CN110438251A - Utilize the method for peanut ingredient in dual digital pcr quantitative detection hazel Rong - Google Patents
Utilize the method for peanut ingredient in dual digital pcr quantitative detection hazel Rong Download PDFInfo
- Publication number
- CN110438251A CN110438251A CN201910375185.7A CN201910375185A CN110438251A CN 110438251 A CN110438251 A CN 110438251A CN 201910375185 A CN201910375185 A CN 201910375185A CN 110438251 A CN110438251 A CN 110438251A
- Authority
- CN
- China
- Prior art keywords
- peanut
- fibert
- specific gene
- hazel
- species
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The present invention provides a kind of methods using peanut ingredient in dual digital pcr quantitative detection hazel Rong, it uses Dual channel detection method, two kinds of fluorescence signals are detected simultaneously using digital pcr system, the probe of peanut species-specific gene sequence and fibert species-specific gene Sequence Detection is respectively labeled as VIC and FAM, pass through the copy Particle density of the peanut species-specific gene sequence and the fibert species-specific gene sequence that measure in same PCR reaction system, the DNA copy number percentage that peanut accounts for fibert and peanut is calculated, conversion obtains the mass percent that peanut ingredient accounts for fibert and peanut ingredient.This method can accurately and rapidly be the mass percentage content for detecting peanut ingredient in hazel Rong, provide accurately and reliably technical data for the identification of hazel paste stuffing authenticity.
Description
Technical field
The invention belongs to molecular Biological Detection fields, and in particular to a kind of to utilize dual digital pcr quantitative detection hazel Rong
The method of middle peanut ingredient.
Background technique
Hazel Rong is that it is deep by people to be added to the sweets such as cake, the chocolate of hazel Rong using fibert as fillings made of primary raw material
Like there is the considerable market demand.Kernel contains in regulation nuts and kernels fillings in " GB/T 21270-2007 Food stuff "
Amount should be not less than 20% (w/w).Since fibert belongs to the higher kernel of price, the production cost of hazel Rong is higher, contains hazel Rong's
Food price is more expensive, and illegal manufacturer often reduces cost, improper profit using nerkel raw material personation fibert cheap and easy to get.
Wherein, most commonly with the adulterated behavior of peanut personation fibert.This behavior seriously damages the interests of consumer, and it is fair to hinder
Trade.
Currently, the standard detecting method of fibert ingredient includes " SN/T 1961.8-2013 export food anaphylactogen in food
The 8th part of composition detection: real time fluorescent PCR method detects filbert ingredient " and " the common mistake of SN/T 4419.4-2016 export food
Quick the 4th part of original LAMP series detection method: filbert ", the detection method of peanut ingredient includes " SN/T 1961.2-2007 food
Middle anaphylactogen is at anti-detection method part 2: real-time fluorescence PCR method detects peanut ingredient " and " SN/T 4419.12-2016 goes out
The 12nd part of mouth food Typical allergic original LAMP series detection method: peanut ".These methods use real-time fluorescence PCR and isothermal
The problem of whether amplification technique carries out qualitative detection to fibert and peanut, only can solve in hazel Rong containing peanut ingredient, to hazel Rong
" unintentional pollution " and " having for the purpose of adulterated as caused by common container, equipment and production line etc. in process of manufacture
Meaning addition " not can be carried out effective district point, and there are apparent technical limitations, are not able to satisfy the demand that hazel Rong cracks down on counterfeit goods.
To ensure food safety, safeguards fair fair trade, establish the dual digital pcr quantitative detection of peanut ingredient in hazel Rong
Method can carry out the peanut ingredient mixed in hazel Rong precisely quantitatively, identifying the true and false of hazel Rong and providing accurately and reliably technology
Foundation.
Summary of the invention
It is an object of the invention to for above to solve the disadvantage that with it is insufficient, provide a kind of quasi- using dual digital pcr
Really, effectively in quantitative detection hazel Rong peanut ingredient method.
The purpose of the invention is achieved by the following technical solution:
A method of using peanut ingredient in dual digital pcr quantitative detection hazel Rong, Dual channel detection method being used, benefit
Two kinds of fluorescence signals are detected simultaneously with digital pcr system, by peanut species-specific gene sequence and fibert species specificity base
Because the probe of Sequence Detection is respectively labeled as VIC and FAM, pass through the peanut species measured in same PCR reaction system
The copy Particle density of specific gene sequences and the fibert species-specific gene sequence, is calculated peanut and accounts for fibert and flower
Raw DNA copy number percentage, conversion obtain the mass percent that peanut ingredient accounts for fibert and peanut ingredient.
Preferably, the method for the present invention includes the following steps:
Step 1. extracts hazel Rong sample DNA；
Step 2. design and synthesize the fibert species-specific gene sequence primer and probe sequence and the flower
The primer and probe sequence of biological species specific gene sequences；
Step 3. carries out dual digital pcr reaction；
Step 4. is read using the fluorescence detection of FAM and VIC binary channels and analysis of fluorescence signal；
Step 5. calculates the DNA copy number percentage that the peanut accounts for fibert and peanut according to fluorescence signal testing result,
Conversion obtains the mass percent that peanut ingredient accounts for fibert and peanut ingredient；
Wherein, the peanut accounts for the DNA copy number percentage of fibert and peanutWherein a is that peanut is special
Specific gene copies Particle density, and b is that fibert specific gene copies Particle density.
Wherein, the peanut ingredient accounts for the mass percent of fibert and peanut ingredient, by establishing it to copy number percentage
The relational expression of ratio is acquired using copy number percentage.
Preferably, the step 1 includes that the hazel Rong sample is extracted sample DNA using RNA isolation kit.
Preferably, in the step 2, the primer and probe sequence of the fibert species-specific gene sequence is as follows:
Fibert specific gene-F:CCGTTTTGTCGTGGATCTACAG (SEQ ID NO.1)；
Fibert specific gene-R:CCTTCATCTCCCGAGCCTTAC (SEQ ID NO.2)；
Fibert specific gene-P:FAM-CCTGGAGCGGATCAACTTGACCAC-BHQ1 (SEQ ID NO.3).
Preferably, in the step 2, the primer and probe sequence of the peanut species-specific gene sequence is as follows:
Peanut specific gene-F:GCAACAGGAGCAACAGTTCAAGAGG (SEQ ID NO.4)；
Peanut specific gene-R:CGCTGTGGTGCCCTAAGGCCG (SEQ ID NO.5)；
Peanut specific gene-P:VIC-CTCAGGAACTTGCCTCAACAGTGCGGCC-BHQ1 (SEQ ID NO.6).
Preferably, the dual digital pcr reaction include the reaction of droplet digital pcr (droplet digital PCR,
DdPCR it) is reacted with chip digital PCR (chip digital PCR, cdPCR).
It is highly preferred that the ddPCR reaction condition are as follows: 95 DEG C, 5 minutes, 1 DEG C/sec；94 DEG C, 15s, 1 DEG C/sec, 60 DEG C, 1
Minute, 1 DEG C/sec, totally 49 recycle；12 DEG C of preservation reaction products.
It is highly preferred that the ddPCR reaction system is 20 μ L, each component is as follows: 2 × ddPCRTM10 μ L of premixed liquid；Concentration
For each 0.8 μ L of primer of 10pmol/ μ L, concentration is each 0.4 μ L of probe of 10pmol/ μ L, 2 μ L of DNA profiling, moisturizing to 20 μ L.
It is highly preferred that the cdPCR reaction condition are as follows: 96 DEG C, 10 minutes；60 DEG C, 2 minutes, 98 DEG C, 30 seconds, 49 were followed
Ring；60 DEG C, 2 minutes；10 DEG C of preservation reaction products.
It is highly preferred that the cdPCR reaction system is 15 μ L, each component is as follows:7.5 μ of premixed liquid
L；Each 0.6 μ L of primer that concentration is 10pmol/ μ L, concentration is 10pmol/ μ L probe each 0.3 μ L, 1.5 μ L of DNA profiling, moisturizing
To 15 μ L.
Digital pcr is a kind of nucleic acid detection technique based on monomolecular amplification, right using Poisson distribution principle as theoretical basis
Specific gene segment carries out the measurement of copy number concentration quantitative in sample, can be to avoid complicated food ingredient composition, processing technology
With result error caused by the factors such as food state.The previous hair using Species composition content in digital pcr technology measurement food
It is bright, in terms of being concentrated mainly on animal derived materials.The digital pcr that this method has carried out plant derived component in food for the first time is quantitative
Measurement invention, establishes peanut and accounts for peanut in fibert and peanut DNA copy number percentage and hazel Rong and account for fibert and peanut into sub-prime
The relational expression for measuring percentage calculates peanut and accounts for hazel using two species DNA copy number concentration in digital pcr technology measurement hazel Rong
Son and peanut DNA copy number percentage, convert to obtain the mass percentage content of peanut ingredient in hazel Rong according to relational expression.
Fibert includes flat hazel (Corylus heterophylla Fisch.) peace Europe hybrid hazel (Corylus
Heterophylla Fisch. × Corylus avellana L.), flat Corylus is in Betulaceae Coryluss, flat Europe hybrid hazel
The interspecific hybridization cultivar cultivated is hybridized by flat hazel and wood-nut, is commonly called as big fruit fibert or Hybrid hazel producing large nuts.According to this hair
The fibert specific primer probe of bright design can carry out specific detection to both fibert ingredients.Peanut (Arachis
Hypogaea Linn.) fruits and seeds that belong to pulse family Arachis plant, the peanut specificity designed according to the present invention draws
Physical prospecting needle can carry out specific detection to peanut ingredient.
This method accounts for fibert to peanut and peanut DNA copy number concentration quantitative determines, and copies Particle density absolute quantitation
Be limited to 6 copies/microlitre, peanut accounts for fibert and peanut DNA copy number percentage is quantitatively limited to 1%；In hazel Rong peanut account for fibert and
The mass percent of peanut ingredient is quantitatively limited to 5%.This method can accurately and rapidly detect the quality of peanut ingredient in hazel Rong
Degree provides accurately and reliably technical data for the identification of hazel paste stuffing authenticity.
Detailed description of the invention
Fig. 1 is copy number percentage quantitative limit confirmatory experiment data analysis chart (ddPCR).
Fig. 2 is copy number percentage quantitative limit confirmatory experiment result 2D figure (cdPCR).
Fig. 3 is mass percent-copy number percentage relation formula (ddPCR).
Fig. 4 is mass percent-copy number percentage relation formula (cdPCR).
Fig. 5 is mass percent quantitative limit confirmatory experiment result 1D figure (ddPCR).
Fig. 6 is mass percent quantitative limit confirmatory experiment result 2D figure (cdPCR).
Specific embodiment
The present invention is described in further detail with attached drawing combined with specific embodiments below, but embodiments of the present invention
It is without being limited thereto.
The present invention is as follows using the method for peanut ingredient in dual digital pcr quantitative detection hazel Rong:
1, the extraction of the preparation of sample and genomic DNA template: sample (fibert, peanut, hazel paste stuffing etc.) 10g is taken, is made
Crush with beveller and homogeneous, condition are 1800 revs/min, 3 minutes.
Sample 30mg is weighed in 1.5mL centrifuge tube, sample DNA is extracted using RNA isolation kit, kit can be selected:
Kurabo QuickGene DNA extraction kit DT-S, Wizard Genomic DNA purification kit
The DNA extraction methods such as (Promega, A1120), PSS nucleic acid automatic extracting instrument.These known DNA of those skilled in the art are extracted
Method, to extract the DNA of respective sample respectively.
2, design and synthesize the fibert species-specific gene sequence primer and probe sequence and the peanut object
The primer and probe sequence of species-specific genes sequence, the nucleotide sequence of the primer and probe are as follows:
3, dual digital pcr reaction is carried out
(1) instrument
QX200TMDroplet Digital PCR system: including thermal cycler (C1000TouchTM thermal
Cycler), droplet generates instrument (droplet generator), droplet analyzer (droplet reader) and sealer instrument (PCR
Plate sealer) 4 parts, it is purchased from U.S. Bio-rad company.
QuantStudioTM3D Digital PCR system: including PCR system (Dual Flat BlockPCR System 9700), chip loading instrument (Digital Chip Loader) and chip analyzer
3 parts (Digital PCR Instrument) are purchased from U.S. Applied Biosystems by Life
Technologies company.
E4-200XLS+ single channel electrical pipette rifle is purchased from U.S. Rui Ning company.
(2) reagent
DdPCR:ddPCRTMPremixed liquid (Super Mix for Probes, no dUTP), droplet generate oil (Droplet
Generation Oil), droplet analyzes oily (Droplet Reader Oil), droplet generates card slot (Droplet Generator
DG8Cartridge), droplet generates card slot rubber mat (Droplet Generator DG8Gasket) and 96 orifice plates, is purchased from the U.S.
Bio-Rad company.
CdPCR:Premixed liquid (3D Digital PCR Master Mix v2), chip agent box (3D
Digital PCR20K Chip Kit v2 includes chip, chip lid, brush head, oil sealing syringe), it is purchased from U.S. Applied
Biosystems by Life Technologies company.
QuickGene gene extracts kit (Cat.#DT-S)
Primer and probe is synthesized by Shanghai Shan Jing molecular biosciences Science and Technology Ltd..
(3) for sample sheet
For every kind of method in addition to for this difference of sample, operating procedure, reagent dosage and reaction condition etc. are all the same.Specifically
For sample sheet and obtained experimental data to be described in detail in following example.
(4) preparation and dispersion of reaction system
DdPCR reaction system is 20 μ L, and each component is as follows: 2 × ddPCRTM10 μ L of premixed liquid (MasterMix)；Concentration is
Each 0.8 μ L of the primer of 10pmol/ μ L, concentration are each 0.4 μ L of probe of 10pmol/ μ L, 2 μ L of DNA profiling, moisturizing to 20 μ L.Point
The reaction system of 20 μ L and 70 μ L droplets are generated oil to be added in droplet generation card slot, are put into droplet generation instrument after covering rubber mat
Middle progress droplet generation is all turned the droplet (about 40 μ L) of generation with single channel electrical pipette rifle after generating to droplet
It moves in 96 orifice plates, carries out sealer with sealer instrument and be placed on progress PCR reaction in thermal cycler.
CdPCR reaction system is 15 μ L, and each component is as follows:7.5 μ L of premixed liquid (MasterMix)；
Each 0.6 μ L of primer, each 0.3 μ L of probe that concentration is 10pmol/ μ L that concentration is 10pmol/ μ L, 1.5 μ L of DNA profiling, moisturizing is extremely
15μL.Prepared 15 μ L reaction system is automatically loaded into the micropore on chip by chip loading instrument, system has loaded
Oil sealing is covered in chip surface using oil sealing syringe immediately after and seals chip.Chip after sealing is placed in PCR
It is expanded in system.
(5) response procedures
DdPCR reaction condition: 95 DEG C, 5 minutes (1 DEG C/s)；94 DEG C 15 seconds (1 DEG C/sec), 60 DEG C 1 minute (1 DEG C/sec), altogether
49 circulations；12 DEG C of preservation reaction products.
CdPCR reaction condition: 96 DEG C 10 minutes；60 DEG C 2 minutes, 98 DEG C 30 seconds, 49 circulation；60 DEG C 2 minutes；10 DEG C of guarantors
Deposit reaction product.
4, fluorescence signal reads and analyzes
Fluorescence, which is read, in this standard uses the fluorescence detection of FAM and VIC binary channels.
After phosphor collection, fluorescence threshold is determined according to reaction hotspot graph, carries out differentiation of the negative point with positobe focus.
DdPCR reading data: 96 orifice plates are placed in droplet analyzer after amplification and read fluorescence signal, are used in combination
QuantaSoft V1.3.2 software analyzes experimental data.
CdPCR reading data: after amplification, restore to chip to room temperature, chip is placed in chip analyzer and is read
And preliminary analysis chip results, then via QuantStudioTMBis- times points of Software of 3D AnalysisSuiteTM Cloud
Analyse experimental data.
5, the calculating of copy number percentage
The peanut, which is calculated, according to fluorescence signal testing result accounts for fibert and peanut DNA copy number percentage.
Peanut accounts for fibert and peanut DNA copy number percentage
A --- peanut specific gene copy Particle density (copy/microlitre)
B --- fibert specific gene copy Particle density (copy/microlitre).
6, mass percent-copy number percentage relation formula foundation
Preparation mixes the peanut of different quality percentage using fibert as matrix, and obtain no less than 5 mass percents is
Column peanut/fibert mixing sample.For example, preparing peanut ingredient percent is 1%, 5%, 10%, 20%, 40%, 50%
With 100% peanut/fibert powder aggregate sample product.Each sample weighs 3 parallel, each parallel 30mg, carries out DNA respectively and mentions
It takes, after each title sample is 10 times of DNA dilution parallel, carries out 1 parallel ddPCR and cdPCR respectively.It is built using Data Analysis Software
Vertical mass percent-copy number percentage relation formula.
7, the conversion of mass percent
The sample to be tested copy number percentage being calculated in step 5 is substituted into mass percent-copy described in step 6
Number percentage relational expression, conversion obtain peanut ingredient in sample to be tested and account for fibert and peanut ingredient percent content.
8, quality controls
(1) the quality control of sample detection
A. the relative standard deviation between sample is parallel calculates
The reaction of sample digital pcr should be arranged 3 in parallel, guarantee testing result copy Particle density greater than absolute quantitation limit
In the case of, and positive reaction quantity, lower than under the premise of overall reaction quantity 80%, 3 parallel samples copy the opposite of Particle density
Standard deviation (RSD) need to meet RSD≤25%, peanut/fibert of the average value measured by 3 parallel samples as the sample
Subsequent analysis is carried out with peanut gene content.
B. the effectively control of micro- stoichiometric number
The total quantity of the effective micro- reaction generated in digital pcr system cutting procedure must not be lower than the 60% of platform theoretical value
(i.e. 12000)；The quantity of positive systems must not exceed the 80% of total system quantity.
C. the quality control of blank control
Digital pcr blank control theory testing result should be zero.But in actually detected, allow there are minute quantity positive systems
It counts existing.Positive micro- reactant coefficient should be less than the 0.03% of actually active system number in blank control.
There are a those who do not meet in the above Quality Control condition, experimental result should be abandoned, and re-start digital pcr experiment.
(2) confirmation of performance indicator
A. copy Particle density absolute quantitation limit
Using RSD≤25% as the judgment basis of effective quantitative data, copy Particle density absolute quantitation is limited to testing result
Minimum copy Particle density when RSD≤25%.Fibert and peanut DNA to serial dilutions carry out digital pcr quantitative detection,
Each concentration is arranged 3 in parallel, calculates the RSD value of each concentration Parallel testing result.Copy of this method to peanut and fibert DNA
Particle density absolute quantitation be limited to 6 copies/microlitre.
B. copy number percentage quantitative limit and the rate of recovery
Using RSD≤25% and the rate of recovery 80%~120% as the judgment basis of effective quantitative data, copy number percentage
Quantitatively it is limited to minimum copy number percentage when testing result RSD≤25% and the rate of recovery 80%~120%.Series is mixed than copying
The fibert and peanut DNA of shellfish number percentage carry out digital pcr quantitative detection, and 3 parallel, calculating are arranged in each copy number percentage
The RSD value and the rate of recovery of each copy number percentage Parallel testing result.This method accounts for the copy number of fibert and peanut DNA to peanut
Percentage is quantitatively limited to 1%.
C. mass percent quantitative limit and the rate of recovery
Using RSD≤25% and the rate of recovery 80%~120% as the judgment basis of effective quantitative data, mass percent is fixed
Amount is limited to minimum quality percentage when testing result RSD≤25% and the rate of recovery 80%~120%.Specific mass hundred is mixed to series
Dividing the hazel Rong of ratio to carry out, DNA is extracted and digital pcr quantitative detection, each mass percent are arranged 3 in parallel, calculate each quality hundred
Divide the RSD value and the rate of recovery than Parallel testing result.The mass percent that this method accounts for fibert and peanut ingredient to peanut is quantitative
It is limited to 5%.
Embodiment 1: the verifying of copy number absolute quantitation limit
For sample sheet: for the copy number absolute quantitation limit for verifying this method, extracting fibert and peanut genome simultaneously respectively
Be serially diluted, obtain 500,100,20,10,5,1 copy/microlitre serial dilutions fibert and peanut DNA.Respectively
3 parallel ddPCR and cdPCR experiment is carried out, experimental results are shown in Table 1.
The verifying (ddPCR and cdPCR) of 1 peanut of table and fibert DNA copy number absolute quantitation limit
Result as shown in Table 1 as it can be seen that on ddPCR platform, when peanut DNA copy number concentration be 1.23 copies/microlitre
When, three it is parallel between RSD value be all larger than 25%, when peanut DNA copy number concentration be more than or equal to 5.23 copies/microlitre when,
Three it is parallel between RSD value less than 25%, the absolute quantitation of peanut DNA copy number concentration be limited to 5.23 copies/microlitre；Work as hazel
Sub- DNA copy number concentration be 1.19 copies/microlitre when, three it is parallel between RSD value be greater than 25%, when fibert DNA copy number
Concentration be more than or equal to 5.07 copies/microlitre when, three it is parallel between RSD value less than 25%, fibert DNA copy number concentration it is exhausted
To be quantitatively limited to 5.07 copies/microlitre.On cdPCR platform, when peanut DNA copy number concentration be 1.35 copy/microlitre when, three
It is a it is parallel between RSD value be all larger than 25%, when peanut DNA copy number concentration be more than or equal to 5.76 copies/microlitre when, three are flat
RSD value between row less than 25%, the absolute quantitation of peanut DNA copy number concentration be limited to 5.76 copies/microlitre；As fibert DNA
Copy Particle density be 1.35 copies/microlitre when, three it is parallel between RSD value be greater than 25%, when fibert DNA copy number concentration is big
In be equal to 5.55 copies/microlitre when, three it is parallel between RSD value less than 25%, the absolute quantitation of fibert DNA copy number concentration
Be limited to 5.55 copies/microlitre.For the application of this method, this method limits peanut and fibert DNA copy number concentration absolute quantitation
Round numbers be 6 copy/microlitre.
Embodiment 2: the verifying of copy number percentage quantitative limit
For sample sheet: for the copy number percentage quantitative limit for verifying this method, being with the fibert DNA of known copy Particle density
Matrix mixes the peanut DNA of known copy Particle density, obtains series to mix than copy number percentage being respectively 0.1%, 1%, 10%
With 50% fibert and peanut DNA mixing sample.3 parallel ddPCR and cdPCR experiment, experimental results are carried out respectively
See Fig. 1 and Fig. 2.
By Fig. 1 and result shown in Fig. 2 as it can be seen that being respectively 0.1%, 1%, 10% and 50% for copy number percentage
Fibert and peanut DNA mixing sample, the testing result on ddPCR platform are respectively 0.099%, 1.027%, 10.700% and
51.733%, three it is parallel between RSD value between 0.29%~10.40%, the rate of recovery 98.67%~107.00% it
Between；Testing result on cdPCR platform is respectively 0.102%, 1.049%, 10.034% and 53.832%, three it is parallel it
Between RSD value between 0.859%~4.497%, the rate of recovery is between 100.34%~107.66%.For copy number percentage
Than the sample for 0.1%, the copy Particle density that measures lower than 6 copy of absolute quantitation limit/microlitre, testing result is not effectively quantitative
Data.Therefore, the copy number percentage of this method is quantitatively limited to 1%.
Embodiment 3: mass percent-copy number percentage relation formula foundation
For sample sheet: to establish mass percent-copy number percentage relation formula, using fibert as matrix, mixing not homogeneity
The peanut for measuring percentage obtains peanut and fibert that mass percent is 1%, 5%, 10%, 20%, 40%, 50% and 100%
Powder mixing sample.Each sample weighs 3 parallel, each parallel 30mg, carries out DNA extraction respectively, the parallel DNA of each title sample
After 10 times of dilution, 1 parallel ddPCR and cdPCR are carried out respectively.Mass percent-copy is established using Data Analysis Software
Number percentage relational expression, gained relational expression are shown in Fig. 3 and Fig. 4.The sample for being 1% for mass percent, copy number percentage
The rate of recovery is unsatisfactory for the judgment basis of effective quantitative data, and testing result is not effective quantitative data.Therefore, the foundation of relational expression
Use mass percent for 5%, 10%, 40% and 50% testing result.
In mass percent-copy number percentage relation formula that ddPCR platform is established as shown in figure 3, relational expression are as follows: 100y
=(100x-1.615)/1.074, wherein x is copy number percentage, and y is mass percent.R2It is 0.9925.
In mass percent-copy number percentage relation formula that cdPCR platform is established as shown in figure 4, relational expression are as follows: 100y
=(100x+0.3522)/1.095, wherein x is copy number percentage, and y is mass percent.R2It is 0.9998.
Embodiment 4: the verifying of mass percent quantitative limit
For sample sheet: mixing the flower of different quality using fibert as matrix for the mass percent quantitative limit for verifying this method
Hazel Rong is given birth to and be made, serial Quality of Peanuts is obtained and mixes hazel Rong's sample than being respectively 1%, 5%, 10%, 40% and 50%.Each
Sample weighs 3 parallel, each parallel 30mg, carries out DNA extraction respectively, after each titles sample is 10 times of DNA dilution parallel, respectively into
Row 1 parallel ddPCR and cdPCR, experimental results are shown in Fig. 5 and Fig. 6.
It is as shown in Figure 5 that mass percent quantitative limit confirmatory experiment result 1D schemes (ddPCR), wherein A06, B06, C06 are flower
Hazel Rong's sample of raw mass percent 5%, A05, B05, C05 are hazel Rong's sample of Quality of Peanuts percentage 10%, D04, E04,
F04 is hazel Rong's sample of Quality of Peanuts percentage 40%, and A04, B04, C04 are hazel Rong's sample of Quality of Peanuts percentage 50%.
It is as shown in Figure 6 that mass percent quantitative limit confirmatory experiment result 2D schemes (cdPCR).
Copy number percentage is calculated according to experimental result, substitutes into mass percent-copy number percentage relation of embodiment 3
Mass percent is conversed in formula.By Fig. 5 and result shown in fig. 6 as it can be seen that be respectively 5% for Quality of Peanuts percentage,
10%, 40% and 50% hazel Rong's sample, the testing result on ddPCR platform are respectively 4.53%, 10.92%, 40.06%
With 49.78%, three it is parallel between RSD value between 0.73%~16.68%, the rate of recovery is 91.56%~110.49%
Between；Testing result on cdPCR platform is respectively 5.06%, 10.02%, 39.56% and 50.30%, three it is parallel it
Between RSD value between 1.05%~13.79%, the rate of recovery is between 98.66%~101.10%.It is for mass percent
1% hazel Rong's sample, the rate of recovery of mass percent are unsatisfactory for the judgment basis of effective quantitative data, and testing result is not effective
Quantitative data.Therefore, the mass percent of this method is quantitatively limited to 5%.
Sequence table
<110>Inspection and Quarantine Technic Center, Guangdong Entry-Exit Inspection and Qu
<120>method of peanut ingredient in dual digital pcr quantitative detection hazel Rong is utilized
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ccgttttgtc gtggatctac ag 22
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ccttcatctc ccgagcctta c 21
<210> 3
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cctggagcgg atcaacttga ccac 24
<210> 4
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gcaacaggag caacagttca agagg 25
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cgctgtggtg ccctaaggcc g 21
<210> 6
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ctcaggaact tgcctcaaca gtgcggcc 28
Claims (10)
1. a kind of method using peanut ingredient in dual digital pcr quantitative detection hazel Rong, it is characterised in that: examined using binary channels
Survey method detects two kinds of fluorescence signals using digital pcr system simultaneously, and peanut species-specific gene sequence and fibert species is special
The probe of specific gene Sequence Detection is respectively labeled as VIC and FAM, passes through the flower measured in same PCR reaction system
The copy Particle density of biological species specific gene sequences and the fibert species-specific gene sequence, is calculated peanut and accounts for hazel
The DNA copy number percentage of son and peanut, conversion obtain the mass percent that peanut ingredient accounts for fibert and peanut ingredient.
2. according to the method described in claim 1, characterized by the following steps:
Step 1. extracts hazel Rong sample DNA；
Step 2. design and synthesize the fibert species-specific gene sequence primer and probe sequence and the peanut object
The primer and probe sequence of species-specific genes sequence；
Step 3. carries out dual digital pcr reaction；
Step 4. is read using the fluorescence detection of FAM and VIC binary channels and analysis of fluorescence signal；
Step 5. calculates the DNA copy number percentage that the peanut accounts for fibert and peanut according to fluorescence signal testing result, conversion
Obtain the mass percent that peanut ingredient accounts for fibert and peanut ingredient；
Wherein, the peanut accounts for the DNA copy number percentage of fibert and peanutWherein a is peanut specificity
Gene copy Particle density, b are that fibert specific gene copies Particle density.
Wherein, the peanut ingredient accounts for the mass percent of fibert and peanut ingredient, by establishing it to copy number percentage
Relational expression is acquired using copy number percentage.
3. the method according to claim 1, wherein the step 1 includes by the hazel Rong sample using reagent
Box method extracts sample DNA.
4. the method according to claim 1, wherein in the step 2, the fibert species-specific gene sequence
The primer and probe sequence of column is as follows:
Fibert specific gene-F:CCGTTTTGTCGTGGATCTACAG；
Fibert specific gene-R:CCTTCATCTCCCGAGCCTTAC；
Fibert specific gene-P:FAM-CCTGGAGCGGATCAACTTGACCAC-BHQ1.
5. the method according to claim 1, wherein in the step 2, the peanut species-specific gene sequence
The primer and probe sequence of column is as follows:
Peanut specific gene-F:GCAACAGGAGCAACAGTTCAAGAGG；
Peanut specific gene-R:CGCTGTGGTGCCCTAAGGCCG；
Peanut specific gene-P:VIC-CTCAGGAACTTGCCTCAACAGTGCGGCC-BHQ1.
6. the method according to claim 1, wherein the dual digital pcr reaction includes that droplet digital pcr is anti-
It should be reacted with chip digital PCR.
7. according to the method described in claim 6, it is characterized in that, the ddPCR reaction condition are as follows: 95 DEG C, 5 minutes, 1 DEG C/
Second；94 DEG C, 15 seconds, 1 DEG C/sec, 60 DEG C, 1 minute, 1 DEG C/sec, totally 49 recycled；12 DEG C of preservation reaction products.
8. according to the method described in claim 6, each component is as follows: 2 it is characterized in that, the ddPCR reaction system is 20 μ L
×ddPCRTM10 μ L of premixed liquid；Concentration is each 0.8 μ L of primer of 10pmol/ μ L, and concentration is each 0.4 μ L of probe of 10pmol/ μ L,
2 μ L of DNA profiling, moisturizing to 20 μ L.
9. according to the method described in claim 6, it is characterized in that, the cdPCR reaction condition are as follows: 96 DEG C, 10 minutes；60
DEG C, 2 minutes, 98 DEG C, 30 seconds, 49 circulations；60 DEG C, 2 minutes；10 DEG C of preservation reaction products.
10. according to the method described in claim 6, each component is as follows it is characterized in that, the cdPCR reaction system is 15 μ L:7.5 μ L of premixed liquid；Each 0.6 μ L of primer that concentration is 10pmol/ μ L, the probe that concentration is 10pmol/ μ L
Each 0.3 μ L, 1.5 μ L of DNA profiling, moisturizing to 15 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375185.7A CN110438251B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910375185.7A CN110438251B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438251A true CN110438251A (en) | 2019-11-12 |
| CN110438251B CN110438251B (en) | 2022-09-23 |
Family
ID=68429473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910375185.7A Active CN110438251B (en) | 2019-05-07 | 2019-05-07 | Method for quantitatively detecting peanut components in hazelnut paste by using dual digital PCR (polymerase chain reaction) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438251B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080064028A1 (en) * | 2003-05-16 | 2008-03-13 | Takashi Hirao | Quantitative Pcr Method of Detecting Specific Plant Genus in Food or Food Ingredient |
| US20080261215A1 (en) * | 2005-02-09 | 2008-10-23 | Biomay Ag | Method for Evaluating the Allergen Sensitivity of an Individual |
| EP2226395A1 (en) * | 2009-02-27 | 2010-09-08 | Università degli Studi di Parma | Method and Kit for the detection of allergens |
| CN103540673A (en) * | 2013-10-30 | 2014-01-29 | 昆明理工大学 | Dual PCR (Polymerase Chain Reaction) detection method for soybean and peanut components in walnut milk beverage |
| CN106191252A (en) * | 2016-07-14 | 2016-12-07 | 安徽出入境检验检疫局检验检疫技术中心 | The primer sets identifying tms5 trans-genetic hybrid rice seed and the method detecting seed purity with it |
| CN108060241A (en) * | 2018-02-13 | 2018-05-22 | 广东出入境检验检疫局检验检疫技术中心 | A kind of dual digital pcr method that pigeon derived component quantitatively detects |
| CN110846410A (en) * | 2019-12-20 | 2020-02-28 | 西北民族大学 | Method for detecting walnut allergens in food by real-time fluorescent quantitative PCR |
-
2019
- 2019-05-07 CN CN201910375185.7A patent/CN110438251B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080064028A1 (en) * | 2003-05-16 | 2008-03-13 | Takashi Hirao | Quantitative Pcr Method of Detecting Specific Plant Genus in Food or Food Ingredient |
| US20080261215A1 (en) * | 2005-02-09 | 2008-10-23 | Biomay Ag | Method for Evaluating the Allergen Sensitivity of an Individual |
| EP2226395A1 (en) * | 2009-02-27 | 2010-09-08 | Università degli Studi di Parma | Method and Kit for the detection of allergens |
| CN103540673A (en) * | 2013-10-30 | 2014-01-29 | 昆明理工大学 | Dual PCR (Polymerase Chain Reaction) detection method for soybean and peanut components in walnut milk beverage |
| CN106191252A (en) * | 2016-07-14 | 2016-12-07 | 安徽出入境检验检疫局检验检疫技术中心 | The primer sets identifying tms5 trans-genetic hybrid rice seed and the method detecting seed purity with it |
| CN108060241A (en) * | 2018-02-13 | 2018-05-22 | 广东出入境检验检疫局检验检疫技术中心 | A kind of dual digital pcr method that pigeon derived component quantitatively detects |
| CN110846410A (en) * | 2019-12-20 | 2020-02-28 | 西北民族大学 | Method for detecting walnut allergens in food by real-time fluorescent quantitative PCR |
Non-Patent Citations (4)
| Title |
|---|
| ELISA INIESTO等: "real time PCR to detect hazelnut allergen coding sequences in processed foods", 《FOOD CHEMISTRY》 * |
| HOLZHAUSER T等: "polymerase chain reaction（PCR）for detection of potentially allergenic hazelnut residues in complex food matrixes", 《EUROPEAN FOOD RESEARCH AND TECHNOLOGY》 * |
| 中华人民共和国国家质量监督检验检疫总局: "食品中过敏原成分检测方法 第2部分：实时荧光PCR法检测花生成分", 《中国人民共和国出入境检验检疫行业标准》 * |
| 程芳: "十种常见食品过敏原基因复合PCR检测方法的建立和不同玉米品种代谢组学差异分析", 《中国优秀硕士学位论文全文数据库工程科技I辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438251B (en) | 2022-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104263848B (en) | A kind of deaf susceptibility gene mutation detection kit and preparation method thereof and application | |
| CN105274246B (en) | The detection kit of several species kind derived components in calf-derived Cyclospora identification and its product | |
| CN101736087A (en) | Method for digitally detecting micro-mutation by using micro-emulsion clone amplified bound water gel microsphere chip | |
| CN104293778B (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN108060241A (en) | A kind of dual digital pcr method that pigeon derived component quantitatively detects | |
| CN114134236A (en) | Application of reagent for detecting SNP molecular marker in goat RBP4 genotyping and/or goat molecular marker assisted breeding | |
| Namsolleck et al. | Molecular methods for the analysis of gut microbiota | |
| CN105385766B (en) | A kind of Streptococcus suis Serotypes liquid phase chip reagent box | |
| CN106434959A (en) | Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit | |
| CN106555000A (en) | A kind of method of plant derived component in plant identification protein beverage | |
| CN108342461A (en) | DdPCR technologies detect primer, kit and the detection method of IDH1 genetic mutations | |
| CN108085397A (en) | Primer and probe and its kit and method based on fluorescence quantitative PCR detection Mandarin fish | |
| CN111718984A (en) | Method for STR typing of forensic mixed DNA sample | |
| CN110438251A (en) | Utilize the method for peanut ingredient in dual digital pcr quantitative detection hazel Rong | |
| CN108642156A (en) | A kind of the digital pcr detection kit and its detection method of T790M gene mutations | |
| CN109680098A (en) | A kind of kit and its application based on droplet digital pcr quantitative detection potato ingredient | |
| CN109943627A (en) | Utilize the method for peanut ingredient in dual digital pcr quantitative detection sesame paste and sesame Rong | |
| CN110317858A (en) | Utilize the method for kidney beans in dual digital pcr quantitative detection lotus-seed paste | |
| CN110396554A (en) | Utilize the method for dual digital pcr quantitative detection Li Rongzhong mung bean ingredient | |
| CN110408682B (en) | Method for quantitatively detecting red bean and red bean components in food by using dual digital PCR | |
| CN109097488A (en) | For synchronizing nucleic acid, method and the kit of five kinds of dog diarrhea virus of detection and identification | |
| CN106520914A (en) | Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials | |
| CN108546755A (en) | Calibration object for the detection of fragile X mental retardation Disease-causing gene and its application | |
| CN106544447A (en) | A kind of Multiple immunizations fluorescence analysiss primer, test kit and method for detecting chicken Marek's disease virus and chicken infectious anemia virus | |
| CN110004243A (en) | A kind of kit and its application based on droplet digital pcr quantitative detection sweet potato ingredient |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 510623 block B, Guangdong check tower, 66 Huacheng Road, Zhujiang New Town, Guangzhou, Guangdong. Applicant after: Guangzhou Customs Technology Center Address before: 510623 block B, Guangdong check tower, 66 Huacheng Road, Zhujiang New Town, Guangzhou, Guangdong. Applicant before: Inspection & Quarantine Technology Center of Guangdong Entry-Exit Inspection & Quarantine Bureau |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |