CN110092823A - Isolated carp antiviral protein Pdcd6ip and antiviral activity - Google Patents
Isolated carp antiviral protein Pdcd6ip and antiviral activity Download PDFInfo
- Publication number
- CN110092823A CN110092823A CN201910345517.7A CN201910345517A CN110092823A CN 110092823 A CN110092823 A CN 110092823A CN 201910345517 A CN201910345517 A CN 201910345517A CN 110092823 A CN110092823 A CN 110092823A
- Authority
- CN
- China
- Prior art keywords
- pdcd6ip
- carp
- ala
- leu
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to freshwater fish gene engineering technology fields, disclose a kind of isolated carp antiviral protein Pdcd6ip and antiviral activity, the nucleotide sequence of the gene of carp antiviral protein Pdcd6ip is sequence shown in 1-2610bp in SEQ ID NO:1, and the amino acid sequence of coding is sequence shown in SEQ ID NO:2.Experiments have shown that the expression for the Pdcd6ip albumen that the present invention clones can influence the proliferation of huichun viremia virus (SVCV), and Pdcd6ip albumen plays an important role in the course of infection that cell resists SVCV, the influence simultaneously for the cell activity of ordinary cells is low.Gene or albumen of the invention provides new target spot to prepare anti-SVCV drug.
Description
Technical field
The present invention relates to freshwater fish gene engineering technology field more particularly to a kind of isolated carp antiviral proteins
Pdcd6ip and antiviral activity.
Background technique
China is aquaculture big country, but in recent years along with the continuous development of culture fishery, aquatic animal disease
Apparent ascendant trend is presented in the disease incidence of disease especially viral disease.This culture fishery and foreign trade to China
Huge economic loss is caused, the health and sustainable development of China's culture fishery are seriously restrict.Wherein, carp spring disease
Toxaemia (Spring viraemia of carp, SVC) is one kind by huichun viremia virus (Spring viraemia
Of carp virus, SVCV) caused by sudden hemorrhage.The disease be one kind using bleeding as main clinic symptoms and with height
Communicable acute epidemic disease is spent, can be sent out in a variety of Cyprinidae economic fish such as carp, fancy carp, grass carp, silver carp, flathead, crucian carp and fancy fishes
Raw manifest symptom.Normal outbreak of epidemic when spring is at 8~20 DEG C of water temperature, especially 13~15 DEG C of SVC, the disease break out and water temperature
Closely related with fish body health situation, water temperature is more suitable, the more poorer easier infection of fish body health situation.Sick fish is often gathered in water outlet
Mouthful place, body colour black, and exophthalmos, anus redness, abdomen expands and serious ascites, slow respiration, often disequilibrium and side
Trip.Disease morbidity is anxious, the death rate may be up to 90% or so, seriously endangers fish production and causes crushing blow, therefore the world
Animal health tissue OIE is classified as must notifiable important epidemic disease.2008, No. 1125 bulletin of the Ministry of Agriculture was even more by the disease
It is classified as " People's Republic of China (PRC) enter the territory animal one kind infectious disease ", and is uniquely listed in the fish epidemic disease of a kind of infectious disease so far
Disease is the first kind quarantine object of China's fish port quarantine.
Currently, the effective measures of the control of the passage disease are to carry out the monitoring of spring viremia in the world, find early
And be isolated or slaughtered, still lack the drug and method of effectively control spring viremia.Therefore reinforce the antiviral machine of SVCV
The research of system seeks effective prevention and treatment method with particularly important theory and practice meaning.
6 interaction albumen Pdcd6ip of apoptosis (Programmed cell death 6-interacting
Protein), also referred to as Alix or Aip1 is encoded by pdcd6ip gene, is endocytosis body sorting transhipment complex III
(the composition portion of (Endosomal sorting complexes required for transport III, ESCRT-III)
Point, also important function is played in regulatory process cell death.Studies have shown that Pdcd6ip can be with combination cell apoptosis phase
Close the albumen such as CIN85, endophilins, CHMP4B and the Tsg101 in albumin A LG-2, ESCRT-III.In addition, Pdcd6ip
Envelope virus such as human immunity can be taken part in conjunction with the late domain, including P (S/T) AP, YXXL, PPXY etc. of virus
In the budding and vesicular stomatitis virus VSV reproduction process of defective virus HIV, equine infectious anemia virus EIAV etc. nucleocapsid from
Inner body is to cytoplasmic transhipment.Pdcd6ip has played indispensable function served as bridge in different kinds of molecules mechanism, and virus composition
The budding of intracellular transhipment and intact virus is essential for viral normal replication.Therefore, Pdcd6ip is adjusting virus sense
Play a significant role in dye and duplication, whether expression and the height of expression will affect the infection and duplication of virus.EIAV
In studies have shown that the overexpression of Pdcd6ip inhibits its duplication.
Therefore, those skilled in the art is dedicated to developing a kind of carp antiviral protein, has and is directed to spring viremia
Antiviral activity, to reduce SVCV infectious, inhibits SVCV virus replication function, simultaneously for the cell activity of ordinary cells
It influences low, provides new drug target for the treatment of SVCV virus infection.
Summary of the invention
In view of the above drawbacks of the prior art, technical problem to be solved by the invention is to provide a kind of carp antivirus proteins
White (Pdcd6ip) has the antiviral activity for spring viremia, reduces SVCV infectivity, inhibits SVCV virus replication
Function, while the cell activity of ordinary cells will not be influenced, new drug target is provided for the treatment of SVCV, overcomes existing skill
The deficiency of art.
To achieve the above object, described the present invention provides a kind of isolated carp antiviral protein Pdcd6ip gene
The nucleotide sequence of Pdcd6ip gene is sequence shown in 1-2610bp in SEQ ID NO:1.
The present invention also provides a kind of isolated carp antiviral protein Pdcd6ip, the amino of the albumen Pdcd6ip coding
Acid sequence is sequence shown in SEQ ID NO:2.
Further, the albumen Pdcd6ip have can in huichun viremia virus (SVCV) matrix protein
The segment that PPXY structural domain combines.
The present invention also provides a kind of recombinant expression plasmids of nucleotide sequence comprising the Pdcd6ip gene.
The present invention also provides a kind of preparation methods for preparing the recombinant expression plasmid, which is characterized in that the method
The following steps are included:
Step 1: extracting the RNA of carp, RNA described in reverse transcription obtains the total cDNA of carp;
Step 2: the forward primer and reverse primer of design Pdcd6ip gene, total with the carp that the step 1 obtains
CDNA is template amplification, obtains amplified production;
Step 3: the amplified production that the step 2 is obtained carries out molecular cloning, recombinant expression plasmid is obtained.
Further, the step 2 further includes that need to also introduce respectively in the upstream and downstream of the total cDNA of the carp before amplification
Nhe I, EcoR I restriction enzyme site.
Further, forward primer and the reverse primer are respectively pCI-Pdcd6ip-F and pCI-Pdcd6ip-R,
The DNA sequence dna of middle pCI-Pdcd6ip-F is TTAGCTAGCCACCATGGCGACGTTTATTTCTGTC, the pCI-Pdcd6ip-
The DNA sequence dna of R is CGGAATTCCTACTGTTGGGGGTAGTAGGGCT。
Further, the amplified production is the DNA fragmentation of 2610bp.
The present invention also provides a kind of carp antiviral protein Pdcd6ip genes to prepare anti-huichun viremia virus
Application in pharmaceutical composition.
The present invention also provides a kind of carp antiviral protein Pdcd6ip to prepare anti-huichun viremia virus drug
Application in composition.
Compared with prior art, the present invention at least has technical effect beneficial below:
(1) expression of carp antiviral protein Pdcd6ip of the invention can influence huichun viremia virus (SVCV)
Proliferation, and the copy function of SVCV virus is inhibited, reduce the infectivity of SVCV virus;
(2) influence pole of the overexpression of carp antiviral protein Pdcd6ip of the invention for the cell activity of ordinary cells
It is low;
(3) Pdcd6ip gene of the invention and Pdcd6ip albumen provide to prepare anti-huichun viremia virus drug
New target spot.
It is described further below with reference to technical effect of the attached drawing to design of the invention, specific structure and generation, with
It is fully understood from the purpose of the present invention, feature and effect.
Detailed description of the invention
Fig. 1 is the amplification schematic diagram of the Pdcd6ip genetic fragment of a preferred embodiment of the invention;
Fig. 2 is the knot that situation is overexpressed using Western blot detection Pdcd6ip of a preferred embodiment of the invention
Fruit schematic diagram;
Fig. 3 is utilization cell Proliferation/toxicity detection reagent C CK-8 detection of a preferred embodiment of the invention
Pdcd6ip is overexpressed the influence result data figure to cell activity;
Fig. 4 is the utilization indirect immunofluorescence detection Pdcd6ip albumen of a preferred embodiment of the invention to virus
The fluorescence imaging picture of the influence of infection;
Fig. 5 is the utilization fluorescence quantitative PCR detection Pdcd6ip albumen of a preferred embodiment of the invention to virus multiplication
Influence result data figure;
Fig. 6 is the structural representation map of the pCI-neo empty carrier of the application of a preferred embodiment of the invention;
Fig. 7 is the structural representation of the recombinant expression plasmid pCI-Pdcd6ip of the preparation of a preferred embodiment of the invention
Map;
Fig. 8 is the structure of the recombinant expression plasmid pCI-flag-Pdcd6ip of the preparation of a preferred embodiment of the invention
Illustrate map.
Specific embodiment
Multiple preferred embodiments of the invention are introduced below with reference to Figure of description, keep its technology contents more clear and just
In understanding.The present invention can be emerged from by many various forms of embodiments, and protection scope of the present invention not only limits
The embodiment that Yu Wenzhong is mentioned.
(1) RNA of carp is extracted
Sample to be tested total serum IgE is extracted using classical Trizol method.It is directly placed into after taking carp tissue block to be shredded with eye scissors
In mortar, a small amount of liquid nitrogen is added, grinds rapidly, is transferred to centrifuge tube after grinding sufficiently, takes 50-100mg tissue that 1mL is added
Trizol is mixed, and (15-25 DEG C) placement 10min of room temperature, is centrifuged 5min by then 4 DEG C, 12000 × g.
Take supernatant that 200 μ L chloroforms are added, oscillation is placed at room temperature for 15min, 4 DEG C, 12000 × g, is centrifuged 15min after mixing.
It takes upper strata aqueous phase to another new centrifuge tube, 500 μ L isopropanols is added, place 10min on ice, 4 DEG C, 12000 ×
G is centrifuged 15min.
Supernatant is abandoned, the 75% ethyl alcohol 1mL washing precipitating being pre-chilled on ice is added, 4 DEG C, 7500 × g, is centrifuged 10min.
Supernatant is abandoned, room temperature is dried, and is dissolved RNA precipitate with the water of no RNA enzyme, is carried out reverse transcription immediately.
(2) reverse transcription obtains the total cDNA of carp;
Using the reverse transcription reagent box of Invitrogen company, operating procedure carries out cDNA synthesis to specifications, specifically
Steps are as follows:
The RNA, 1 μ L random hexamers, supplement of 1 μ g said extracted are sequentially added in PCR reaction tube without RNA
Enzyme water is to 12 μ L of total volume;It in 65 DEG C of reaction 5min, is immediately placed on ice, 4 μ L5 × Reaction Buffer, 1 μ is then added
L RiboLock RNase Inhibitor, 2 μ L 10mM dNTP Mix and 1 μ L RevertAid M-MuLV RT, 25 DEG C anti-
5min is answered, 42 DEG C of heat preservation 45min obtain the total cDNA of carp later.
(3) carp pdcd6ip gene magnification
First with 5.0 software of Primer Express, the forward primer and reverse primer of pdcd6ip gene are designed, and
Nhe I, EcoR I restriction enzyme site are introduced in the upstream and downstream of the total cDNA of the carp respectively, is carried out by template of the total cDNA of the carp
PCR amplification, primer sequence are as follows:
PCI-Pdcd6ip-F:TTAGCTAGCCACCATGGCGACGTTTATTTCTGTC;
PCI-Pdcd6ip-R:CGGAATTCCTACTGTTGGGGGTAGTAGGGCT。
PCR reaction system are as follows: 50 μ L reaction systems, including ddH230.5 μ L, 10 × LA Buffer II (Mg2+ of O
Plus) 5 μ L, dNTP Mixture (2.5mmol/L) 8 μ L, upstream and downstream primer (10 μm of ol/L) each 2 μ L;LA Taq
2 μ L of Polymerase (5U/ μ L) 0.5 μ L, cDNA template.
PCR reaction condition are as follows: 95 DEG C of initial denaturation 5min;95 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 3min, altogether
35 circulations;72 DEG C of extension 10min;4 DEG C of heat preservations.
Pcr amplification product uses 1.0% agarose electrophoresis, nucleic acid staining agent dyeing.Voltage 120V, electrophoresis 30min, standard
Molecular weight compares, and amplification obtains the amplified production of 2610bp, and amplification is as shown in Figure 1.
(4) building of recombinant expression plasmid pCI-Pdcd6ip and pCI-flag-Pdcd6ip
According to classical molecular cloning protocols method, returned with the glue purification of cutting that DNA plastic recovery kit carries out PCR fragment
It receives, then respectively by pCI-neo carrier (being purchased from Promega company, map is as shown in Figure 6) and the amplified production recycled
PCR fragment 37 DEG C of double digestion 3h of Nhe I and EcoR I, endonuclease bamhi purification and recovery.Segment is recycled to make in T4-DNA ligase
Under, overnight in 16 DEG C of connections.Connection product is converted into DH5 α competent escherichia coli cell, picking monoclonal expands culture,
PCR is identified.Positive colony further passes through sequencing, compares the correctness for determining recombinant plasmid sequence, is named as pCI-
Pdcd6ip, all samples are sequenced by Sangon Biotech (Shanghai) Co., Ltd..
The construction method of pCI-flag-Pdcd6ip plasmid is as follows: in pCI-Pdcd6ip primer before initiation codon ATG
It is inserted into flag sequence label, separately designs synthetic primer pCI-flag-Pdcd6ip-F1:TTAGCTAGCCACCATGGATTACA AGGATGACGACGATAnd pCI-flag-Pdcd6ip-F2:GGATGACGACGATAAGATGGCGACGTTTATTTCTGTC, with
Be sequenced correct pCI-Pdcd6ip plasmid be template, with pCI-flag-Pdcd6ip-F2 and pCI-Pdcd6ip-R primer pair into
Row first round PCR, after the recycling of PCR product glue, then using first round PCR product as template, with pCI-flag-Pdcd6ip-F1 and
PCI-Pdcd6ip-R primer pair carries out the second wheel PCR, the recycling of PCR product glue, structure of the remaining steps with pCI-Pdcd6ip plasmid
Construction method.
The map difference of recombinant expression plasmid pCI-Pdcd6ip and pCI-flag-Pdcd6ip are as shown in Figure 7 and Figure 8.
(5) preparation of recombinant expression plasmid and empty carrier
The 30 μ L bacterium solution that correct monoclonal is sequenced is inoculated into the LB liquid training of ampicillin of the 3mL containing 50ug/mL
It supports in base, 37 DEG C, 220rpm, shaking table is incubated overnight, described in plasmid extraction kit (being purchased from Invitrogen company) extraction
Recombinant plasmid pCI-Pdcd6ip and the empty carrier pCI-neo plasmid, the specific steps are as follows:
The bacterium solution being incubated overnight is placed in 1.5mL centrifuge tube, room temperature, 12000 × g is centrifuged 1min, abandons supernatant to the greatest extent, repeats
The above operation is until all bacterium solutions have been centrifuged;
250 μ L Resuspension Solution suspension precipitating is added in bacterial precipitation;
250 μ L Lysis Solution are added mildly and fully spinning upside down 4-6 times and being uniformly mixed splits thallus sufficiently
Solution, until forming bright solution, this step is no more than 5min;
350 μ L Neutralization Solution are added and sufficiently spin upside down 4-6 times, room temperature, 12000 × g, from
Heart 5min;
It sucks supernatant and is transferred to adsorption column (being provided in kit), room temperature, 12000 × g is centrifuged 1min, abandons filtrate;
It is washed twice with 500 μ L Wash Solution, abandons filtrate;Room temperature, 12000 × g are centrifuged void column 1min;
Adsorption column moves into new 1.5mL centrifuge tube, adds 50 μ L Eluent in adsorption column film center, is stored at room temperature 2min,
12000 × g is centrifuged 1min.
(6) recombinant expression plasmid and empty carrier transfect EPC cell
Specific step is as follows (by taking 24 porocyte culture plates as an example):
The day before transfection determines cell density according to transfection purpose, if collecting cell western detection after transfection, the
Transfection when cell density reaches about 90% in two days, if the positioning of observation albumen, density can be reduced suitably after transfection;
Transfection: 0.8 μ g DNA is first dissolved in 50 μ L Opti-MEM culture mediums by A;2 μ L Lipo 2000 are dissolved in 50 μ L by B
In Opti-MEM culture medium, mixes, be placed at room temperature for 5min;Then two pipe of AB is mixed, is placed at room temperature for 20min;
Period changes culture medium in 24 orifice plates into serum free medium, every 400 μ L of hole.If can not without dead cell in hole
It changes, does not influence transfection efficiency;
AB pipe mixture is added in 24 orifice plate corresponding apertures, all around mixes gently, sets in incubator, changed into after 4-6h
Culture medium containing 10% serum.
(7) detection recombinant plasmid pCI-Pdcd6ip is overexpressed the influence to cell activity
It is overexpressed using cell Proliferation/toxicity detection reagent C CK-8 (being purchased from Dojindo company) detection to cell activity shadow
It rings, CCK-8 reagent can be used for easy and accurately cell Proliferation and oxicity analysis, basic principle are to contain 2- in the reagent
(2- methoxyl group -4- nitrobenzophenone) -3- (4- nitrobenzophenone) -5- (2,4- disulfonic acid benzene) -2H- tetrazolium monosodium salt (WST-8), it
Water-soluble orange-yellow formazan can be reduced to by intracellular dehydrogenase under the action of electron carrier 1-Methoxy PMS, it is raw
The amount of Cheng formazan is directly proportional to cell number, can indirect determination living cells quantity.Specific step is as follows:
The day before transfection is inoculated with 100 μ L EPC cell suspensions into 96 porocyte culture plates, and overnight incubation is close to cell
The recombinant expression plasmid pCI-Pdcd6ip and empty carrier pCI- is transfected by preceding method when degree reaches about 70%-90%
neo;
The CCK-8 of 10 μ L is added into every hole by 12h, 36h and 72h after transfection;
Culture plate is incubated for 1 hour in incubator, utilizes the absorbance at microplate reader measurement 450nm.
As a result as shown in figure 3, showing that recombinant plasmid pCI-Pdcd6ip is overexpressed the activity for having no effect on cell.
(8) Western blot immunoblot experiment
Specific step is as follows:
The recombinant expression plasmid pCI-flag-Pdcd6ip and empty carrier pCI-neo is transfected EPC cell 24 hours
Afterwards, abandon supernatant, washed twice with PBS, each 3min, be added RIPA cell pyrolysis liquid, with rifle piping and druming it is several under, make lysate and cell
It comes into full contact with, is incubated for 10min lytic cell on ice, lysate is transferred in 1.5mL EP pipe, 12000 × g, be centrifuged 5min,
5 × albumen sample-loading buffer of 20 μ L centrifugation, 5 μ L of supernatant is taken to mix, 95 DEG C are boiled 5min, carry out SDS-PAGE.SDS-PAGE is solidifying
The preparation of glue uses PAGE gel reagent preparation box (being purchased from Shanghai Yi Sheng company);
The filter paper and pvdf membrane to fit like a glove with gel size is cut, 15min is balanced in transfering buffering liquid;
After gel electrophoresis, gel interlayer is dismantled, removal concentration glue, gel is in appropriate transfering buffering liquid equilibrium at room temperature
10min;
Black plate is soaked with transfer buffer, assembling transfer interlayer pays attention in time needing that bubble is discharged.Egg is shifted at constant pressure
White 20V, 40min;
It after transferring film is complete, takes the film out, is put into hybridizing box, add 10mL 5%PBST-BSA confining liquid to close, 37 DEG C of closing 2h
Or 4 DEG C of closings are overnight;
Confining liquid is outwelled, (primary antibody is purchased from Sigma company to the flag tag antibody that addition has diluted, with volume ratio 1:1000
Dilution), 2h is slowly shaken at 37 DEG C;
PBST is washed 3 times, each 3min, the goat anti-mouse IgG antibodies (two that the alkaline phosphatase diluted (AP) is marked
It is anti-, it is purchased from green skies company, with volume ratio 1:800 dilution) be added in hybridizing box, 37 DEG C slowly shake 1h;
Secondary antibody is outwelled, PBST is washed 3 times, each 3min.10mL NBT/BCIP chromophoric substrate is added, band is in 5-10min
Colour developing.After immunoblot results are as shown in Fig. 2, show transfection, Pdcd6ip is overexpressed.
(9) indirect immunofluorescence (IF)
PBS is washed cell 2 times, each 3min, and 300 μ L, 4% paraformaldehyde, the fixed 30min of room temperature is added in every hole;
Fixer is absorbed, is washed cell 3 times with PBS, the PBS permeabilization of 300 μ L X-100 containing 0.2%Triton is added in every hole
15min;
PBS is washed 3 times, and the confining liquid containing 4%BSA, 37 DEG C of closing 2h are added;
Absorption confining liquid, the addition diluted primary antibody of confining liquid (preparation of this laboratory, rabbit-anti SVCV M protein antibodies, with
Volume ratio 1:1000 dilution), 37 DEG C of incubation 2h;
Primary antibody is absorbed, PBS is washed 3 times, each 3min, addition fluorescence secondary antibody (donkey anti-rabbit that Alexa Fluor 488 is marked,
It is purchased from Invitrogen company, with volume ratio 1:2000 dilution), 37 DEG C of incubation 1h;
Secondary antibody is absorbed, PBS is washed 3 times, each 3min, and diluted dye karyolymph DAPI (1:2000) dyeing liquor of PBS, room temperature is added
10min is dyed, PBS is washed 3 times, each 3min;
500 μ L PBS are added in every hole, are placed under fluorescence inverted microscope and observe and take pictures.As a result as shown in figure 4,
The expression of Pdcd6ip can inhibit the infection of SVCV.
(10) influence that the overexpression of Pdcd6ip is proliferated SVCV
After the recombinant expression plasmid pCI-Pdcd6ip and empty carrier pCI-neo transfects EPC cell for 24 hours, with MOI
=0.5 inoculation huichun viremia virus (SVCV), after infection 12h, collect with 36h experimental group and control group respectively for 24 hours
Supernatant carries out the measurement of SVCV virus titer.Specific steps are as follows:
The recombinant expression plasmid pCI-Pdcd6ip and empty carrier pCI-neo transfects EPC cell;
It after transfection for 24 hours, is washed twice with serum-free M199, huichun viremia virus (SVCV) is inoculated with MOI=0.5,20
DEG C absorption 1 hour, change the M199 containing 2%FBS into;
12h after infection, the supernatant for collecting experimental group and control group respectively with 36h for 24 hours, with virus RNA extraction kit (purchase
In Qiagen company) extract viral RNA;
Reverse transcription is carried out using reverse transcription reagent box (being purchased from Invitrogen company) and synthesizes cDNA;
Virus titer measurement is carried out using fluorescence quantifying PCR method.
Fluorescence quantification PCR primer sequence is as follows:
Forward primer: N-TF1:ATCAGGCCGATTATCCTTCCA;
Reverse primer: N-TR1:AGATAAGCATTCACATGCTGTAT;
10 μ L 2 × SYBR Premix Ex Taq (TAKARA company) are sequentially added in 200 μ L Fluorescence PCR pipes,
10 μm of ol/L forward primers of concentration, reverse primer each 0.4 μ L, 0.4 μ L ROX reference dye II and 100ng/ μ L are to be measured
The 2 μ L of cDNA of sample, supplement distilled water to 20 μ L, is placed in 7500Fast fluorescence quantitative PCR instrument and is reacted, reaction condition
For 95 DEG C of 30s;95 DEG C of 5s, 60 DEG C of 30s, 72 DEG C of 30s 40 circulations later, after, melting curve point is carried out by instrument immediately
Analysis calculates amplified production Tm value finally by 7500 2.0.6 software of ABI;To transfect cell 24 hours of empty carrier pCI-neo
Virus titer is set as 1, as shown in figure 5, Pdcd6ip is overexpressed the proliferation that can significantly inhibit virus, it is bright to show that Pdcd6ip has
Aobvious antiviral functions.
The present embodiment passes through the antiviral protein Pdcd6ip gene that gene clone technology is isolated from carp, can combine
PPXY structural domain present in SVCV viral matrix protein M may indicate that the present invention clones by a series of verification experimental verification
The expression of Pdcd6ip protein gene has excellent ntiviral characteristic, reduces SVCV infectivity, inhibits SVCV virus replication function
Can, its proliferation is influenced, is played an important role in the course of infection that cell resists SVCV.And the overexpression pair of Pdcd6ip
The influence of the cell activity of ordinary cells is also extremely low.Pdcd6ip albumen of the invention and its gene are to prepare anti-SVCV medicine
Object provides new target spot.
The preferred embodiment of the present invention has been described in detail above.It should be appreciated that the ordinary skill of this field is without wound
The property made labour, which according to the present invention can conceive, makes many modifications and variations.Therefore, all technician in the art
Pass through the available technology of logical analysis, reasoning, or a limited experiment on the basis of existing technology under this invention's idea
Scheme, all should be within the scope of protection determined by the claims.
Sequence table
<110>Shanghai Aquatic Product Institute
<120>the carp antiviral protein Pdcd6ip and antiviral activity separated
<130> 20190417
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 2610
<212> DNA
<213>carp (Cyprinus carpio)
<400> 1
atggcgacgt ttatttctgt cccgttgaaa aagtcctcag aggtggactt agcgaaaccg 60
ttgttgaaat ttgtaactgc cacgtatcct cccggtgagg agcaggcgga gtatgtccgt 120
gccgtggaag agctcaacaa gctccgcaaa agtgctctgg ggaggccgct ggacaaacac 180
gagagctcgc tggaaatcct gcttcgatat tatgatcagc tctgtgcaat cgaacccaaa 240
tttccttttc cagagttgtg tctgacattc acttggaaag atgcttttga taaaggatca 300
ctttttggag gatcagtaaa gcttgcattg gcaagtgtgg gctatgagaa gacgtgcgtg 360
ttgtttaatg tcggtgcgct ggcgggtcag cttgcttctg agcagaatct cgacaatgac 420
gaaggactta agactgccgc caagttctac cagctggcga gtggtgcatt tgctcatata 480
aaggacactg tgctgtctgc actgaatcga gagcccacca tggacatctc ccccgagacg 540
gtgggcacgc tcagtcagat catgctcagc caggcacagg aggtcttcgt tctcaaggcc 600
actgctgata agatgaagga cgccattgtc gctaaactcg ccaaccaggc agcagattac 660
tacggcgacg cttttaagca atgtcaatac aaagagaatc tgcccaagga agcgcttcca 720
gtcctggccg ccaagcactg tatgatgcag gccaccgccg agctgcacca gtcagccttg 780
gccaatcaga agaaaaagtt cggagaggag attgctcggc tgcagcacgc cacagagctg 840
gtgaagactg cggcttccag atacgatgag tacgttaacg taaaggatct gtcagataag 900
atcagtcgtg cgctcacggc tgcaaagaag gacaacgatt tcatttacca tgatcgtgtg 960
cccggagtca aagacctgga gcacattggc aaagcatctc tggtcaaagc aactgcagtg 1020
cagattccac tcagccagaa gttcacagat ctgtttgaga agatggtgcc gatggcagta 1080
cagcagtcag tgagcgcagc caattccagg aaggctgaca cagtcaacag attgattggc 1140
agcatgagag aagcaacaaa tctctgcaat ggggtgttgg cgtctttgaa tctgccggct 1200
gcactagaag atctgtcagg agacgctgtg cctcagtcca tcctggataa gagtcgtgca 1260
gttattcagc acggaggcct gcagaacatc gaacagctga ttcgagatct ccctgaactt 1320
ctgcagagga accgtgagat cctggatgag tccttgaaga tattagatga agaggaaacg 1380
acagacaatg aactcagagc taaattcaat cagcgctgga acagaactcc ctctggagat 1440
ctgtataaat cactcagagc agagggaaat aatttttgca atatactgga caaggcagtg 1500
caggctgatc aggtgatgaa agggcgttac aatgaacatt gtgggatgat tgctttgctc 1560
tgcaagccag agaatgagat cagtgccgcc ataccgtctg ccaaccctgc caagactctg 1620
cagggcagtg aggtggtgaa cgtgctgaga gctcagctgg cacagctgga tgaggtgaag 1680
agggaacggg aagttctgga gggagaggtg aaggcggtga cctttgacct gacgacaaag 1740
ttccttaccg cactcgctca agatggtgcc attaacgagg aggccatgac caccaatgag 1800
ctggacactc gctacggctc tcacacacaa cgtgttcagc agaacttgcg ccgacaggag 1860
gaactgctgt cacagataca ggtgtctcac caggagttct cagcactgaa gcaatccaac 1920
tctgaggcta atagcagaga ggaggtgtta aagaagcttg ctgcggccca tgatagctac 1980
atcgagatca gctccaatac caaagagggc actaaattct acaatgatct gacagaaatc 2040
ctgctgaagt ttcaaaataa gtgcagcgac attgtcttcg ctcgcaaaac tgagagggat 2100
gaactgctta aggagctgca gcagagcatc gctcgtgagc cgagcgctcc ttcattcaat 2160
gtcccatcat accagtccaa cacccctgct cctgtcccag gaggcccaac ccctgcaccc 2220
aggactgtgt ttaacgcgca gcggcctcag gctaagcccc agcccccagc gagaccacca 2280
cccccgagca tcactcctca ggctgccagt gcttcagctc cagtcagttc ttcgatgggt 2340
cccggaagca ctaatcctcc acctgttgca cccactggac cctcacaggc tcaaggacca 2400
ccctatccct cttatcaagg ctacccaggg tatccaggtt accagatgcc aatggcctat 2460
aacccctatg catacgggca gtttaatatg ccctacatgc cctatcaagc ccaggggcag 2520
gctgggtacc ctggagcccc tcctacacag cagccctacc cttaccccca acaaccccca 2580
cagcagcagc cctactaccc ccaacagtag 2610
<210> 2
<211> 869
<212> PRT
<213>carp (Cyprinus carpio)
<400> 2
Met Ala Thr Phe Ile Ser Val Pro Leu Lys Lys Ser Ser Glu Val Asp
1 5 10 15
Leu Ala Lys Pro Leu Leu Lys Phe Val Thr Ala Thr Tyr Pro Pro Gly
20 25 30
Glu Glu Gln Ala Glu Tyr Val Arg Ala Val Glu Glu Leu Asn Lys Leu
35 40 45
Arg Lys Ser Ala Leu Gly Arg Pro Leu Asp Lys His Glu Ser Ser Leu
50 55 60
Glu Ile Leu Leu Arg Tyr Tyr Asp Gln Leu Cys Ala Ile Glu Pro Lys
65 70 75 80
Phe Pro Phe Pro Glu Leu Cys Leu Thr Phe Thr Trp Lys Asp Ala Phe
85 90 95
Asp Lys Gly Ser Leu Phe Gly Gly Ser Val Lys Leu Ala Leu Ala Ser
100 105 110
Val Gly Tyr Glu Lys Thr Cys Val Leu Phe Asn Val Gly Ala Leu Ala
115 120 125
Gly Gln Leu Ala Ser Glu Gln Asn Leu Asp Asn Asp Glu Gly Leu Lys
130 135 140
Thr Ala Ala Lys Phe Tyr Gln Leu Ala Ser Gly Ala Phe Ala His Ile
145 150 155 160
Lys Asp Thr Val Leu Ser Ala Leu Asn Arg Glu Pro Thr Met Asp Ile
165 170 175
Ser Pro Glu Thr Val Gly Thr Leu Ser Gln Ile Met Leu Ser Gln Ala
180 185 190
Gln Glu Val Phe Val Leu Lys Ala Thr Ala Asp Lys Met Lys Asp Ala
195 200 205
Ile Val Ala Lys Leu Ala Asn Gln Ala Ala Asp Tyr Tyr Gly Asp Ala
210 215 220
Phe Lys Gln Cys Gln Tyr Lys Glu Asn Leu Pro Lys Glu Ala Leu Pro
225 230 235 240
Val Leu Ala Ala Lys His Cys Met Met Gln Ala Thr Ala Glu Leu His
245 250 255
Gln Ser Ala Leu Ala Asn Gln Lys Lys Lys Phe Gly Glu Glu Ile Ala
260 265 270
Arg Leu Gln His Ala Thr Glu Leu Val Lys Thr Ala Ala Ser Arg Tyr
275 280 285
Asp Glu Tyr Val Asn Val Lys Asp Leu Ser Asp Lys Ile Ser Arg Ala
290 295 300
Leu Thr Ala Ala Lys Lys Asp Asn Asp Phe Ile Tyr His Asp Arg Val
305 310 315 320
Pro Gly Val Lys Asp Leu Glu His Ile Gly Lys Ala Ser Leu Val Lys
325 330 335
Ala Thr Ala Val Gln Ile Pro Leu Ser Gln Lys Phe Thr Asp Leu Phe
340 345 350
Glu Lys Met Val Pro Met Ala Val Gln Gln Ser Val Ser Ala Ala Asn
355 360 365
Ser Arg Lys Ala Asp Thr Val Asn Arg Leu Ile Gly Ser Met Arg Glu
370 375 380
Ala Thr Asn Leu Cys Asn Gly Val Leu Ala Ser Leu Asn Leu Pro Ala
385 390 395 400
Ala Leu Glu Asp Leu Ser Gly Asp Ala Val Pro Gln Ser Ile Leu Asp
405 410 415
Lys Ser Arg Ala Val Ile Gln His Gly Gly Leu Gln Asn Ile Glu Gln
420 425 430
Leu Ile Arg Asp Leu Pro Glu Leu Leu Gln Arg Asn Arg Glu Ile Leu
435 440 445
Asp Glu Ser Leu Lys Ile Leu Asp Glu Glu Glu Thr Thr Asp Asn Glu
450 455 460
Leu Arg Ala Lys Phe Asn Gln Arg Trp Asn Arg Thr Pro Ser Gly Asp
465 470 475 480
Leu Tyr Lys Ser Leu Arg Ala Glu Gly Asn Asn Phe Cys Asn Ile Leu
485 490 495
Asp Lys Ala Val Gln Ala Asp Gln Val Met Lys Gly Arg Tyr Asn Glu
500 505 510
His Cys Gly Met Ile Ala Leu Leu Cys Lys Pro Glu Asn Glu Ile Ser
515 520 525
Ala Ala Ile Pro Ser Ala Asn Pro Ala Lys Thr Leu Gln Gly Ser Glu
530 535 540
Val Val Asn Val Leu Arg Ala Gln Leu Ala Gln Leu Asp Glu Val Lys
545 550 555 560
Arg Glu Arg Glu Val Leu Glu Gly Glu Val Lys Ala Val Thr Phe Asp
565 570 575
Leu Thr Thr Lys Phe Leu Thr Ala Leu Ala Gln Asp Gly Ala Ile Asn
580 585 590
Glu Glu Ala Met Thr Thr Asn Glu Leu Asp Thr Arg Tyr Gly Ser His
595 600 605
Thr Gln Arg Val Gln Gln Asn Leu Arg Arg Gln Glu Glu Leu Leu Ser
610 615 620
Gln Ile Gln Val Ser His Gln Glu Phe Ser Ala Leu Lys Gln Ser Asn
625 630 635 640
Ser Glu Ala Asn Ser Arg Glu Glu Val Leu Lys Lys Leu Ala Ala Ala
645 650 655
His Asp Ser Tyr Ile Glu Ile Ser Ser Asn Thr Lys Glu Gly Thr Lys
660 665 670
Phe Tyr Asn Asp Leu Thr Glu Ile Leu Leu Lys Phe Gln Asn Lys Cys
675 680 685
Ser Asp Ile Val Phe Ala Arg Lys Thr Glu Arg Asp Glu Leu Leu Lys
690 695 700
Glu Leu Gln Gln Ser Ile Ala Arg Glu Pro Ser Ala Pro Ser Phe Asn
705 710 715 720
Val Pro Ser Tyr Gln Ser Asn Thr Pro Ala Pro Val Pro Gly Gly Pro
725 730 735
Thr Pro Ala Pro Arg Thr Val Phe Asn Ala Gln Arg Pro Gln Ala Lys
740 745 750
Pro Gln Pro Pro Ala Arg Pro Pro Pro Pro Ser Ile Thr Pro Gln Ala
755 760 765
Ala Ser Ala Ser Ala Pro Val Ser Ser Ser Met Gly Pro Gly Ser Thr
770 775 780
Asn Pro Pro Pro Val Ala Pro Thr Gly Pro Ser Gln Ala Gln Gly Pro
785 790 795 800
Pro Tyr Pro Ser Tyr Gln Gly Tyr Pro Gly Tyr Pro Gly Tyr Gln Met
805 810 815
Pro Met Ala Tyr Asn Pro Tyr Ala Tyr Gly Gln Phe Asn Met Pro Tyr
820 825 830
Met Pro Tyr Gln Ala Gln Gly Gln Ala Gly Tyr Pro Gly Ala Pro Pro
835 840 845
Thr Gln Gln Pro Tyr Pro Tyr Pro Gln Gln Pro Pro Gln Gln Gln Pro
850 855 860
Tyr Tyr Pro Gln Gln
865
<210> 3
<211> 34
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 3
ttagctagcc accatggcga cgtttatttc tgtc 34
<210> 4
<211> 31
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 4
cggaattcct actgttgggg gtagtagggc t 31
<210> 5
<211> 37
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 5
ttagctagcc accatggatt acaaggatga cgacgat 37
<210> 6
<211> 37
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 6
ggatgacgac gataagatgg cgacgtttat ttctgtc 37
Claims (10)
1. a kind of isolated carp antiviral protein Pdcd6ip gene, which is characterized in that the nucleotides sequence of the Pdcd6ip gene
Column are sequences shown in 1-2610bp in SEQ ID NO:1.
2. a kind of isolated carp antiviral protein Pdcd6ip, which is characterized in that the amino acid sequence of the albumen Pdcd6ip coding
Column are sequences shown in SEQ ID NO:2.
3. the carp antiviral protein Pdcd6ip separated as claimed in claim 2, which is characterized in that the albumen Pdcd6ip tool
Having can be with the segment in conjunction with the PPXY structural domain in huichun viremia virus (SVCV) matrix protein.
4. a kind of recombinant expression plasmid of the nucleotide sequence comprising Pdcd6ip gene as described in claim 1.
5. a kind of preparation method for preparing recombinant expression plasmid as claimed in claim 4, which is characterized in that the method includes
Following steps:
Step 1: extracting the RNA of carp, RNA described in reverse transcription obtains the total cDNA of carp;
Step 2: the forward primer and reverse primer of design Pdcd6ip gene, the total cDNA of the carp obtained with the step 1
For template amplification, amplified production is obtained;
Step 3: the amplified production that the step 2 is obtained carries out molecular cloning, recombinant expression plasmid is obtained.
6. the preparation method of recombinant expression plasmid as claimed in claim 5, which is characterized in that the step 2 further includes expanding
Before increasing, also Nhe I, EcoR I restriction enzyme site need to be introduced respectively in the upstream and downstream of the total cDNA of the carp.
7. the preparation method of recombinant expression plasmid as claimed in claim 5, which is characterized in that the forward primer and described anti-
It is respectively pCI-Pdcd6ip-F and pCI-Pdcd6ip-R to primer, wherein the DNA sequence dna of the pCI-Pdcd6ip-F is TTAGCTAGCThe DNA sequence dna of CACCATGGCGACGTTTATTTCTGTC, the pCI-Pdcd6ip-R is
CGGAATTCCTACTGTTGGGGGTAGTAGGGCT。
8. the preparation method of recombinant expression plasmid as claimed in claim 5, which is characterized in that the amplified production is 2610bp
DNA fragmentation.
9. a kind of carp antiviral protein Pdcd6ip gene as described in claim 1 is preparing anti-huichun viremia virus medicine
Application in compositions.
10. a kind of carp antiviral protein Pdcd6ip as claimed in claim 2 is preparing anti-huichun viremia virus medicine group
Close the application in object.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910345517.7A CN110092823B (en) | 2019-04-26 | 2019-04-26 | Separated carp antiviral protein Pdcd6ip and antiviral activity |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910345517.7A CN110092823B (en) | 2019-04-26 | 2019-04-26 | Separated carp antiviral protein Pdcd6ip and antiviral activity |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110092823A true CN110092823A (en) | 2019-08-06 |
CN110092823B CN110092823B (en) | 2022-05-20 |
Family
ID=67446084
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910345517.7A Active CN110092823B (en) | 2019-04-26 | 2019-04-26 | Separated carp antiviral protein Pdcd6ip and antiviral activity |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110092823B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113698469A (en) * | 2021-06-21 | 2021-11-26 | 深圳大学 | Method and reagent for capturing host cell membrane-bound protein of SVCV |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104611343A (en) * | 2015-01-20 | 2015-05-13 | 华中农业大学 | Isolated antiviral natural immune protein TRIM32 (tripartite motif 32) for carps and antiviral activity |
CN109439638A (en) * | 2018-10-19 | 2019-03-08 | 华中农业大学 | A kind of isolated fish antivirus protein gene CMPK2 and its antiviral activity |
-
2019
- 2019-04-26 CN CN201910345517.7A patent/CN110092823B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104611343A (en) * | 2015-01-20 | 2015-05-13 | 华中农业大学 | Isolated antiviral natural immune protein TRIM32 (tripartite motif 32) for carps and antiviral activity |
CN109439638A (en) * | 2018-10-19 | 2019-03-08 | 华中农业大学 | A kind of isolated fish antivirus protein gene CMPK2 and its antiviral activity |
Non-Patent Citations (2)
Title |
---|
YU XIAO等: "Genomic evidence of homologous recombination in spring viremia ofcarp virus: A negatively single stranded RNA virus", 《VIRUS RESEARCH》 * |
张海强等: "鲤春病毒血症病毒核蛋白、磷蛋白与基质蛋白的表达、抗体制备及免疫原性比较", 《水产学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113698469A (en) * | 2021-06-21 | 2021-11-26 | 深圳大学 | Method and reagent for capturing host cell membrane-bound protein of SVCV |
Also Published As
Publication number | Publication date |
---|---|
CN110092823B (en) | 2022-05-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110128550B (en) | Novel replicative oncolytic adenovirus capable of simultaneously blocking immune check points PD-L1 and TIGIT and application | |
CN111560354A (en) | Recombinant novel coronavirus and preparation method and application thereof | |
CN106282216B (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
CN113512096B (en) | Weever rhabdovirus recombinant G2 protein and application thereof | |
CN104962581B (en) | A kind of recombinant viral vaccine strain for expressing African swine fever virus p72 albumen | |
CN107841507A (en) | A kind of porcine circovirus 2 type Cap cell-penetrating peptides antigen-4 fusion protein gene of high efficient expression and its application | |
CN101186637A (en) | Method for inhibiting influenza virus infection and medicament thereof | |
CN101586120B (en) | Rabies virus Flury-LEP vaccine strain reverse genetic operating system and LEP green fluorescent protein recombination viral vector | |
CN110092823A (en) | Isolated carp antiviral protein Pdcd6ip and antiviral activity | |
CN111793721B (en) | Application of eEF1D protein in preparation of drugs for preventing or treating foot-and-mouth disease virus infection | |
CN108715866A (en) | A kind of recombinant viral vector, vaccine and the preparation method and application thereof | |
CN112587660A (en) | Application of Seneca valley virus 3D protein as immune inducer or adjuvant | |
CN104611343B (en) | The carp antiviral natural immune protein TRIM32 and antiviral activity of separation | |
CN102526718B (en) | Recombinant H5N1 (Hemagglutinin 5 Neuraminidase 1) avian influenza virus cell vaccine and application thereof | |
CN110295173B (en) | Isolated carp antiviral protein Rhbdd3 and antiviral activity thereof | |
Chen et al. | Development and evaluation of nucleoprotein-based rapid detection test for Siniperca chuatsi rhabdovirus | |
CN110747231A (en) | Construction of ribosome inactivating protein gene virus vector and method for expressing active protein in tumor cell | |
CN109867713A (en) | A kind of canine distemper genetic engineering subunit vaccine | |
CN106119287B (en) | A kind of recombinant vector and method for expressing respiratory syncystial virus F protein | |
CN110904056B (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
CN104151402B (en) | Viral myocarditis cyclic peptide vaccine and preparation method thereof | |
CN103555679A (en) | Enhanced green fluorescent protein recombinant H5N1 subtype influenza virus and its application | |
CN109439638B (en) | Separated fish antiviral protein gene CMPK2 and antiviral activity thereof | |
CN110240650A (en) | The monoclonal antibody and its preparation method and application of anti-flounder rhabdovirus G-protein | |
CN109402117A (en) | A kind of adeno-associated virus and its preparation method and application of silencing mouse intestinal RASGRP1 expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CP01 | Change in the name or title of a patent holder |
Address after: 200433 No. 265, Jiamusi Road, Shanghai, Yangpu District Patentee after: SHANGHAI FISHERIES Research Institute SHANGHAI FISHERIES TECHNICAL EXTENSION STATION Address before: 200433 No. 265, Jiamusi Road, Shanghai, Yangpu District Patentee before: SHANGHAI FISHERIES Research Institute |
|
CP01 | Change in the name or title of a patent holder |