CN106434959A - Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit - Google Patents
Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit Download PDFInfo
- Publication number
- CN106434959A CN106434959A CN201610976206.7A CN201610976206A CN106434959A CN 106434959 A CN106434959 A CN 106434959A CN 201610976206 A CN201610976206 A CN 201610976206A CN 106434959 A CN106434959 A CN 106434959A
- Authority
- CN
- China
- Prior art keywords
- chicken
- gene
- lamp
- food
- actb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention provides a quick detection kit for a chicken-origin ingredient in food and feed and relates to the technical field of biological species identification. A general chicken-origin internal standard gene Actb is screened first; a nucleotide sequence of the gene Actb is as shown as SEQ ID NO.1 (Sequence Identifier Number 1); the gene Actb is located on a chromosome; single copy is easy to quantify; and the gene Actb has a constant copy number in chicken species, without allelic variation and can serve as a target gene for chicken-origin identification. LAMP amplification primers are designed by taking the gene as a target sequence; nucleotide sequences of the LAMP amplification primers are as shown as SEQ ID NO. 2-5; the LAMP amplification primers and an LAMP reaction solution constitute the detection kit; the detection kit can detect the chicken-origin ingredient in the food and the feed quickly and sensitively, and the sensitivity reaches 10pg. The kit is simple in use method, low in cost, high in specificity and very applicable to field real-time detection and has a wide application prospect in animal-origin food surveillance and meat product adulteration defense, and a reaction result is easy to observe.
Description
Technical field
The present invention relates to living species identification technology field, become more particularly to Ji Yuan in a kind of detection food and feedstuff
Loop-mediated isothermal amplification technique (LAMP) test kit dividing.
Background technology
With the development of social economy and product technology processing, a lot of food are illegally added various chemical raw materials, interpolation
Agent, hormone etc., or even much businessman is to seek great number interests to carry out food adulteration behavior or directly adulterate, this serious harm
Interests of consumer and healthy are therefore most important to the precise Identification of food variety.
No matter at home or external, Carnis Gallus domesticus are all the main meat of current consumption, and its importance is self-evident.In Europe
Continent, Carnis Gallus domesticus occupy staple market, and supermarket supplies 60% Carnis Gallus domesticus processed goods, and turkey is even more by popular consumer.In China, chicken
Meat is traditional poultry meat, enters Chinese market with miscellaneous external fast food, Carnis Gallus domesticus have been processed to various products.So
And more and more businessman is to obtain great number interests, feeding chicken with hormone and antibody makes its accelerated growth, in chicken in feeding process
Add Ji Cheng branch in feedstuff and cause " crazy fowl disease ", more have illegal businessman with the cheap adulterated beef and mutton of Carnis Gallus domesticus, to seek violence
Deng.And Carnis Gallus domesticus pollution may cause global food-safety problem, internal standard gene and molecular engineering using chicken detect Carnis Gallus domesticus
Adulterated is a kind of effective detection meanss.
At present, internal standard gene is widely used for differentiating food adulteration, but how to filter out suitable internal standard base
Because being particularly important.Mostly meat productss detection of adulterations technology both domestic and external is specifically to draw for the gene design on mitochondrion at present
Carrying out real-time fluorescence quantitative PCR amplification, because mitochondrial gene is multi-copy gene, its detection sensitivity is high for thing, but simultaneously
Distinguishing due to there is puzzlement when the unconscious cross-contamination produced by process such as selling, transport with conscious illegal interpolation.
In addition, the concentration of high copy number mitochondrial DNA cannot be corresponding with the concentration of genomic DNA, therefore essence cannot be carried out to sample
Really quantitative analyses, simultaneously because mitochondrial gene homology high it is difficult to qualitative detection is realized by regular-PCR.Therefore, the party
The screening that method can only realize meat adulteration by quantitative fluorescent PCR differentiates.To differentiate the cross-contamination unintentionally of low concentration and having
Meaning is illegally added and clearly adulterated ratio realizes rapid screening, then want the low copy gene on selective staining body as meat internal standard
Quasi- gene.
Loop-mediated isothermal amplification (loop-mediated isotherm amplification, LAMP) be by
In a kind of new constant temperature nucleic acid amplification method of exploitation in 2000, its principle is using a kind of strand displacement DNA polymerization to Notomi
, to special primer, specifically 6 isolated areas on identification target sequence, in isothermal for enzyme (BstDNA polymerase) and two
Under the conditions of (65 DEG C about) insulation dozens of minutes, you can complete nucleic acid amplification reaction.
Content of the invention
It is an object of the invention to provide for the chicken source general internal standard gene detecting chicken derived components in food and feedstuff
Actb.
Another object of the present invention be to provide a kind of have high sensitivity, high specific, detection food simple to operate and
The LAMP detection kit of chicken derived components in feedstuff.
A kind of gene for detecting chicken derived components in food and feedstuff, it is internal standard gene Actb, has SEQ ID
Sequence shown in NO.1.
The invention provides application in detection chicken derived components for the above-mentioned internal standard gene Actb.
The invention provides the application in above-mentioned internal standard gene Actb chicken Components identification in food or feedstuff.
The invention provides a kind of specificity LAMP primer composition for detecting above-mentioned internal standard gene Actb, including following
Article 4, primer：
F3：5’-CCCAAGAAAGATGGCTGGAA-3’；
B3：5’-AGAGGCTACAGCTTCACCA-3’；
FIP：5’-AGCTGCCTCTAGCTCTTCCCTAAACCTCTCATTGCCAATGGT-3’；BIP：5’-
GTGGCCATCTCCTGCTCGAAACCGAGAGAGAAATTGTGCGT-3’.
The invention provides application in the identification of chicken derived components for the above-mentioned specificity LAMP primer composition.
The invention provides above-mentioned specificity LAMP primer composition is in preparation chicken derived components detection kit or detectable
In application.
Further, the present invention provides a kind of detection chicken derived components reagent containing above-mentioned specificity LAMP primer composition
Box.
The method that the present invention provides chicken derived components in a kind of detection food and feedstuff, comprises the following steps：
(1) testing sample extracts DNA；
(2) to extract DNA as template, LAMP detection is carried out using specificity LAMP primer composition described in claim 3；
(3) result judges：Carry out product judgement using 2% agarose gel electrophoresiies, stepped band proves amplification
Success, containing genes of interest.
In said method, the described LAMP of step (2) detects, the concrete configuration of its 25 μ L LAMP detection system is：1×
Thermopol buffer, 0.4mM dNTP, 3mM MgSO4, 1.0M glycine betaine, 1.6 μM of primers F IP, 1.6 μM of primer BIP,
3,0.2 μM of primer B3 of 0.2 μM of primers F, 8U Bst archaeal dna polymerase large fragment.
In said method, LAMP detection reaction condition is：60-65 DEG C of constant temperature 1h, 85 DEG C of 5min, then terminating reaction.
The present invention filters out chicken source internal standard gene first on chromosome, and copy number is single copy.The present invention uses many
Individual kind chicken checking internal standard gene is it was demonstrated that there is not allelic variation in this internal standard stable gene.The choosing of internal standard gene
Select and typically require copy number low and stable, general animal internal standard gene often selects on mitochondrion, and such reference gene is copied
Shellfish number is many, is not easy to quantitation.As internal standard gene, its copy number ground is easy to quantitative to gene on selective staining body of the present invention,
Compared to the gene on mitochondrion, mutation rate is lower.The present invention takes digital pcr and southern hybridization two ways, enters
The identification of row copy number.In conjunction with Ensembl gene information database data it is determined that the copy number of Actb gene is single copy,
Determine accuracy on checking copy number for the digital pcr simultaneously, other species can be extended to.
Based on present invention determine that internal standard Gene A ctb for detecting chicken derived components in food and feedstuff, the present invention sets
Count the LAMP primer composition for detecting this gene, apply this LAMP primer composition can detect in testing sample whether there is Ji Yuan
Composition, reaction is quick, and time-consuming few, specificity is good, and sensitivity is high, simple to operate it is not necessary to professional's operation, result is easy to see
Examine, be very suitable for basic unit's food supervision and inspection and use.
Brief description
Fig. 1 is Genetic homology of carbapenem-resistant.
Fig. 2 is common family chicken, the Southern results of hybridization electrophoretogram of turkey, the common family chicken of 1, BamH1 enzyme action；2,Nhe1
The common family chicken of enzyme action；3, BamH1 enzyme action turkeys 4, Nhe1 enzyme action turkey.
Fig. 3 is that Actb and Gcg expands hotspot graph.
Fig. 4 is the Actb/Gcg ratio figure under common 5 Concentraton gradient of family chicken, and concentration is respectively 100,10,1,0.1,
0.01ng/ul.
Fig. 5 is that the qualitative PCR of Actb gene verifies specificity, swimming lane 1-21:1, common family chicken；2, pheasant；3, turkey；4,
Gallus Domesticuss；5, pig；6, cattle；7, sheep；8, horse；9, donkey；10, duck；11, goose；12, Canis familiaris L.；13, rabbit；14, Mus；15, fish；16, yak；17,
Babalus bubalis L.；18, camel；19, ermine；20, deer；21, negative；M:DNA Marker DL 2000.
Fig. 6 is that the quantitative PCR of Actb gene verifies specificity, and wherein 1 is pheasant, and 2 is Gallus Domesticuss, and 3 is common family chicken, and 4 are
Turkey.
Fig. 7 is the fluorescent quantitative PCR curve of Actb gene, and wherein 1 is 100ng/ul, and 2 is 10ng/ul, and 3 is 1ng/
Ul, 4 is 0.1ng/ul, and 5 is 0.01ng/ul, and 6 is feminine gender.Each concentration do three parallel.
Fig. 8 is the quantitative fluorescent PCR standard curve of Actb gene.
Fig. 9 is LAMP specific detection result, swimming lane 1-23:1, donkey；2, camel；3, deer；4, ermine；5, pig；6, cattle；7,
Sheep；8, horse；9, common family chicken；10, Gallus Domesticuss；11, pheasant；12, turkey 13, goose；14, duck；15, Canis familiaris L.；16, rabbit；17, Mus；18,
Fish；19, yak；20, Babalus bubalis L.；21, negative；M:DNA Marker DL 2000.
Figure 10 is common family chicken LAMP susceptiveness testing result, swimming lane 1-8:1,100ng；2,10ng；3,1ng；4,
0.1ng；5,10pg；6,1pg；7,0.1pg；8, negative；M:DNA Marker DL 2000.
Specific embodiment
Following examples further illustrate present disclosure, but should not be construed as limitation of the present invention.Without departing substantially from
In the case of present invention spirit and essence, the modification that the inventive method, step or condition are made or replacement, belong to the present invention
Scope.
If not specializing, the conventional meanses that in embodiment, technological means used are well known to those skilled in the art.
Pig (Sus scrofa), cattle (Bos taurus), sheep (Ovis aries), common family chicken (Gallus gallus),
Pheasant (Phasianuscolchicus), turkey (Meleagris gallopavo), Gallus Domesticuss (Gallus domesticus
Brisson), duck (Anas platyrhynchos), goose (Goose calicivirus), Canis familiaris L. (Canis lupus
Familiaris), rabbit (Oryctolagus cuniculus), yak (Bos mutus), Channa argus (Pseudosciaena
Polyactis) buy for supermarket.Horse (Equus caballus), donkey (Equus asinus) is bought for Beijing market of farm produce.Always
Mus (Mus musculus) are provided with Molecular Biology Lab by China Agricultural University's food safety.Babalus bubalis L. (Bubalus
Bubalis), ermine (Martes zibellina), camel (Camelus ferus), deer (Cervus) is entered and left the border by Tianjin and checks
Doctor Li Zongmeng of office provides.
The screening of the general internal standard gene Actb in embodiment 1 chicken source
By searching for the gene information with regard to chicken in GenBank, target gene group is downloaded from NCBI, and saves as
" .FASTA " form.Full-length genome information for chicken is analyzed, and is entered using BLAST and DNAMAN Version 4.0 software
Row homology analysis, filter out Actb gene, and this gene is located on chromosome, is one of actin cytoskeleton.By 20 kinds
Meat (it is common family chicken (Gallus gallus) respectively, pheasant (Phasianuscolchicus), turkey (Meleagris
Gallopavo), Gallus Domesticuss (Gallus domesticus brisson), pig (Sus scrofa), cattle (Bos taurus), sheep
(Ovis aries), duck (Anas platyrhynchos), goose (Goose calicivirus), Canis familiaris L. (Canis lupus
), familiaris rabbit (Oryctolagus cuniculus), yak (Bos mutus), Channa argus (Pseudosciaena
Polyactis), horse (Equus caballus), donkey (Equus asinus), mouse (Mus musculus), Babalus bubalis L.
(Bubalus bubalis), ermine (Martes zibellina), camel (Camelus ferus), deer (Cervus)) Actb
Channel genes DNAMAN Version 4.0, carries out multisequencing specificity analyses, and sequence alignment result saves as " .seq " form.
The fragment selecting specificity high carries out BLAST analysis again, sequence homology and specificity in searching data storehouse.Finally by sequence
Row are integrated, and determine that final specific targets gene β-Actin (Actb) gene can be used as internal standard gene.This Actb
The nucleotide sequence of fragment is as shown in SEQ ID NO.1.
The checking of the general internal standard gene in embodiment 2 chicken source
1st, it is directed to internal gene Actb of embodiment 1 screening, (U.S. gives birth to by Primer Express 3.0 design software
Life technology company) it is directed to Actb gene design PCR and quantification PCR primer and probe.
Table 1 qualitative PCR, quantitative PCR and digital pcr the primer and probe sequence
Note：FAM, TAMRA, VIC and BHQ1 are 4 kinds of fluorophors
2nd, copy number measures
Take digital pcr and southern hybridization two ways, carry out the identification of copy number.In conjunction with Ensembl gene
Information data database data, it is determined that the copy number of Actb gene is single copy, determines digital pcr on checking copy number simultaneously
Accuracy, other species can be extended to.
Preferably internal standard gene should copy number be constant there is not allelic variation in corresponding species.According to
Actb gene sets up chicken source species specificity PCR detection system using primer Actb-1F/1R, for analyzing internal standard gene
Middle specificity and allelic variability, to ensure the accuracy of internal standard genescreen.Using primer carry out qualitative and
Find after quantitative analyses, Actb gene does not have allelic variation in chicken species.Template DNA is carried out with 10 times of gradients dilute
Release, carry out quantitative fluorescent PCR to sensitive analysis using primer Actb-1F/1R and probe Actb-1P, when DNA profiling concentration
During as little as 10pg, fluorescence signal still can be detected, obtaining good linear equation according to standard curve is：Y=-3.196x+
32.481, R2=0.994.Understand that Actb gene is in common family chicken, turkey, Gallus Domesticuss and pheasant by the identification of above copy number
Single copy, thus it could be speculated that this reference gene Actb and quantitative PCR system equally can be also suitably used for turkey, Gallus Domesticuss and pheasant
Detection by quantitative, its detection is limited to 8 copy numbers.
In order to identify copy number in chicken for the Actb, the present invention devises pair of primers Actb-2F/2R and expands one section
436bp DNA fragmentation, this fragment is used for Southern blot as probe.It is respectively cut chicken, turkey with Nhe1 and BamH1
DNA, then hybridizes with 436bp DNA fragmentation.One rule all only occurs in the DNA fragmentation of Nhe1 and BamH1 enzyme action as shown in Figure 2
Band, this shows that Actb gene is single copy in chicken and turkey.
Additionally, carrying out digital pcr using primer Actb-1F/1R and probe Actb-2P to do copy number analysis.System configurations
After the completion of, reaction system is transferred in the system well that Droplet Generator Cartridge microdroplet generates card, and
The digital pcr reaction oil of 70 μ L is added in reaction oil well；After the completion of sample-adding, microdroplet generation card is transferred to
In Droplet Generator drop generators, start instrument；Microdroplet generates after terminating, by the micro system after the completion of generating
It is transferred to sealer in 96 holes；96 orifice plates are placed in PCR instrument, PCR amplification program is 50 DEG C of hot activation 5min；95 DEG C of denaturations
5min；50 circulations：95 DEG C of degeneration 15s, 60 DEG C of annealing and extension 60s.After amplification terminates, 96 orifice plates are taken out, is placed in
Droplet Reader microdroplet reads in instrument and carries out microdroplet fluorescence reading；Microdroplet signals collecting adopts FAM/VIC dual pathways fluorescence
By analyzing hotspot graph, collection, after fluorescent collecting, determines that fluorescence threshold limit (2995) determines negative microdroplet and positive microdroplet.
According to Poisson distribution, calculate the copy number of each passage using formula.Concrete formula is as follows：
Formula 1：N (reference gene)=- ln [(N-X)/N] × N
Formula 2：N (specific gene)=- ln [(N-Y)/N] × N
Wherein, N (reference gene) and N (specific gene) represents reference gene (the i.e. single copy Gcg base calculating respectively
Cause) and specific gene (being this experiment Actb internal standard gene) copy number；N is total hole count, and X represents the corresponding sun of reference gene
Property hole count, Y represent specific gene corresponding the positive hole count.
Chicken template concentrations are arrived 100ng/ul surely, dilutes 5 Concentraton gradient successively, then calculate Actb/ with digital pcr
The value of Gcg, from the figure 3, it may be seen that the value of Actb/Gcg is 1:1.The ratio of Actb/Gcg and the limits of error are automatically generated by hotspot graph.
As shown in Figure 4, when template concentrations are very high, the stability of reaction result is still fine, and result fluctuation range is little, ratio and error
Limit is near 1.Reduce with concentration although result fluctuation shows larger difference, the limits of error substantially broadens, but Actb/Gcg
It is worth still 1 about.Show that the result of Actb/Gcg value is not affected by template concentrations.Southern results of hybridization and digital pcr
Result is consistent, illustrates that digital pcr is a kind of efficient, quick, method of precise Identification copy number of target genes, can be with Applied Digital
PCR method identifies the copy number of target gene.
Table 2 Bio-Rad digital pcr flat reaction system
3rd, the analysis of the specificity identification of Actb gene and its allelic variation
Using primer pair Actb-1F/1R (being shown in Table 1) designing to 4 breeder species (common family chicken, turkey, Gallus Domesticuss, pheasant)
With 16 kinds of non-chicken species (pig, cattle, sheep, duck, goose, Canis familiaris L., rabbit, yak, horse, donkey, Mus, Babalus bubalis L., ermine, camel, deer, fish) carry out qualitative
PCR expands and with 2% agarose gel, amplified production is carried out with electrophoretic analysiss, pcr amplification reaction program：95 DEG C of denaturations
5min；95 DEG C of 30s, 60 DEG C of 45s, 72 DEG C of 1min, 35 circulations；72 DEG C of extension 10min.Carry out quantitative PCR analysis, reaction simultaneously
Program：95 DEG C of denaturations 10min；95 DEG C of 15s, 60 DEG C of 1min, 40 circulations；60 DEG C of collection signals.Result shows, all 4 kinds
Chicken species all can amplify the fragment of 113bp, meets the corresponding clip size of designed primer.And 16 kinds of non-chicken species of other are equal
No specific amplification band (Fig. 5).Carry out quantitative PCR with primer Actb-1F/1R and probe Actb-1P this 20 kinds of species are entered
Row detection, 4 breeder species can detect signal and 16 kinds of non-chicken species are not detected by signal (Fig. 6).This show this gene with
And corresponding primer can be used to specifically detect chicken and chicken source property product.
Table 3 qualitative PCR reaction system
Table 4 quantitative PCR reaction system
4th, quantitative PCR sensitivity checking
In order to evaluate the susceptiveness of quantitative fluorescent PCR, by genomic DNA concentration 7 gradients of 10 times of dilutions of family chicken,
100ng, 10ng, 1ng, 0.1ng, 10pg, 1pg, 0.1pg, carry out quantitative fluorescent PCR, amplification curve such as Fig. 7, take 5 point-renderings
Standard curve, the standard curve obtaining is as shown in figure 8, as DNA profiling concentration the most as little as 10pg, fluorescence signal can be detected.
Therefore, the test limit of this fluorescent quantitation system is 10pg DNA, that is, 8 copy numbers.Give with regard to Cq value and base simultaneously
Because of linear equation between the logarithm of group concentration.Linear equation is：Y=-3.196x+32.481, R2=0.994.Y represents Cq value, x
Represent the logarithm value of genome concentration, R2Represent linearly dependent coefficient.According to R2Value understands copy number and the Ct of chicken genomic DNA
There is between value good linear relationship.Understand Actb gene in common family chicken, turkey, Gallus Domesticuss and pheasant by the identification of above copy number
In be single copy, thus it could be speculated that this gene and quantitative PCR system can be also suitably used for turkey, Gallus Domesticuss and pheasant quantitation inspection
Survey, its detection is limited to 8 copy numbers.
5th, Carnis Gallus domesticus processed goods detection
Determined by the checking present invention, the quantitative PCR detection technique of internal standard gene and foundation detects in actual sample
During accuracy, this research to commercially available 14 kinds of Carnis Gallus domesticus processed goods and 6 kinds mixing meat productss detect, result shows 4
There is the phenomenon collected less than fluorescence signal in kind of food and 2 kinds of feedstuffs, this with KOKA Chicken satay taste instant noodles, close taste chicken
Meat flavour cup face, Mr. Zhang's refined little sister charcoal roasted chicken juice dessert face, in Mexico's chicken with several spices dessert surface compositions display do not contain chicken derived component
And be consistent without chicken derived component practical situation in chicken feed, show that the fluorescence quantifying PCR method that this research is set up can be used
Detection in actual sample.
Table 5 Carnis Gallus domesticus processed goods and mixing meat testing result
The foundation of embodiment 3 chicken derived components LAMP detection method
Using Japanese Rong Yan Co., Ltd. ring mediation primer Photographing On-line software LAMP primer designing
software primerexplorer V 5.0(http://primerexplorer.jp/elamp5.0.0/index.html)
The Actb gene design LAMP primer determining for embodiment 1.
Table 6 LAMP primer sequence
Using LAMP quick detection chicken sample, reaction system 25 μ L, including 1x Thermopol buffer, 0.4mM
DNTP, 3mM MgSO4, 1.0M glycine betaine, 1.6 μM of primers F IP, 1.6 μM of primer BIP, 3,0.2 μM of primer B3 of 0.2 μM of primers F,
8U Bst archaeal dna polymerase large fragment.Response procedures are 65 DEG C of constant temperature 1h, 85 DEG C of 5min.After amplification terminates, using 2% agarose
Gel electrophoresiss carry out product judgement, and stepped band proves to expand successfully, containing genes of interest.Result is as shown in figure 9, only
There are common family chicken, turkey, Gallus Domesticuss, pheasant that bright band occurs, show that Actb gene and corresponding LAMP system can be used for chicken
The quick detection of species.Detect the susceptiveness of chicken source species in order to evaluate LAMP system, by the genome of common family chicken from 100ng
7 Concentraton gradient of 10 times of dilutions, 100ng, 10ng, 1ng, 0.1ng, 10pg, 1pg, 0.1pg, carry out ring mediated isothermal amplification, knot
Fruit as shown in Figure 10, as DNA profiling concentration the most as little as 10pg, has bright band to expand out, as concentration as little as 1pg then
Band is not had to occur that is to say, that test limit is 10pg DNA, i.e. 8 copy numbers.Actb base is understood by the identification of above copy number
Because being single copy in common family chicken, turkey, Gallus Domesticuss and pheasant, thus it could be speculated that this gene and ring mediated isothermal amplification are examined
Survey system can be also suitably used for the quick detection of turkey, Gallus Domesticuss and pheasant, and its detection is limited to 8 copy numbers.This shows based on Actb
The ring mediated isothermal rapid detection system of gene detects that the test limit of chicken source species is 10pg DNA, that is, 8 copy numbers.
The above is only the preferred embodiment of the present invention it is noted that ordinary skill people for the art
For member, on the premise of without departing from the technology of the present invention principle, some improvements and modifications can also be made, these improvements and modifications
Also should be regarded as protection scope of the present invention.
Sequence table
<110>China Agricultural University
<120>Chicken derived components quick detection kit and its application in a kind of food and feedstuff
<130> KHP161116813.3
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 1380
<212> DNA
<213>Chicken ACTb
<400> 1
aacaactggt cagatgcagt gtgatggtac acaacccaca cgcagccctg tggcgctccg 60
ctacctaatt cctttatcag gccttggcca aggcactcca gagtctgagc aggcttaagg 120
cacagcccta cacacagcac cctccccctc ccaccccaac tcacagccag cacttaatct 180
cattactcac atggctgagt ggctgccacc ctgcccagag cgaggccata aggctccacc 240
actaagacaa agcagtttcc atcttctgta gtagtttagc tcagcctcct ccacccactc 300
agcattaaga ggtgtgctaa gagcagccta gggctccagc ctaccttgat tttcattgtg 360
ctaggtgcca gggctgtgat ctccttctgc atcctgtcag caatgccagg gtacattgtg 420
gtaccaccag acagcactgt gttggcatac agatccttac ggatatccac atcacacttc 480
atgatggagt tgaaggtagt ttcatggata ccacaggact ccatacctgc aagcaaaaag 540
cagtgtcaag tcagtaaatg gttcagggac aaggaagaca gaggacctac tgctatggga 600
aaacaagaga atcaaacacc ccatagtggg aaacaacaca gacaaaggca tggctgacag 660
gctcagcctc ctgttctact gacctaggta cctcaatcat cctcaaactg aggaagaaaa 720
aagactgcag tggaatggga cagacctgct aagggccagc aatattgtgg ccagtctcta 780
agtcgctcta ggcagaaggg gcatggaatc tcctcaaagg agtcagactt acccaagaaa 840
gatggctgga agagggcctc ggggcacctg aacctctcat tgccaatggt gatgacctga 900
ccatcaggga gttcatagct cttctctagg gaagagctag aggcagctgt ggccatctcc 960
tgctcgaaat ccagtgcgac gtagcacagc ttctccttga tgtcacgcac aatttctctc 1020
tcggctgtgg tggtgaagct gtagcctctc tctgtcagga tcttcatgag gtagtccgtc 1080
aggtcacggc cagccagatc cagacggagg atggcatggg ggagggcgta gccttcatag 1140
atgggcacag tgtgggtaac accatcacca gagtccatca caataccagt ggtacgacca 1200
gaggcataca gggacagcac agcctggatg gctacataca tggctggggt gttgaaggtc 1260
tcaaacatga tctagaaaga taaaaaaagc actgagtcaa gcagaataaa ccaaggttct 1320
cactgcacac ctacatcggt ccatgcatgt ggtttacatt tgtccctaga taagaggctt 1380
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
cccaagaaag atggctggaa 20
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<400> 3
agaggctacagcttcacca 19
<210> 4
<211> 42
<212> DNA
<213>Artificial sequence
<400> 4
agctgcctctagctcttccctaaacctctcattgccaatggt 42
<210> 5
<211> 41
<212> DNA
<213>Artificial sequence
<400> 5
gtggccatctcctgctcgaaaccgagagagaaattgtgcgt 41
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
tgacctaggt acctcaatca tc 22
<210> 7
<211> 22
<212> DNA
<213>Artificial sequence
<400> 7
cctagagtga cttagagact gg 22
<210> 8
<211> 24
<212> DNA
<213>Artificial sequence
<400> 8
cagacctgct aagggccagc aata 24
<210> 9
<211> 23
<212> DNA
<213>Artificial sequence
<400> 9
gcaatttcca agcgtcattc tga 23
<210> 10
<211> 24
<212> DNA
<213>Artificial sequence
<400> 10
ttcttcctcg tccattcact aacc 24
<210> 11
<211> 24
<212> DNA
<213>Artificial sequence
<400> 11
cagacctgct aagggccagc aata 24
<210> 12
<211> 23
<212> DNA
<213>Artificial sequence
<400> 12
gcaatttcca agcgtcattc tga 23
<210> 13
<211> 24
<212> DNA
<213>Artificial sequence
<400> 13
ttcttcctcg tccattcact aacc 24
<210> 14
<211> 24
<212> DNA
<213>Artificial sequence
<400> 14
ttgagagaca tgctgaaggc acct 24
Claims (10)
1. a kind of gene for detecting chicken derived components in food and feedstuff, it is internal standard gene Actb, has SEQ ID NO.1
Shown sequence.
2. application in detection chicken derived components for the gene described in claim 1.
3. the application in the chicken Components identification in food or feedstuff of the gene described in claim 1.
4. it is used for the specificity LAMP primer composition that test right requires gene described in 1, including following 4 primers：
F3：5’-CCCAAGAAAGATGGCTGGAA-3’；
B3：5’-AGAGGCTACAGCTTCACCA-3’；
FIP：5’-AGCTGCCTCTAGCTCTTCCCTAAACCTCTCATTGCCAATGGT-3’；
BIP：5’-GTGGCCATCTCCTGCTCGAAACCGAGAGAGAAATTGTGCGT-3’.
5. application in the identification of chicken derived components for the specificity LAMP primer composition described in claim 4.
6. the specificity LAMP primer composition described in claim 4 is in preparation chicken derived components detection kit or detectable
Application.
7. a kind of detection chicken derived components test kit containing specificity LAMP primer composition described in claim 4.
8. a kind of method detecting chicken derived components in food and feedstuff is it is characterised in that comprise the following steps：
(1) testing sample extracts DNA；
(2) to extract DNA as template, LAMP detection is carried out using specificity LAMP primer composition described in claim 4；
(3) result judges：Carry out product judgement using 2% agarose gel electrophoresiies, stepped band proves to expand successfully,
Containing genes of interest.
9. it is characterised in that the described LAMP of step (2) detects, its 25 μ L LAMP detects body to method as claimed in claim 8
System concrete configuration be：1x Thermopol buffer, 0.4mM dNTP, 3mM MgSO4, 1.0M glycine betaine, 1.6 μM of primers
FIP, 1.6 μM of primer BIP, 3,0.2 μM of primer B3 of 0.2 μM of primers F, 8U Bst archaeal dna polymerase large fragment.
10. method as claimed in claim 8 or 9 is it is characterised in that LAMP detection reaction condition is：60-65 DEG C of constant temperature 1h,
85 DEG C of 5min, then terminating reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610976206.7A CN106434959A (en) | 2016-11-07 | 2016-11-07 | Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610976206.7A CN106434959A (en) | 2016-11-07 | 2016-11-07 | Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434959A true CN106434959A (en) | 2017-02-22 |
Family
ID=58180196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610976206.7A Pending CN106434959A (en) | 2016-11-07 | 2016-11-07 | Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434959A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109337991A (en) * | 2018-11-20 | 2019-02-15 | 昆明理工大学 | The application and its kit of a kind of gene Gcg in detection family's chicken derived component |
| CN109457034A (en) * | 2018-11-20 | 2019-03-12 | 昆明理工大学 | The application and its kit of a kind of gene Gcg in detection turkey derived component |
| CN109811068A (en) * | 2019-04-11 | 2019-05-28 | 中国农业大学 | The kit of chicken derived components and its application in a kind of Rapid identification food |
| CN109811067A (en) * | 2019-04-11 | 2019-05-28 | 中国农业大学 | Chicken derived components quick detection kit and its application in a kind of food |
| CN109852707A (en) * | 2019-04-11 | 2019-06-07 | 中国农业大学 | Chicken derived components rapid detection method and kit in a kind of food |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773850A (en) * | 2013-12-10 | 2014-05-07 | 天津出入境检验检疫局动植物与食品检测中心 | Side flow test strip detection kit for detecting Gallusgallus ingredients in food and feeding stuff and application of kit |
-
2016
- 2016-11-07 CN CN201610976206.7A patent/CN106434959A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773850A (en) * | 2013-12-10 | 2014-05-07 | 天津出入境检验检疫局动植物与食品检测中心 | Side flow test strip detection kit for detecting Gallusgallus ingredients in food and feeding stuff and application of kit |
Non-Patent Citations (6)
| Title |
|---|
| ANDREW J. HOPWOOD等: "An actin gene-related polymerase chain reaction (PCR) test for", 《MEAT SCIENCE》 * |
| FAIRBROTHER KS等: "The actin multigene family and livestock speciation using the polymerase chain reaction", 《ANIMAL BIOTECHNOLOGY》 * |
| RENE KOPPEL等: "Multiplex real-time PCR for the detection and quantification", 《EUR FOOD RES TECHNOL》 * |
| 吴忠道等: "《临床寄生虫学检验》", 31 August 2015, 北京：中国医药科技出版社 * |
| 胡智恺等: "实时定量PCR 法对牛肉中鸡源性成份的量化检测", 《食品安全质量检测学报》 * |
| 马莉等: "鸡β-actin基因实时荧光定量PCR方法的建立", 《中国畜牧兽医》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109337991A (en) * | 2018-11-20 | 2019-02-15 | 昆明理工大学 | The application and its kit of a kind of gene Gcg in detection family's chicken derived component |
| CN109457034A (en) * | 2018-11-20 | 2019-03-12 | 昆明理工大学 | The application and its kit of a kind of gene Gcg in detection turkey derived component |
| CN109337991B (en) * | 2018-11-20 | 2021-09-14 | 昆明理工大学 | Application of gene Gcg in detection of chicken-derived components and kit thereof |
| CN109811068A (en) * | 2019-04-11 | 2019-05-28 | 中国农业大学 | The kit of chicken derived components and its application in a kind of Rapid identification food |
| CN109811067A (en) * | 2019-04-11 | 2019-05-28 | 中国农业大学 | Chicken derived components quick detection kit and its application in a kind of food |
| CN109852707A (en) * | 2019-04-11 | 2019-06-07 | 中国农业大学 | Chicken derived components rapid detection method and kit in a kind of food |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kumar et al. | Identification of species origin of meat and meat products on the DNA basis: a review | |
| CN106434959A (en) | Quick detection kit for chicken-origin ingredient in food and feed and application of quick detection kit | |
| Cammà et al. | Development and validation of fast Real-Time PCR assays for species identification in raw and cooked meat mixtures | |
| Xu et al. | Multiplex TaqMan locked nucleic acid real-time PCR for the differential identification of various meat and meat products | |
| CN105296647B (en) | The detection kit of several species kind derived components in sheep derived material identification and its product | |
| CN105274246B (en) | The detection kit of several species kind derived components in calf-derived Cyclospora identification and its product | |
| CN104946788A (en) | PCR primer and kit for identifying eight kinds of animal-derived components | |
| CN105274099A (en) | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method | |
| CN101659996A (en) | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof | |
| CN105296648B (en) | Fox derived component identify and animal product in fox, rabbit, dog ingredient multiple PCR detection kit | |
| CN106048034B (en) | Animal-derived component forms in based on PCR-RLFP-DHPLC technology scanning analysis food | |
| CN104946790A (en) | PCR method for tracking source identification of origin components of eight kinds of animals | |
| Gargouri et al. | PCR–RFLP and species-specific PCR efficiency for the identification of adulteries in meat and meat products | |
| CN103031382B (en) | Real-time fluorescence PCR (Polymerase Chain Reaction) detection method for source component of marten in food and feed | |
| CN106480203A (en) | For detecting internal standard gene and its application of chicken derived components | |
| CN106521016B (en) | The real-time fluorescence PCR detection method of calf-derived Cyclospora in food and feed is detected using single-copy nuclear gene | |
| CN105316418A (en) | Specific primer, probe, kit and method for detecting duck-origin components in meat products | |
| Vishnuraj et al. | Detection of giblets in chicken meat products using microRNA markers and droplet digital PCR assay | |
| CN106811514B (en) | Specific real-time fluorescence detection method for biological components in Amydae and kit thereof | |
| CN103525908A (en) | Method for rapidly detecting chicken, duck and pig blood components in blood jelly | |
| CN109266755B (en) | Kit and method for detecting mouse-derived components | |
| CN104962650B (en) | A kind of synchronous PCR method and kit for differentiating animal derived materials | |
| CN105296646B (en) | The detection kit of several species kind derived components in the identification of pig derived component and its product | |
| CN106868185B (en) | Specific primer group for detecting rat-derived component and application thereof | |
| CN109852705A (en) | Horse derived components rapid detection method and kit in a kind of food |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170222 |