The method for identifying the rubber tree varieties by using the 34 pairs of complete primer pairs and the rubber tree standard DNA fingerprint spectrum library constructed by the primer pairs has the advantages of good repeatability, stability, reliability and rapid detection, and provides a basis for identifying the rubber tree varieties by using an SSR molecular marker technology. The rubber tree standard DNA fingerprint spectrum library can be directly applied to the authenticity identification of rubber tree varieties, solves the problem of the early identification of the rubber tree varieties for a long time, and ensures that the identification of the rubber tree varieties is not limited by space-time conditions any more.
Description
Technical Field
The invention relates to a fingerprint map library and a construction method thereof, in particular to a rubber tree variety standard DNA fingerprint map library and a construction method and special primers thereof.
Background
The natural amazonon river basin of the Brazilian rubber tree is an important economic crop in tropical regions, and the produced natural rubber is a strategic resource related to the national civilization. Since 1904 introduction of Hevea brasiliensis into China, 6165 parts of germplasm materials are counted by 5 varieties and 1 variety of rubber tree cultivars, wild germplasm and congeneric germplasm materials which are stored domestically so far. However, the rubber trees belong to perennial trees, and not only have the disadvantages of long sexual generation period, high heterozygosis of varieties, small difference of agronomic traits among a plurality of varieties with similar genetic relationship, even no obvious variation of single traits and the like, but also can blossom and bear fruits after 5-6 years after permanent planting in the current production, and if the genuineness of the varieties can be identified by using the traditional morphological markers, the time is too late.
The international union for the protection of new plant varieties has specificity, consistency and stability as essential characteristics for the registration and protection of new varieties. At present, the traditional morphological identification method has the defects of long identification period, easy influence of environmental factors and the like, is very difficult to identify some varieties with small property differences and close genetic relationship, and brings great inconvenience to the identification of germplasm resources and varieties of rubber trees. For a long time, the variety characteristic identification of rubber trees adopts morphological characters as main basis. The classical and conventional identification method can be performed from vegetative growth stage to specific reproductive development stage of the plant, so that the identification period is long; and the agronomic characters are susceptible to environmental conditions and cultivation management measures. Therefore, an accurate molecular marking method is needed to identify the germplasm resources and varieties of rubber trees.
With the development of molecular biology, various DNA molecular marker technologies are continuously emerging, the detection technology is gradually perfected, and a new way is provided for realizing early, rapid and accurate identification of rubber tree germplasm resources and varieties. The predecessors also have the research of identifying the germplasm resources and varieties of rubber trees by using the molecular marker technology (Anzegwei, Xieli and the like), but all of them focus on researching the genetic relationship and specific markers of the germplasm materials of the rubber trees; at present, no report for establishing a complete rubber tree variety fingerprint atlas database to identify varieties exists.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a rubber tree variety standard DNA fingerprint spectrum library, a construction method and a special primer thereof, thereby providing a basis for identifying main cultivars of rubber trees from a molecular level.
The first aspect of the invention provides a set of primer pairs for obtaining a rubber tree variety standard DNA fingerprint atlas database, which consists of 34 primer pairs:
| primer numbering | Upstream primer | Downstream primer | |
| 1 | TCTAAGGATGGTTTCCGACG | ATAGCCCCAACCCCATTC | |
| 2 | CCGCAGGAAATACTAAGGAGG | TTGGCAATCCACGAACGA | |
| 3 | TTCAGATCCACACGCTAAAAT | TCTGCCGTTGGCGGTTAT | |
| 4 | CCAGTAAAACCCAAATAGATAAACA | AAGCAAGGCGAAGAACATAA | |
| 5 | | CTCAACAATGAGGTTTAACTGCT | |
| 6 | CCGCCTCAAGAAGAACAAA | ACACCCAAATCCCCTCGA | |
| 7 | GATGCCCGATGGACCTCT | CTACAAAACCCGACCCAATA | |
| 8 | CCGATCAGATCCAAATCAAG | ATCCGAAGCCGCAGACAC | |
| 9 | CCCTTCCTTCTGTCCCTCTC | GGGTAGATTCTGGAGGTCGG | |
| 10 | GGACACCTGGAGCAAAATAG | TATGCTTCGATGTATATTCACAGT | |
| 11 | AAGGCAACGACGAAGAAAGA | CGTTAAAAAGGGGATGAAAGC | |
| 12 | CGACTGCTGCTGTGACAAAT | CAGGAACACAACGTCTTCTTTT | |
| 13 | CGGAGATTGTTTGGGAGAGA | ATTGGGTGGGGATACGTTTT | |
| 14 | GGCCAATGGATTCTCTCTCA | CAAAACCCAAAAAGGAACGA | |
| 15 | TTGATGGCCAATTATCAGCA | CTTTCTTCGTCGTTGCCTTC | |
| 16 | GGGGATTGCTGTTGTGAGA | AGTGTAAGGTAGAGGTCGGTGA | |
| 17 | CACGTTTAATATCACGGGAA | CCTTTGACATAAGTTGGAGA | |
| 18 | GCTTTGGTCTTGGGAGAGAG | TGCACCAATCAATAATCACCA | |
| 19 | TTGATGGCCAATTATCAGCA | GTTGCCTTCATCTTCTGCAA | |
| 20 | TTTCATTTCCAGTAAAACCCAAA | CTCCCTCCATCTTGAACCAA | |
| 21 | GGGACGCTACCTACTATTAC | CCCTTGAGTGCTCTTCG | |
| 22 | AACAGATTCCTCATCACGG | ATAGTTTTCACCATCACCC | |
| 23 | AAACCCAAATCAGCAAGC | AAACCAGCAGGCAAGAGC | |
| 24 | AAGGCATCAACCACCAAATC | AAGGCGTCATCGCTCCA | |
| 25 | TAGGGTTATCTTTGGCTCTC | CTACTGCTACTCCGATGGTG | |
| 26 | CTGGGTTTGATTTTGATGGC | CCTCTTTCTTCGTCGTTGC | |
| 27 | CTGGGTTTGATTTTGATGGC | TCCGATTCAGTTCCTCCGTA | |
| 28 | TCCCTTTTCTCCGCTCCT | TCTCAATCCCGATACCTTCC | |
| 29 | ATGTGCCCTTCTTGTGAGC | TATCTTTGTAGGTGGTACTGGTG | |
| 30 | CCCACGGATTTTGCTGTT | CTTTACCCTATCAATGTCACCTC | |
| 31 | ACGGTCTGTGAGTACCATCTGC | CATCATCAACCTACACCCCATT | |
| 32 | TCATTTCAAGTTCACCGTGCTTATT | AGCGCATGTATTTGCCTTATGTCTC | |
| 33 | TGTGTCCTCTACTTGTCTTCATTTG | GCCTCTACTTTTCTTTCTCCTTTAT | |
| 34 | CATCTCCACCACCTACA | AGGAGAGCAATAACCAAC |
In a second aspect, the invention provides a product for obtaining a rubber tree variety standard DNA fingerprint atlas database, wherein the product comprises the primer set of the first aspect of the invention.
The product can be a reagent or a kit, and can also be a system consisting of the reagent or the kit and an instrument, such as a system consisting of the primer set, the primer set A for acquiring the DNA fingerprint of the rubber tree or the primer set B for acquiring the DNA fingerprint of the rubber tree and at least one of the following reagents and/or instruments: other reagents required for performing PCR amplification, reagents required for performing gel electrophoresis, a PCR instrument, an electrophoresis instrument, a gel imaging system, and a camera.
The third aspect of the invention provides the use of the primer set according to the first aspect of the invention or the product according to the second aspect of the invention for obtaining a standard DNA fingerprint atlas database of rubber tree varieties.
The fourth aspect of the invention provides a method for constructing a rubber tree variety standard DNA fingerprint atlas database, which is characterized by comprising the following steps: (1) extracting total DNA of leaves of each rubber tree variety; (2) carrying out PCR amplification on DNA of each rubber tree variety by using the primer set pair of the first aspect of the invention to obtain a DNA characteristic fingerprint of each rubber tree variety; (3) identifying and processing the DNA characteristic fingerprints of the rubber tree varieties by using an automatic fingerprint identification system, and then converting the DNA characteristic fingerprints of the rubber tree varieties into a rubber tree variety standard DNA fingerprint library; wherein the rubber tree varieties are the rubber tree varieties described in the following table:
| numbering | Name of breed | Numbering | Name of breed | Numbering | Name of |
| 1 | PR107 | 12 | Dafeng 95 | 23 | Heat grinding 7-20-59 |
| 2 | |
13 | Reclamation of land from |
24 | Wenchang 11 |
| 3 | PB86 | 14 | RRIM600 | 25 | Heat grinding 88-13 |
| 4 | Reclamation of land from |
15 | 93-114 | 26 | Bench scale 327-13 |
| 5 | Tjir1 | 16 | Cloud research 77-2 | 27 | Wenchang 217 |
| 6 | Nanhua 1 | 17 | Cloud research 77-4 | 28 | Heat grinding 8-79 |
| 7 | |
18 | Heat grinding 217 | 29 | Heat grinding 8-333 |
| 8 | Tianren 31-45 | 19 | PB235 | 30 | Hot reclamation of 525 |
| 9 | Closing 3-11 | 20 | RRIM712 | 31 | Hot reclamation of 523 |
| 10 | RRIM623 | 21 | Cloud 277-5 | 32 | Hot reclamation 628 |
| 11 | IAN873 | 22 | Heat grinding 7-33-97 | 33 | Heat grinding 87-4-26 |
Preferably, step (1) is specifically: extracting the total DNA of the leaves of each rubber tree variety by referring to a CTAB method, and detecting the total DNA quality of each variety by agarose gel electrophoresis and a spectrophotometer to ensure that the integrity of the extracted total DNA of each rubber tree variety is good and the ratio of A260/A280 is between 1.6 and 2.0.
Wherein the primer set is obtained by screening according to the following method:
SSR primer sources: selecting primer pair sequences distributed on different linkage groups, synthesizing the primer pair sequences, and performing PAGE purification;
screening sequences of SSR characteristic primers: taking each rubber tree variety as a material, and carrying out PCR amplification on DNA of each rubber tree variety by utilizing a synthesized SSR primer;
firstly, according to the synthesized SSR primers, performing primary screening on the specificity and polymorphism of PCR amplification bands and the easily distinguishable degree of band types in each rubber tree variety, and screening out a batch of SSR primers which have rich polymorphism and clear band types among different rubber tree varieties and can stably repeat characteristic bands; then finding out a pair of SSR primers with highest polymorphic information content PIC and the largest number of allelic loci among the rubber tree varieties as core primers constructed by a fingerprint spectrum library of the rubber tree varieties, and dividing the rubber tree varieties into 4 groups, namely 34 allelic loci according to characteristic fingerprints of the core primers; further, with the distinguishing result of the core primer as a reference, detecting in the 4 classes, further screening one primer with polymorphism every time, and so on, so that 39 rubber tree varieties are divided into more classes until the classes are divided into only one variety; and finally, screening the synthesized SSR primer pair sequences of the rubber trees to obtain SSR characteristic primer pair sequences from a plurality of linkage groups, namely the complete set of primer pairs.
Preferably, the construction method comprises:
A. total DNA extraction of various rubber tree varieties
Extracting the total DNA of each rubber tree leaf, detecting the quality of the total DNA by using agarose gel electrophoresis and a total spectrophotometer to ensure that the integrity of the extracted total DNA is good, the ratio of A260/A280 is between 1.6 and 2.0, then diluting the total DNA into 100 ng/microliter, and storing the diluted total DNA at the temperature of minus 20 ℃ for later use;
B. screening of SSR characteristic primer pair sequences
SSR primer sources: selecting primer pair sequences distributed on different linkage groups, synthesizing the primer pair sequences, wherein the primer pair sequences are synthesized by Shanghai worker (Sangon) and require PAGE purification;
screening sequences of SSR characteristic primers: taking each rubber tree variety as a material, carrying out PCR amplification on DNA of each rubber tree variety by utilizing a synthesized SSR primer, and separating PCR amplification products by utilizing capillary electrophoresis;
firstly, according to the synthesized SSR primers, firstly, performing primary screening on the specificity, polymorphism and band type distinguishing easiness degree of a PCR (polymerase chain reaction) amplification band in each rubber tree variety by adopting non-denatured polyacrylamide gel electrophoresis, and screening out a batch of SSR primers which have rich polymorphism, clear band type and stably repeatable characteristic bands among different rubber tree varieties; then, finding out a pair of SSR primers with the polymorphism information content (PIC value) larger than 0.4 and the maximum number of allelic loci among all rubber tree varieties as core primers constructed by a rubber tree variety fingerprint spectrum library by utilizing capillary electrophoresis, and dividing all rubber tree varieties into 4 groups (34 allelic loci) according to the characteristic fingerprints of the core primers; further, with the distinguishing result of the core primer as a reference, detecting in the 4 classes, further screening one primer with polymorphism every time, and so on, so that 33 rubber tree varieties are divided into more classes until the classes are divided into only one variety; finally, screening the sequences of the SSR characteristic primer pairs from a plurality of linkage groups from the synthesized SSR primer pairs of the rubber trees, namely the primer pairs of the whole set in the first aspect of the invention;
C. obtaining characteristic fingerprint spectrum of rubber tree
B, performing PCR amplification on each rubber tree variety by utilizing the SSR characteristic primer pair sequence obtained by screening in the step B, performing preliminary verification by adopting non-denatured polyacrylamide gel electrophoresis, and analyzing by adopting capillary electrophoresis to obtain a DNA characteristic fingerprint spectrum of each rubber tree variety; in order to facilitate the analysis and comparison of DNA fingerprints of various varieties on different gels, the same DNA Marker and PCR products are arranged on each gel as references during electrophoresis;
D. construction of rubber tree standard DNA fingerprint atlas database
And C, selecting an electrophoresis peak which accords with the size and the repetitive unit characteristics of the primer design target product according to the DNA characteristic fingerprint of the rubber tree variety obtained in the step C, collecting effective characteristic data of the capillary electrophoresis pattern, standardizing the effective characteristic data of the pattern, and finally constructing the rubber fingerprint by using the position of the electrophoresis peak corresponding to the size of the PCR amplification product and the corresponding electrophoresis peak characteristic data.
The fifth aspect of the invention adopts the rubber tree variety standard DNA fingerprint atlas database constructed by the construction method of the fourth aspect of the invention.
The invention provides a method for identifying rubber tree varieties, which comprises the steps of carrying out PCR amplification on total DNA of a sample to be detected by adopting a complete set of primer pairs in the first aspect of the invention, and comparing an obtained fingerprint with a characteristic fingerprint in a rubber tree variety standard DNA fingerprint atlas library in the fifth aspect of the invention.
In a seventh aspect, the invention provides the use of a primer set according to the first aspect of the invention, or a product according to the second aspect of the invention, or a library of rubber tree varieties standard DNA fingerprints according to the fifth aspect of the invention for identifying rubber tree varieties.
The invention has the following beneficial effects:
1. the complete set of primer pairs and the constructed rubber tree standard DNA fingerprint spectrum library are used for identifying rubber tree varieties, have the advantages of good repeatability, stability, reliability and rapid detection, and provide a basis for identifying the rubber tree varieties by utilizing the SSR molecular marker technology. The rubber tree standard DNA fingerprint spectrum library can be directly applied to the authenticity identification of rubber tree varieties, solves the problem of the early identification of the rubber tree varieties for a long time, and ensures that the identification of the rubber tree varieties is not limited by space-time conditions any more.
2. The invention utilizes the principle that each pair of SSR primers can generate a specific fingerprint after amplifying the DNA of a specific variety, and the same pair of SSR primers can amplify different DNA characteristic fingerprints (which are mutually called allelic sites) among different varieties, and a plurality of pairs of SSR primers can amplify each variety to possibly obtain a group of specific DNA fingerprints, so that the method adopts a primer combination identification method to analyze and screen the primers again, and each variety can find the specific DNA fingerprint. The invention finally obtains a standard DNA fingerprint pattern atlas database containing 33 rubber tree varieties, wherein each rubber tree variety has unique DNA characteristic fingerprint.
The DNA fingerprint atlas library constructed according to the invention, capillary electrophoresis detection and DNA fingerprint atlas analysis show that PR107, black skin PR107, IAN873, Shufeng and hot reclamation 628, 08-3 and 11-1 are homonymous varieties.
Drawings
FIG. 1 is SSR amplification map of rubber tree seed material, specific SSR primers H-190, M is DNA Marker I, and 1-33 are different rubber tree seed materials.
FIG. 2 is a molecular marker capillary electrophoresis pattern of rubber tree and the characteristic value of an electrophoresis peak, wherein the abscissa in the pattern is the size of an amplification product and the ordinate is the height of the electrophoresis peak; the top of the electrophoresis peak shows the value, the upper is the electrophoresis peak height value, and the lower is the electrophoresis peak area.
FIG. 3 is a diagram of SSR molecular marker cluster analysis of different rubber tree species; through SSR molecular marker clustering analysis, part of rubber tree foreign matter homonymous varieties can be accurately distinguished.
Detailed Description
The invention will be better understood from the following description of specific embodiments with reference to the accompanying drawings. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1
The invention relates to a method for constructing a rubber tree variety standard DNA fingerprint spectrum library, which comprises the following steps:
(1) screening of SSR characteristic primer pair sequences
SSR primer sources: the primer pair sequences are distributed on different linkage groups and synthesized by Shanghai Biolabs (Sangon) and require PAGE purification;
screening sequences of SSR characteristic primers: taking rubber tree varieties shown in table 1 as materials, carrying out PCR amplification on DNA of each rubber tree variety by using a synthesized SSR primer, firstly using non-denatured polyacrylamide gel electrophoresis as a primary screen for PCR amplification products, preliminarily screening out core primers with good polymorphism through silver staining and color development, then carrying out capillary electrophoresis separation, and determining the core primers for constructing a fingerprint spectrum according to the screening result of the capillary electrophoresis.
Screening primers, firstly, carrying out primary screening according to the specificity and polymorphism of PCR amplification bands of the synthesized SSR primers in each rubber tree variety and the easily distinguishable degree of band types, and screening out a batch of SSR primers which have rich polymorphism and clear band types among different rubber tree varieties and can stably repeat characteristic bands; and then, utilizing capillary electrophoresis analysis to find out a pair of SSR primers with the polymorphism information content (PIC value) larger than 0.4 and the maximum number of allelic loci among all rubber tree varieties as core primers constructed by a fingerprint spectrum library of the rubber tree varieties as shown in Table 2. Dividing each rubber tree variety into 4 groups, namely 34 allelic loci according to the characteristic fingerprint of the core primer; further, with the discrimination result of the core primer as a reference, detecting in the 4 classes, further screening one primer with polymorphism every time, and so on, so that 33 rubber tree varieties (table 1) are divided into more classes until the classes are divided into only one variety; and finally, screening the sequences of the SSR characteristic primer pairs from a plurality of linkage groups from the synthesized SSR primer pairs of the rubber trees (Table 3).
TABLE 1 rubber Tree species
| Numbering | Name of breed | For short | Numbering | Name of breed | For short | ||
| 1 | | PR107 | 18 | Heat grinding 217 | RY217 | ||
| 2 | | GT1 | 19 | | PB235 | ||
| 3 | | PB86 | 20 | | RRIM712 | ||
| 4 | Reclamation of land from |
|
21 | Cloud 277-5 | YY277-5 | ||
| 5 | Tjir1 | Tjir1 | 22 | Heat grinding 7-33-97 | RY7-33-97 | ||
| 6 | |
|
23 | Heat grinding 7-20-59 | RY7-20-59 | ||
| 7 | |
|
24 | |
|
||
| 8 | Tianren 31-45 | TR31-45 | 25 | Heat grinding 88-13 | RY88-13 | ||
| 9 | Closing 3-11 | HK3-11 | 26 | Bench scale 327-13 | ZS327-13 | ||
| 10 | | RRIM623 | 27 | Wenchang 217 | |
||
| | IAN873 | IAN873 | 28 | Heat grinding 8-79 | RY8-79 | ||
| 12 | Dafeng 95 | |
29 | Heat grinding 8-333 | RY8-333 | ||
| 13 | Reclamation of land from |
|
30 | Hot reclamation of 525 | |
||
| 14 | | RRIM600 | 31 | Hot reclamation of 523 | |
||
| 15 | 93-114 | 93-114 | 32 | Hot reclamation 628 | |
||
| 16 | Cloud research 77-2 | YY77-2 | 33 | Heat grinding 87-4-26 | RY87-4-26 | ||
| 17 | Cloud research 77-4 | YY77-4 |
TABLE 2 SSR sites, fluorescence markers, and statistics of polymorphic information content during capillary electrophoresis of rubber tree varieties
In Table 2, 1) Locus: SSR locus names; dye: fluorescent labeling used for SSR loci; n: detecting the number of samples; na: an allelic factor; ne: an effective allelic factor; i: a shannon index; ho: observing the heterozygosity; he: a desired heterozygosity; f: fixing the index; PIC: a polymorphic information content index;
2) PIC values greater than 0.4 indicate better site polymorphism.
TABLE 3 SSR characteristic primer pair sequences
(2) Extracting the total DNA of leaves of each rubber tree variety
Putting the rubber tree leaves into a mortar filled with liquid nitrogen, fully grinding the rubber tree leaves into powder, transferring about 0.1g of the leaf powder into a 2ml centrifuge tube, adding 500 mul of CTAB buffer solution preheated in advance, putting the mixture into a water bath kettle, incubating the mixture for 30min at 65 ℃, taking the centrifuge tube out of the middle, fully shaking the centrifuge tube upside down, taking the centrifuge tube out, adding 500 mul of the centrifuge tube, uniformly mixing the mixture according to a ratio of 24:1 to obtain a chloroform-isoprene solution, centrifuging the mixture for 10min at 12000rpm at room temperature, discarding the precipitate, transferring the supernatant into a new centrifuge tube, adding 2/3 volumes of isopropanol, uniformly mixing the mixture, and standing the mixture for 1 hour at-20 ℃; and finally centrifuging for 5min at 4 ℃ and 10000rpm, removing the supernatant, reserving the precipitate, adding 500 mu l of 75% ethanol to wash the precipitate for 2 times, airing the obtained DNA precipitate at room temperature, adding 100 mu l of ddH20 to dissolve the DNA, and storing the DNA in a refrigerator at-20 ℃ for later use.
(3) Fluorescent PCR amplification
PCR amplification is carried out by taking each rubber tree variety leaf DNA as a template, the SSR primers used in the embodiment are sequences shown in SEQ ID NO. 1-SEQ ID NO. 68 (Table 2), and the fluorescent labels are different labels in FAM, HEX and TAMRA 3.
The fluorescent PCR reaction adopts a 15 mu L system, and comprises the following components in proportion: 2 × Taq Master Mix 7.5 μ L; mix primer2.0 μ L; DNA template 1. mu.L (50-200 ng); ddH 20 4.5μL。
The PCR reaction program is: pre-denaturing at 94 ℃ for 2min, denaturing at 94 ℃ for 30s, annealing at 52-57 ℃ for 45s, extending at 72 ℃ for 1min, circulating for 30 times, extending at 72 ℃ for 5min after the last cycle is finished, and storing at 4 ℃ for 20min to obtain a rubber tree leaf DNA amplification product.
(4) Electrophoretic analysis of PCR products
And (2) carrying out PCR amplification on a PCR product by using the SSR characteristic primer pair sequence obtained by screening in the step (1) through non-denatured polyacrylamide gel electrophoresis, carrying out silver staining and color development, and carrying out photographic recording, further verifying the effect of the SSR characteristic primer pair sequence obtained in the step (1), wherein the result shows that the SSR characteristic primer pair sequence obtained by screening has good polymorphism (figure 1). And then obtaining capillary electrophoresis patterns of various rubber varieties by using a capillary electrophoresis apparatus.
In order to facilitate the analysis and comparison of DNA fingerprints of various varieties on different gels, identical DNAmarker and PCR products are arranged on each gel as a reference during the non-denaturing polyacrylamide gel electrophoresis.
The capillary electrophoresis apparatus is a 3730xl analyzer manufactured by Applied biosystems, the sample loading processing is according to the specification requirements of the apparatus, the capillary electrophoresis sample injection voltage is-15 kv, the sample injection time is 40s, the separation voltage is-15 kv, and the temperature is controlled at 25 ℃.
(5) Establishment of rubber capillary electrophoresis fingerprint spectrum
Selecting an electrophoresis peak which accords with the size and the repetitive unit characteristics of the primer design target product according to the capillary electrophoresis pattern obtained in the step (4), and collecting effective characteristic data of the capillary electrophoresis pattern, wherein the effective characteristic data comprises the position of the electrophoresis peak, the height of the electrophoresis peak and the area of the electrophoresis peak corresponding to the size of the amplification product; then, standardizing effective characteristic data of the capillary electrophoresis pattern, standardizing the characteristic data of an electrophoresis peak with the highest electrophoresis peak height or the largest electrophoresis peak area to be 1, and standardizing the rest electrophoresis peaks through the ratio of the electrophoresis peak height to the highest electrophoresis peak or the ratio of the electrophoresis peak area to the largest electrophoresis peak; and finally, constructing a rubber fingerprint spectrum by using the positions of the electrophoresis peaks corresponding to the sizes of the PCR amplification products and the corresponding electrophoresis peak characteristic data, as shown in tables 4-8.
The method for identifying the rubber variety to be detected can be realized by utilizing the constructed rubber standard fingerprint atlas database, and the identification method comprises the steps of utilizing the SSR characteristic primer pair sequence to carry out PCR amplification on the total DNA of a sample to be detected, carrying out capillary electrophoresis analysis to obtain the fingerprint atlas of the sample to be detected, and then automatically comparing the obtained fingerprint atlas with the characteristic fingerprint in the atlas database, thereby realizing the rapid detection on the purity and authenticity of the nursery stock of the rubber variety.
TABLE 4 Standard DNA finger print of part of rubber tree variety 1
TABLE 5 Standard DNA finger print of part rubber tree variety II
TABLE 6 Standard DNA finger print of part of rubber tree variety III
TABLE 7 Standard DNA finger print of part rubber tree variety (IV)
TABLE 8 Standard DNA finger prints of rubber tree species
Example 2
The rubber capillary electrophoresis fingerprint spectrum of the invention is used for identifying different rubber tree variety samples
Randomly extracting 4 rubber tree variety samples in a national rubber tree germplasm resource garden, namely black skin PR107 (numbered 34, abbreviated as HPPR107), Shuifeng (numbered 35, abbreviated as SF), 08-3 (numbered 36, abbreviated as 08-3) and 11-1 (numbered 37, abbreviated as 11-1) for identification. The specific operation is as follows:
firstly, extracting DNA of a variety to be detected, and performing PCR amplification by using the DNA as a DNA template, wherein the used primer is consistent with the primer for establishing a rubber tree variety resource capillary electrophoresis fingerprint database; and respectively carrying out capillary electrophoresis analysis on the amplification products of the species to be detected. Standardizing the characteristic data of the capillary electrophoresis peak, comparing the sample to be tested with the data in the database by using a cluster analysis method, and identifying the sample to be tested according to the correlation coefficient. The alignment results are shown in tables 9-10.
TABLE 9 identification results of different rubber tree species samples
TABLE 10 identification results of different rubber tree species samples
Although the morphologies of the varieties to be detected are slightly different from the rubber tree varieties in the standard DNA fingerprints of the rubber tree varieties, the black skin PR107 and the PR107 are the same variety, the Shuifeng and the IAN873 are also the same variety, and the 08-3, 11-1 and the hot reclamation 628 are the same variety through comparison with the standard DNA fingerprints of the rubber tree varieties. Due to the difference of the environment types of the planting rubber areas in different places, the species of the rubber trees to be detected have slightly different morphologies.
The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.
Claims (8)
1. A complete set of primer pairs for obtaining a rubber tree variety standard DNA fingerprint library is characterized by comprising 34 primer pairs:
。
2. A product for obtaining a library of rubber tree species standard DNA fingerprints comprising the primer set of claim 1.
3. Use of the primer set of claim 1 or the product of claim 2 for obtaining a library of rubber tree species standard DNA fingerprints.
4. A method for constructing a rubber tree variety standard DNA fingerprint spectrum library is characterized by comprising the following steps:
(1) extracting total DNA of leaves of each rubber tree variety; detecting the quality of the total DNA by using agarose gel electrophoresis and a total spectrophotometer to ensure that the integrity of the extracted total DNA is good, the ratio of A260/A280 is between 1.6 and 2.0, then diluting the total DNA into 100 ng/mu l, and storing the diluted total DNA at-20 ℃ for later use;
(2) performing PCR amplification on the DNA of each rubber tree variety by using the primer set pair of claim 1 to obtain a DNA characteristic fingerprint of each rubber tree variety;
the primer set is obtained by screening according to the following method:
SSR primer sources: selecting primer pair sequences distributed on different linkage groups, synthesizing the primer pair sequences, wherein the primer pair sequences are synthesized by Shanghai worker (Sangon) and require PAGE purification;
screening sequences of SSR characteristic primers: taking each rubber tree variety as a material, and carrying out PCR amplification on DNA of each rubber tree variety by utilizing a synthesized SSR primer; firstly, using non-denatured polyacrylamide gel electrophoresis as a primary screen for PCR amplification products, preliminarily screening out core primers with good polymorphism through silver staining and color development, then carrying out capillary electrophoresis separation, and determining the core primers for constructing a fingerprint spectrum according to the screening result of the capillary electrophoresis;
firstly, according to the synthesized SSR primer, firstly, adopting non-denatured polyacrylamide gel electrophoresis to carry out primary screening on the specificity and polymorphism of PCR amplification band and the easily distinguishable degree of band type in each rubber tree variety, and screening out a batch of SSR primers which have rich polymorphism, clear band type and stably repeatable characteristic band among different rubber tree varieties after silver staining and color development; then, finding out a pair of SSR primers with the polymorphism information content (PIC value) larger than 0.4 and the maximum number of allelic loci among all rubber tree varieties as core primers constructed by a rubber tree variety fingerprint spectrum library by utilizing capillary electrophoresis, and dividing all rubber tree varieties into 4 groups (34 allelic loci) according to the characteristic fingerprints of the core primers; further, with the distinguishing result of the core primer as a reference, detecting in the 4 classes, further screening one primer with polymorphism every time, and so on, so that 33 rubber tree varieties are divided into more classes until the classes are divided into only one variety; finally, screening SSR characteristic primer pair sequences from a plurality of linkage groups from the synthesized SSR primer pair sequences of the rubber trees, namely the complete set of primer pairs according to claim 1; (3) identifying and processing the DNA characteristic fingerprints of the rubber tree varieties by using an automatic fingerprint identification system, and then converting the DNA characteristic fingerprints of the rubber tree varieties into a rubber tree variety standard DNA fingerprint library; the specific operation is as follows:
performing PCR amplification on each rubber tree variety by using the SSR characteristic primer pair sequence obtained by screening in the step (2), performing preliminary verification by using non-denatured polyacrylamide gel electrophoresis, and performing capillary electrophoresis analysis to obtain a DNA characteristic fingerprint of each rubber tree variety; in order to facilitate the analysis and comparison of DNA fingerprints of various varieties on different gels, the same DNA Marker and PCR products are arranged on each gel as a reference during the non-denatured polyacrylamide gel electrophoresis; selecting an electrophoresis peak which accords with the size and the repetitive unit characteristics of a primer design target product from the obtained capillary electrophoresis pattern, collecting effective characteristic data of the capillary electrophoresis pattern, standardizing the effective characteristic data of the capillary electrophoresis pattern, and finally constructing a rubber fingerprint pattern by using the position of the electrophoresis peak corresponding to the size of the PCR amplification product and the corresponding electrophoresis peak characteristic data;
wherein the rubber tree varieties are the rubber tree varieties described in the following table:
。
5. The construction method according to claim 4, wherein the step (1) is specifically:
extracting the total DNA of the leaves of each rubber tree variety by referring to a CTAB method, and detecting the total DNA quality of each variety by agarose gel electrophoresis and a spectrophotometer to ensure that the integrity of the extracted total DNA of each rubber tree variety is good and the ratio of A260/A280 is between 1.6 and 2.0.
6. The rubber tree variety standard DNA fingerprint atlas database constructed by the construction method of any one of claims 4-5.
7. A method for identifying rubber tree species, which is characterized in that the primer set of claim 1 is adopted to carry out PCR amplification on the total DNA of a sample to be detected, and then the obtained fingerprint is compared with the characteristic fingerprint in the rubber tree species standard DNA fingerprint atlas database of claim 6.
8. Use of a primer set according to claim 1, or a product according to claim 2, or a library of rubber tree species standard DNA fingerprints according to claim 6 for identifying rubber tree species.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010762180.2A CN111808983B (en) | 2020-07-31 | 2020-07-31 | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010762180.2A CN111808983B (en) | 2020-07-31 | 2020-07-31 | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111808983A CN111808983A (en) | 2020-10-23 |
| CN111808983B true CN111808983B (en) | 2021-07-02 |
Family
ID=72863482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010762180.2A Active CN111808983B (en) | 2020-07-31 | 2020-07-31 | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111808983B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113934875B (en) * | 2021-10-27 | 2022-11-25 | 云舟生物科技(广州)股份有限公司 | Electrophoresis data identification method and system, computer storage medium and electronic equipment |
| CN117487950A (en) * | 2022-05-31 | 2024-02-02 | 中国热带农业科学院橡胶研究所 | Construction method of rubber tree variety DNA fingerprint library |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101603090A (en) * | 2009-02-27 | 2009-12-16 | 中国热带农业科学院橡胶研究所 | A kind of method for identifying rubber tree varieties of quickly, efficiently and accurately |
| CN102011196A (en) * | 2010-10-21 | 2011-04-13 | 中国农业科学院柑桔研究所 | Citrus breed standard DNA fingerprint spectrum library and constructing method thereof |
| CN106957918A (en) * | 2017-05-03 | 2017-07-18 | 江西省林业科学院 | Method and the application of cape jasmine kind are identified using EST SSR primers |
-
2020
- 2020-07-31 CN CN202010762180.2A patent/CN111808983B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101603090A (en) * | 2009-02-27 | 2009-12-16 | 中国热带农业科学院橡胶研究所 | A kind of method for identifying rubber tree varieties of quickly, efficiently and accurately |
| CN102011196A (en) * | 2010-10-21 | 2011-04-13 | 中国农业科学院柑桔研究所 | Citrus breed standard DNA fingerprint spectrum library and constructing method thereof |
| CN106957918A (en) * | 2017-05-03 | 2017-07-18 | 江西省林业科学院 | Method and the application of cape jasmine kind are identified using EST SSR primers |
Non-Patent Citations (4)
| Title |
|---|
| Draft genome sequence of the rubber tree Hevea brasiliensis;Rahman等;《BMC Genomics》;20131231;第14卷(第75期);第1~15页 * |
| Evaluasi 18 primer SSR untuk pengembangan sidikjari DNA tanaman karet (Hevea brasiliensis Muell. Arg.);Asmini BUDIANI等;《Menara Perkebunan》;20140925;第82卷(第2期);第81~94页 * |
| 巴西橡胶树主栽品种指纹图谱构建;王明等;《热带农业科学》;20151015;第35卷(第10期);摘要、第20-22页，表2-表3 * |
| 橡胶树EST-SSRs发掘研究;华玉伟等;《热带作物学报》;20081015;第29卷(第5期);第583~588页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111808983A (en) | 2020-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755328B (en) | Method for constructing SSR (simple sequence repeat) fingerprint of broad beans | |
| CN111808983B (en) | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof | |
| CN113832243B (en) | Core SNP marker for tea tree variety identification based on KASP technology development | |
| CN106987648B (en) | High-flux SSR molecular marking method related to plant organ development | |
| CN109868328B (en) | SSR molecular marker for identifying paeonia rockii varieties and application | |
| CN109337997B (en) | Camellia polymorphism chloroplast genome microsatellite molecular marker primer and method for screening and discriminating kindred species | |
| CN108486275B (en) | Method for identifying begonia varieties by SSR (simple sequence repeat) fingerprint spectrum and application of method | |
| CN104293778A (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN105063028B (en) | SSR primer sets and the method using primer sets structure malt finger-print | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN110527743B (en) | Polymorphic molecular marker for identifying Xinjiang color cotton variety and application | |
| CN116716426A (en) | SSR molecular marker primer combination based on aquilaria sinensis genome, kit and application | |
| CN109652587A (en) | A method of Chinese ilex germplasm is identified using the SSR molecular marker of transcript profile sequencing | |
| CN115927731A (en) | SNP (Single nucleotide polymorphism) site combination for constructing litchi SNP fingerprint, application and identification method | |
| CN107151696B (en) | Method for identifying germplasm resource of smilax china | |
| CN115011720A (en) | SNP molecular marker combination for constructing DNA fingerprint spectrum of rubber tree variety, application and method | |
| CN114525355A (en) | Method for identifying authenticity of Vicia species and special SSR primer combination thereof | |
| CN105631245A (en) | Dedicated primer used for identifying superior clones of Populus deltoides Marsh. and identification method for superior clone of Populus deltoides Marsh. | |
| CN113481313B (en) | Multiple fluorescence SSR (simple sequence repeat) labeled primers and method for identifying three Chinese torreya varieties | |
| CN116426684B (en) | InDel molecular marker closely linked with eggplant peel color traits and application | |
| CN113604601B (en) | InDel marker primer group and application thereof in identifying purity of broccoli 'DX-108' variety or seed | |
| CN113621732B (en) | InDel marker primer group and application thereof in identifying purity of broccoli 'CB-30' variety or seed | |
| CN111850159B (en) | SSR molecular marker identification primer and application thereof | |
| CN109593872B (en) | Method for identifying new variety Qingbi of white wax by using capillary electrophoresis fluorescence SSR fingerprint | |
| KR102151225B1 (en) | Molecular marker based on nuclear genome sequence for discriminating Platycodon grandiflorum landraces and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |