CN112587660A - Application of Seneca valley virus 3D protein as immune inducer or adjuvant - Google Patents

Abstract

The present invention is in the field of viral immunology and in particular relates to novel functions of the 3D protein of SVA, such as: the 3D protein can be used as an activator of inflammation signal transduction mediated by NLRP3, and the 3D protein activates the production and secretion of IL-1 beta. Meanwhile, the 3D protein is found to interact with the NATCH domain of NLRP3 through the N-terminal 1-154aa of the protein, and the IL-1 beta production and secretion mediated by NLRP3 inflammasome in cells are activated in a mode of regulating the intracellular concentration change of calcium ions and potassium ions. The invention provides a new target and theoretical support for prevention and control of SVA and activation of inflammatory reaction by using 3D protein as an adjuvant.

Description

Application of Seneca valley virus 3D protein as immune inducer or adjuvant

Technical Field

The invention belongs to the field of biotechnology and the field of virus immunology, and particularly relates to SVA (A), (B), (C), (SenecavirusA) The new function of the protein 3D, namely the SVA 3D protein can induce the secretion of IL-1 beta, finally leads to the reduction of SVA virus replication and plays a role in promoting immune response.

Background

Inflammation is part of the body's natural healing process, but when it becomes chronic, it can lead to cancer, alzheimer's disease and other diseases. Inflammasome (inflmamotome) triggers inflammation in response to different signals produced by cellular stress, tissue damage, or infectious agents. Interleukin 1 (IL-1 β) is an inflammatory cytokine or hormone, a secreted protein, usually produced by macrophages, that plays a key role in the host antiviral immune response. Both the beneficial and adverse effects of inflammation are triggered by IL-1 β. Under normal circumstances, IL-1 β is produced in very low amounts, but the production of IL-1 β is highly increased when responding to tissue injury, environmental stress, infection or chronic inflammation. The secretion of IL-1 beta can promote the expression of a large number of acute proteins and also participate in the local immune regulation of the body, such as promoting the growth and differentiation of B cells and the formation of antibodies; promoting the antigen presenting capability of monocytes and the like, the treatment targeting the IL-1 beta pathway has been successfully applied to the clinical treatment of a plurality of virus infections, such as in the process of treating dry eye, the symptoms related to the dry eye and ocular surface diseases can be remarkably reduced by locally applying antagonist medicines targeting IL-1; gout can also be treated clinically by inhibiting the IL-1 pathway. In the virus-induced response process of IL-1 beta, an organism responds to virus stimulation, and an NF-kB signal path is activated through a pattern recognition receptor signal path, so that IL-1 beta precursor is generated, namely a signal 1; simultaneously, the virus induces the activation of the inflammasome, such as the activation of the NLRP3 inflammasome, the activation process comprises the steps that NLRP3 and ASC form a complex, then the complex is combined with a Caspase1 precursor and forms mature Caspase1, the mature Caspase1 cuts the IL-1 beta precursor, and finally the mature IL-1 beta is formed and secreted to the outside of cells to generate inflammatory response.

To combat the host's moderate immune defenses, viruses have acquired a myriad of strategies, one of which is directed to the signaling pathway produced by IL-1 β, including inhibition of inflammasome activation and activation of inflammasomes such that they become overactivated. For example, the genome of poliovirus (EV 71) is able to activate the NLRP 3-induced secretion of IL-1 β. NS5 of Zika virus (Zika) as a nonstructural protein is able to activate NLRP3 inflammasome by binding to LRRs and NACHT domain of NLRP 3. The 2B protein of EMCV is also involved in activating NLRP3 inflammasome-mediated secretion of IL-1 β. A number of viral proteins also inhibit activation of the NLRP3 inflammasome, such as the NS1 protein of influenza virus, which uses its N-terminal structure to inhibit the expression of IL-1 β and IL-18. The measles virus V protein binds to the C-terminus of NLRP3, thereby preventing NLRP 3-mediated secretion of IL-1 β. The 2A and 3C proteins of EV71 inhibit the expression of IL-1. beta. by degrading NLRP 3.

The Seneca virus disease is an animal infectious disease caused by the type A Seneca virus, mainly infects pigs, and is susceptible to pigs of different ages. In early 2015, blistering diseases caused by seneca virus were first developed in brazil, thailand and china. In the same year, studies have found that viral infection is associated with neonatal piglet mortality. SVAs belong to the family of RNA viruses (Picornaviridae) and have the typical characteristics of the small RNA viral genome, whose genomic RNA consists of approximately 7200 nucleotides (nt). The viral genome has only one Open Reading Frame (ORF), encoding a polyprotein of about 2180 amino acids. Consists of leader protein (L), P1 (four structural proteins of cleaved VP1, VP2, VP3 and VP 4), P2 (cleaved into three non-structural proteins of 2A, 2B and 2C) and P3 (cleaved into four non-structural proteins of 3A, 3B, 3C and 3D). The 3D protein is an important viral protein of SVA, and is the viral polymerase. Meanwhile, 3D protein is also involved in binding host factors, but the research is less, for example, 3D protein of SVA of the same family can interact with host factors such as Sam68, DDX1 and the like, the specific mechanism is not clear, and the research of the involvement of SVA 3D protein in immune and inflammatory reactions is blank at present.

Disclosure of Invention

The present invention reveals a novel function of the 3D protein of SVA, namely, 3D protein first activates NF-kB phosphorylation, and then activates NLRP3 inflammasome by changing intracellular calcium and potassium ion concentrations and binding NACHT domain of NLRP3, finally leading to the maturation and secretory degradation of IL-1 beta.

After the lentivirus expression system of the 3D protein constructed by the invention is inoculated to a mouse, the secretion and the generation of IL-1 beta are obviously increased, the mouse dies after 7 days, and different mouse tissues show congestion and swelling. The results indicate that excessive 3D protein can induce the development of inflammation and cause organ damage. Meanwhile, when the same dose of the lentivirus is inoculated to a host animal (pig, 90 days old), the tissues of the animal have no obvious lesion, but the expression level of the IL-1 beta is obviously increased. Indicating that low doses of 3D can also induce an inflammatory response. The invention provides a new visual angle for controlling virus-induced inflammatory reaction and designing 3D inhibiting drugs, and simultaneously, in the vaccine design, SVA 3D protein is used as an inducer or adjuvant to promote the immune response of an organism, so that the antibody is better generated and used as a theoretical bedding.

Wherein, the amino acid sequence of the 3D protein is shown as SEQ ID NO. 1.

The invention constructs a 3D gene lentivirus expression system, and the construction strategy is as follows:

(1) amplifying a fragment containing a 3D gene by using primers 1F and 2R by using SVA virus as a template, connecting the fragment with a pMD 20T vector to obtain a positive clone PMD-3D, and sequencing the Senhua big gene to show the correctness;

wherein the amplification of the primer containing the 3D gene:

1F：5'-ataggtttaattaatgttaagcgtctg-3' （SEQ ID NO:2）；

1R：5'-gtctgtggatccctcgttggagcc-3'（SEQ ID NO:3）；

(2) performing double enzyme digestion on PMD-3D, and connecting to a lentiviral vector (pHBLV-Zsgreen-puro);

(3) the lentivirus vector is subjected to virus packaging, and r-lenti-3D is obtained.

Packaging of empty vector lentivirus (empty-lenti) is the same as packaging strategy of 3D gene overexpression lentivirus.

The 3D protein of SVA is combined with the NATCH structure domain of NLRP3 through the N end (1-154 aa), and the IL-1 beta production and secretion mediated by NLRP3 inflammasome is activated by changing the concentration of potassium ions and calcium ions in cells, and the specific identification process is as follows:

(1) construction of recombinant plasmids such as 3D-12 (DELTA 309-463 aa), 3D-13 (DELTA 154-309 aa), 3D-23 (DELTA 1-154aa), NATCH, NLRP3, PYD, LRR, pro-Caspase-1, pro-IL-1 beta, ASC and the like for the 3D gene and other related genes of SVA;

wherein the nucleotide sequence of the 3D gene is shown as SEQ ID NO. 4, and the nucleotide sequences of the 3D-12 (Delta 309-463 aa), the 3D-13 (Delta 154-309 aa), the 3D-23 (Delta 1-154aa), the NLRP3, the pro-Caspase-1, the pro-IL-1 beta and the ASC gene are respectively shown as SEQ ID NO. 5-11.

(2) The 3D and 3D deletion mutants flag-3D-12 (Delta 309-463 aa), flag-3D-13 (Delta 154-309 aa), and flag-3D-23 (Delta 1-154aa) gene recombination vectors are co-transfected with empty vectors, NLRP3, PYD, LRR, or pro-Caspase-1, pro-IL-1 beta, ASC, etc., respectively, and partial results are treated with different signal pathway activation or inhibitors or markers, which have different action pathways.

(3) The mode of action of the 3D protein to activate NLRP3 is judged by the pathway of action of the activator or inhibitor or marker: 3D activates NLRP3 inflammatory bodies by changing the concentration changes of calcium and potassium ions in cells. This is a new function of SVA 3D.

The invention discovers that in a mouse body, after 3D protein overexpression, the mouse dies in 7 days, animal tissues are congested and swollen, and meanwhile, the IL-beta expression level in the serum and the tissues of the mouse is obviously increased after the 3D protein overexpression. After the 3D protein is over-expressed in the pig body at the same dosage, the animal tissues have no obvious lesion, the animals have no disease, but the IL-beta expression level of the serum and the animal tissues is obviously increased. This suggests that 3D protein activates IL- β production and secretion after high dose expression of the 3D gene, possibly leading to the generation of inflammatory storms. After 3D overdose, the compound can induce the generation and secretion of IL-beta in serum and tissues, but can not cause the pathological changes and the morbidity of animal tissues.

The invention has the following beneficial effects:

the invention discovers that 3D protein of SVA can induce NF-kB activation and activate IL-1 beta secretion by combining NLRP 3. The invention provides a theoretical basis for further clarifying the gene function of SVA and a new function of 3D, and meanwhile, the discovery can provide a new visual angle for virus-induced inflammatory reaction and 3D inhibition drug design, and meanwhile, in the vaccine design, SVA 3D protein is used as an inducer or adjuvant for promoting the immune response of an organism, so that the SVA 3D protein can be used as a theoretical bedding for better generating antibodies.

The invention further discloses a new function of SVA 3D protein, and clarifies that the pathogenesis of the inflammatory reaction of the organism caused by SVA is probably due to 3D activation of IL-1 beta signal channel mediated by NLRP3 inflammasome.

The detailed technical scheme and the invention effect are described in the detailed description of the specific embodiments.

Drawings

FIG. 1 SVA induces IL-1 β secretion.

FIG. 2 SVA activates NLRP3 inflammasome and induces production of IL-1 β.

FIG. 3 SVA activates NLRP3 inflammasome by NF-. kappa.B first signal.

FIG. 4 both the RNA and SVA proteins of SVA are involved in the activation of NLRP3 inflammasome.

FIG. 5 SVA 3D protein promotes activation of NLRP3 inflammasome.

Fig. 6 SVA 3D protein activates NLRP3 inflammasome by binding to the NACHT domain of NLRP 3.

FIG. 7 r-lenti-3D, empty-lenti, mortality after mice inoculated with DMEM, ELISA detection of serum IL-1 β and changes in mRNA expression levels of IL-1 β in animal tissues and phenotypic and pathological changes in animal tissues.

FIG. 8 shows ELISA detection of IL-1. beta. in serum after inoculation of pig with r-lenti-3D, empty-lenti, DMEM and changes in mRNA expression level of IL-1. beta. in animal tissues.

Detailed Description

The SVA virus and the Sendai virus used in the examples are all conventional wild strains and are preserved in the Lanzhou veterinary research institute of Chinese academy of agricultural sciences. The invention can also be realized by SVA virus wild strains and Sendai virus wild strains obtained by the public through other ways.

In the examples, mice were purchased from the Lanzhou veterinary institute of Chinese academy of agricultural sciences, and pigs were purchased from Captain-En-Xin Living pig Breeding, Inc., of Kangle county, and were subjected to security quarantine.

The other cells and reagents used were all commercially available products.

Example 1 plasmid construction

(1) SVA Total RNA extraction

Adding 500 mu L of virus into 1mL of TRIzol, blowing, mixing uniformly, and standing for 5 minutes at room temperature.

Adding 250 mu L chloroform, violently shaking for 15s, placing for 10min in ice bath, and centrifuging for 15min at 4 ℃ and 12000 rpm; the supernatant was aspirated, an equal volume of isopropanol was added to a new centrifuge tube, and the tube was gently inverted 10 times. The mixture was allowed to stand at room temperature for 10 minutes.

Centrifuging at 12000 rpm for 10min at 4 ℃; the supernatant was discarded, 1mL of 75% ethanol was added, and the mixture was washed by gentle inversion.

Centrifuging at 12000 rpm for 5min at 4 ℃; the supernatant was discarded and dried in a clean room (20 min). Adding 40 mu L DEPC water, and promoting the dissolution of RNA 10-15 min at 65 ℃. Storing at-80 deg.C for use.

(2) Obtaining viral cDNA

The cDNA was synthesized by reverse transcription using a reverse transcription kit from Promega according to the protocol. The method comprises the following specific steps:

preparing a reaction system (20 mu L system in total):

5×Buffer 4 μL

10 mM dNTPs 1 μL

Random Primers 1 μL

oligo-dT Primers 0.5 μL

M-MLV transcriptase 1 μL

RRI 0.5 μL

H₂O 6 μL

RNA 4 μL

reaction procedure: 10 minutes at 65 ℃; ice-bath for 5min at 37 deg.C for 90 min; 10 minutes at 75 ℃.

(3) Amplification of a fragment of the CDS-encoding nucleotide sequence of the SVA 3D gene

Primers were designed to amplify the 3D gene with reference to the SVA 3D gene sequence provided in GenBank. An upstream primer: 5'-TATCTCGAGTTATGGAGCTGCGAC-3' (containing XhoI and EcoRI cleavage sites), downstream primer: 5'-ACAAAGCTTGTCCAGGGAGAGGTC-3' (containing HindIII and BamHI cleavage sites), and amplifying to obtain a 3D gene fragment.

The amplification system was as follows (total 50. mu.L system):

10× PCR Buffer 5 μL

2.5 mM dNTPs 5 μL

upstream primer 1. mu.L

Downstream primer 1. mu.L

primerstar 1 μL

H₂O 35 μL

cDNA template 2. mu.L

Reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 seconds, annealing at 57 ℃ for 30 seconds, extension at 72 ℃ for 2 min 30 seconds, and 35 cycles; extension at 72 ℃ for 10min and storage at 4 ℃.

Then, the resulting mixture was subjected to nucleic acid electrophoresis, and the SVA 3D gene amplified fragment was purified and recovered by using a DNA purification and recovery kit of Promega.

The purified DNA and the pcDNA3.1 vector were digested with XhoI and HindIII enzymes at 37 ℃ for 30 min.

The double enzyme digestion system is as follows:

10× M Buffer 2 μL

XhoI 0.5 μL

HindIII 0.5 μL

DNA (or vector) 0.5. mu.g

H₂O is supplemented to the total volume of 20 mu L

Reaction procedure: 30min at 37 ℃.

Then, the resulting mixture was subjected to nucleic acid electrophoresis, and the digested product was recovered using a DNA purification and recovery kit (Promega). Connecting the recovered products, wherein the reaction system and the procedure are as follows:

T4 DNA Ligase 1 μL

10× Ligase Buffer 1 μL

enzyme digestion purification plasmid fragment 0.5 u L

Enzyme digestion purification of 5. mu.L of 3D gene fragment

ddH₂O was supplemented to 10. mu.L and ligated overnight at 16 ℃.

The ligation product is transformed by DH-5 alpha, a monoclonal colony is picked up, the colony is cultured by using LB liquid culture medium containing ampicillin resistance, a recombinant plasmid is extracted by using a Promega plasmid extraction kit, and the recombinant plasmid is sent to Huamao Gen Co.

The other needed protein genes NLRP3, ASC, Pro-Caspase-1 and Pro-IL-1 beta are constructed by amplification sequencing according to a similar method.

NLRP3 ：

An upstream primer: 5'-ATGAGCATGGCAAGCGTCC-3' the flow of the air in the air conditioner,

a downstream primer: 5'-CTACTGGGAAGGCTCAAAGACAA-3', respectively;

pro-Caspase-1：

an upstream primer: 5 '-5' ATGGCCGACAAGGT 3'-3',

a downstream primer: 5'-TTAATGTCCTGGGAAGAGGT-3', respectively;

ASC：

an upstream primer: 5'-ATGCCAGCTCTGCCCCTGGA-3'

A downstream primer: 5'-TCAGGATGGGATCATGCCTTTGCTC-3', respectively;

pro-IL-1β:

an upstream primer: 5 'ATGGCAGAAGTACCTGAGCTCG 3'

A downstream primer: 5 'TTAGGAAGACACAAATTGCATGGTGA 3'.

SVA induces secretion of IL-1 β:

before SVA inoculation, nutrient solution of BMDM cells, PK15 cells or THP-1 cells is discarded, ice-cold PBS is used for washing, then SVA is infected, after 1h of infection, PBS is used for washing three times, 1% nutrient solution is added for culture, and cell samples to be detected are collected at different time points. When a cell sample was collected, cells were washed with ice-cold PBS, then lysed with a cell lysate, and the lysed sample was sonicated for 1 minute (10 s intervals) at 4 ℃ and 10 minutes at 12000 rpm, and the pellet was discarded, and the supernatant was retained. Protein concentration was measured using the BCA method (cloudband BCA reagent). Adding 5 × loading buffer into the protein sample, boiling for 10min, quickly separating at high speed, taking a proper amount of supernatant, and performing protein electrophoresis and Western lot, wherein as shown in figures 1B-H, compared with a control mock, after SVA infection, the protein expression of IL-1 beta can be induced to be up-regulated.

Example 2 SVA activation of NLRP3 inflammasome in turn induces production of IL-1 beta

THP-1 macrophages or PK-15 cells were infected with SVA for 1h with 2. mu.M nigericin (stimulator of Nigercin, NLRP 3) or VX-765 (Casp-1 inhibitor), or with SVA after 1h treatment with VX-765 and Nigercin, or with SVA after 1h treatment with VX-765. The expression levels of IL-1. beta. and IL-1. beta. precursor were measured by ELISA and Western blot, and the results are shown in A-B and D-E in FIG. 2. The results show that: when SVA is infected, the Caspase-1 inhibitor can inhibit the secretion and protein expression of IL-1 beta induced by SVA, which indicates that the generation of IL-1 beta induced by SVA is through the Caspase-1 pathway.

HEK293 cells overexpress shRNAs expression plasmids targeting NLRP3 and were treated with dimethyl sulfoxide or nigericin or infected with SVA. ELISA and Western blot were used to detect IL-1. beta. levels or IL-1. beta. precursor expression, and the results are shown in FIG. 2, C and F. The results show that: IL-1 β secretion and protein expression decreased after SVA infection of cells interfered with shRNA targeting NLRP3, suggesting that SVA induces NLRP3 mediated IL-1 β production.

In FIG. 2, G is the result of confocal microscopy of HEK293 cells infected with SVA. Confocal microscopy examined NLRP3, ACS (green) and SVA (red) subcellular localization. Specifically, HEK293 cells infected with SVA are fixed by 4% paraformaldehyde, then are blocked by BSA, after 1h, the cells are penetrated, after 30min, corresponding primary antibodies are added for incubation, then secondary antibodies with different markers are combined with the primary antibodies, and after cell nuclei are stained by DAPI, the cells are observed by a fluorescence microscope. The results show that: SVA is able to co-localize with NLRP3 and ASC proteins in the cytoplasm. This provides a context for SVA to induce IL-1 β production via NLRP 3.

In FIG. 2, H is the result of SVA infection or nigericin treatment of THP-1 macrophages or PK-15 cells. And detecting the ASC proto-antibody oligomeric spots by using Western blot. The results show that: cells treated with nigericin or infected with SVA can cause ASC to generate oligomerization, which is an important index for activation of NLRP3, and thus, SVA can induce the formation of NLRP 3-mediated ASC complex and finally induce the generation of IL-1 beta.

This example shows generally: SVA is capable of inducing IL-1 β secretion and protein expression, while SVA leads to activation of the IL-1 β signaling pathway by inducing the formation of NLRP3-ASC complex.

Example 3 SVA activates NLRP3 inflammasome by NF-. kappa.B first signal, while simultaneously activating NLRP3 inflammasome by inducing concentration changes of potassium and calcium ions

HEK293 cells were transfected with the NF-. kappa.B luciferase reporter plasmid or in combination with the 3D expression plasmid, and 24h later, the cells were infected with Sendai virus (SeV, Sendai virus) or SVA. After cell lysis, a dual-luciferase reporter gene system is adopted to detect the activation times of NF-kB promoters, a qPCR method is adopted to detect the mRNA expression level of NF-kB, and Western blot is adopted to detect the phosphorylation level of NF-kB.

As shown in FIGS. 3A and 3B, SVA can induce NF-. kappa.B activation (FIG. 3A), and 3D protein can activate NF-. kappa.B activity alone, while enhancing NF-. kappa.B activity induced by viruses such as SVA (FIG. 3B).

FIG. 3C shows that SVA does not induce changes in reactive oxygen species but 3D inhibits the production of reactive oxygen species by infecting HEK293 cells at different time points or transfecting HEK293 cells with SVA 3D protein and treating with MitoSOX. This indicates that SVA does not induce IL-1 β production by a pattern of reactive oxygen species elevation.

FIG. 3D shows that after SVA infection of HEK293 cells, treatment with Mito-TEMPO, an antioxidant, inhibits ROS as an inhibitor of NLRP3, indicating that SVA infection does not alter IL-1 β secretion. This indicates that SVA does not induce IL-1 β production by a pattern of reactive oxygen species.

FIG. 3E shows that after SVA infection of HEK293 cells, treatment with Ca-074-Me, which is an inhibitor of cathepsin B, showed that SVA infection did not alter IL-1 β secretion. This indicates that SVA does not induce IL-1 β production by the pattern of cathepsin B.

FIGS. 3F and 3G show that SVA infection and 3D expression promote an increase in Calcium ion concentration (F) and IL-1 β production is reduced when Calcium ions are sequestered, by transfecting HEK293 cells with SVA or 3D plasmid, staining with Fluo-Calcium (F), or treating the cells with BAPTA-AM cell-permeable Calcium chelator (G). This indicates that SVA and 3D proteins induce an increase in the concentration of calcium ions, which in turn induces activation of NLRP3 inflammasome and ultimately an increase in IL-1 β secretion.

FIGS. 3H and 3I show SVA-infected or 3D plasmid-transfected HEK293 cells with different concentrations of KCl and CaCl, respectively₂The treatment showed that the production of IL-1. beta. decreased with increasing potassium ions and that the production of IL-1. beta. was up-regulated with increasing potassium ions.

Taken together with the results of example 3, SVA or 3D were able to induce the activation of NF-. kappa.B, which in turn triggered the generation of the first signal of NLRP3, while SVA or 3D proteins induced the activation of NLRP3 inflammasome by inducing an efflux of potassium ions and an influx pattern of calcium ions.

Example 4 RNA translation products of SVA activate NLRP3 inflammatory bodies and thereby induce IL-1 β production

(1) Porcine BMDM, PBMC, PK-15 and THP-1 cells were treated with 2. mu.M nigericin or inoculated with UV-inactivated SVA, heat-inactivated SVA or infected SVA, respectively; or transfecting SVA-RNA or PK-15 cells with poly (dA: dT) alone for 24h in a dose-dependent manner, and detecting IL-1 beta levels by ELISA, qPCR and Westernblot; or treating PK-15 and THP-1 cells with 2 μ M nigericin for 2h and 100 μ M CHX for 1h, or infecting SVA for 24h and 100 μ M CHX for 1h, and detecting IL-1 β level by ELISA and qPCR after 24 h. The specific detection method refers to the specification of the Bio-ray mouse or pig source ELISA detection reagent. As shown in FIGS. 4A and 4B, when SVA virus is subjected to UV and heat treatment, IL-1 β secretion and mRNA expression level upregulation cannot be induced, indicating that SVA infection and RNA replication or transcription are required for SVA induction. As shown in FIGS. 4D-4F, when cells infected with SVA virus were subjected to CHX treatment, SVA was unable to cause IL-1 β production, indicating that translation of SVA is required for induction of IL-1 β secretion and expression. Meanwhile, as shown in FIG. 4C, it was found that when RNA of SVA was transfected, IL-1. beta. production could be induced. This suggests that when viral RNA is transferred into cells, it can be transcribed to form mRNA for protein formation, and ultimately induce IL-1 β production.

Example 4 Overall, SVA may require the involvement of its viral proteins to induce IL-1 β production.

Example 5 SVA 3D protein promotes the activation of NLRP3 inflammasome

In FIG. 5, A-B are NLRP3, ASC, Pro-Casp1 and Pro-IL-1. beta. plasmids co-transfected with HEK293 cells with plasmids expressing different SVA proteins. The ELISA method and the qPCR method are used for detecting the IL-1 beta level, and the specific method refers to the specification of a Bio-ray ELISA detection kit. As shown in FIGS. 5A and 5B, the 3D protein from SVA was selected to induce secretion of IL-1 β (A) and upregulation of mRNA expression (B).

FIGS. 5C and 5D show that 3D protein of SVA is able to induce secretion of IL-1 β (C) and upregulation of mRNA expression (D) in PK-15 cells, and is dose-dependent.

FIG. 5E demonstrates that the 3D protein of SVA is able to induce oligomerization of ASC.

The results of example 5 indicate that the 3D protein of SVA has the ability to induce the secretion and expression of IL-1 β.

Example 6 SVA 3D protein utilizes the amino terminus (1-154 aa) to bind to the NACHT domain of NLRP3 to activate NLRP3 inflammatory bodies

(1) FIG. 6-A is a graph showing the results of transfection of HEK293 cells with myc-NLRP3, myc-Caspase-1, or ASC in combination with flag-3D, and detection of cell lysates by SDS-PAGE. The results show that the 3D protein can induce the expression of NLRP3 protein to be up-regulated.

(2) HEK293 cells were transfected with Flag-3D and the myc-NLRP3 or myc-NACHT domain of NLRP3, and cell lysates were subjected to IP (co-immunoprecipitation) treatment with IgG, anti-myc or anti-Flag primary antibodies, as shown in FIGS. 6B and 6C, which indicated that the 3D protein interacted with the NATCH domain of NLRP 3.

D-F in FIG. 6 is the division of the 3D gene into 3 fragments of average length, each of which is deleted separately. The identification is flag-3D-12 (delta 926-1389 bp), flag-3D-13 (delta 463-926 bp), and flag-3D-23 (delta 1-463 bp). Deletion mutants were co-expressed with NLRP3, respectively. After 24 hours, the protein samples were IP treated with the relevant antibodies and detected with a western blot. The results show that: the N-terminus (1-154 aa) of the 3D protein of SVA is capable of binding to NLRP 3.

This example shows that 3D protein activates NLRP3 inflammatory bodies by binding the amino terminus (1-154 aa) of the protein to the NACHT domain of NLRP 3.

Example 7 challenge with SVA strains and determination of IL-1 beta and serum virus neutralization titers in animals thereof

1. Animal toxicity attacking experiment

DMEM, r-lenti-3D and empty-lenti are used for injection at the tail vein part of the mouse, after inoculation, the pathogenesis condition is observed in 0-7 days respectively, and serum and tissue samples are collected. As shown in FIG. 7A, after the mice were inoculated with 3D gene-containing lentivirus (r-lenti-3D), the mice all died for seven days, and the controls all survived. FIG. 7B shows that, following 3D gene expression, there was significant hyperemia and swelling of the mouse tissue.

Using DMEM, SVA strains (3X 10)⁹Copy number/head), r-lenti-3D, empty-lenti, intramuscular injection is carried out on the inner side of the thigh of a pig (90 days old), after inoculation, the body temperature morbidity of the animal is observed within 0-7 days, and meanwhile, serum or tissue samples are collected, and the mortality is counted.

2. (1) ELISA detection of IL-1. beta. in animal sera or tissues

The collected blood samples were incubated at 37 ℃ for 30 minutes, then incubated at 4 ℃ overnight for agglutination, centrifuged at 2000rpm for 10 minutes, and the supernatants collected at-80 ℃ until use. And detecting the content of IL-1 beta in the serum of the inoculated animal.

As shown in FIG. 1A, IL-1 β secretion in porcine serum was up-regulated after porcine vaccination with SVA.

As shown in FIG. 7D and FIGS. 8A-D, after animals were inoculated with 3D, inoculation of the 3D group induced the secretion and protein expression of IL-1 β and the expression level of IL-1 β mRNA in serum and tissues up-regulated relative to the control group. This demonstrates that 3D is capable of inducing IL-1 β mediated inflammatory responses at the animal level.

After the different tissues of the animals were sectioned and stained, as shown in fig. 7C, mice inoculated with 3D protein were able to induce partial tissue infiltration. However, as shown in fig. 8E, the tissues of 3D-inoculated pigs showed no significant change compared to the control. This is probably due to the low lentiviral expressed 3D protein content in pigs relative to mice.

(2) SVA Virus Titer assay

Repeatedly freezing and thawing cells infected with SVA for three times, filtering lysate, diluting SVA according to 10-fold gradient, inoculating a 96-well plate cultured with IBRS2 cells, observing cytopathic condition every day, recording and calculating TCID50 of SVA, and collecting the cell toxin for later infection experiments.

(3) Animal tissue IL-1 beta expression assay

Animal tissues collected for 7 days, such as Peripheral Blood (PBMC), spleen, kidney, heart, lung tissue, were used for virus content and mRNA for IL-1. beta. and ELISA. Adding erythrocyte lysate into PBMC, lysing for 10min, centrifuging for 5min at 500 Xg, discarding supernatant, washing the precipitate for 3 times with PBS, centrifuging for 5min at 500 Xg, extracting RNA, performing reverse transcription, and detecting SVA virus content and mRNA expression level change of IL-1 beta. Animal tissue is taken, 1 cubic centimeter tissue is ground, PBS is used for washing and collecting ground cells, RNA is extracted, and mRNA expression level change of IL-1 beta is detected after reverse transcription. Meanwhile, the protein content of the IL-1 beta is detected by using a kit for the supernatant collected after grinding.

As shown in FIGS. 7 and 8, the serum IL-1. beta. levels of the 3D-overexpressed vaccinated animals were significantly increased, and the levels of IL-1. beta. and mRNA expression levels of peripheral blood lymphocytes, spleen, lung, heart, and kidney were also significantly increased, as compared to vaccinated animals without 3D expression.

The results of all the above examples show that SVA 3D protein can significantly contribute to the level of IL-1 β inflammatory response mediated by NLRP3 by activating the NF-KB "first signal", by binding to the NATCH domain of the NLRP3 protein and altering intracellular potassium and calcium ion concentrations. This conclusion was also confirmed at the animal level.

The above embodiments are merely preferred embodiments of the present invention, and not intended to limit the scope of the invention, so that equivalent changes or modifications made based on the structure, characteristics and principles of the invention should be included in the claims of the present invention.

SEQUENCE LISTING

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> application of Seneka valley virus 3D protein as immune inducer or adjuvant

<130> do not

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 462

<212> PRT

<213> Senecavirus A

<400> 1

Gly Leu Met Thr Glu Leu Glu Pro Gly Val Thr Val His Val Pro Arg

1 5 10 15

Lys Ser Lys Leu Arg Lys Thr Thr Ala His Ala Val Tyr Lys Pro Glu

20 25 30

Phe Glu Pro Ala Val Leu Ser Lys Phe Asp Pro Arg Leu Asn Lys Asp

35 40 45

Val Asp Leu Asp Glu Val Ile Trp Ser Lys His Thr Ala Asn Val Pro

50 55 60

Tyr Gln Pro Pro Leu Phe Tyr Thr Tyr Met Ser Glu Tyr Ala His Arg

65 70 75 80

Val Phe Ser Phe Leu Gly Lys Asp Asn Asp Val Leu Thr Val Lys Glu

85 90 95

Ala Ile Leu Gly Ile Pro Gly Leu Asp Pro Met Asp Pro His Thr Ala

100 105 110

Pro Gly Leu Pro Tyr Ala Ile Ser Gly Leu Arg Arg Thr Asp Leu Val

115 120 125

Asp Phe Ala Asn Gly Thr Val Asp Pro Ala Leu Ala Met Gln Ile Gln

130 135 140

Lys Phe Leu Asp Gly Asp Tyr Ser Asp His Val Phe Gln Thr Phe Leu

145 150 155 160

Lys Asp Glu Ile Arg Pro Ser Glu Lys Val Arg Ala Gly Lys Thr Arg

165 170 175

Ile Val Asp Val Pro Ser Leu Ala His Cys Ile Val Gly Arg Met Leu

180 185 190

Leu Gly Arg Phe Ala Ala Lys Phe Gln Ser His Pro Gly Phe Leu Leu

195 200 205

Gly Ser Ala Ile Gly Ser Asp Pro Asp Val Phe Trp Thr Val Ile Gly

210 215 220

Ala Gln Leu Glu Gly Arg Lys Asn Thr Tyr Asp Val Asp Tyr Ser Ala

225 230 235 240

Phe Asp Ser Ser His Gly Thr Gly Ser Phe Glu Ala Leu Ile Tyr His

245 250 255

Phe Phe Thr Val Asp Asn Gly Phe Ser Pro Ala Leu Gly Pro Tyr Leu

260 265 270

Arg Ser Leu Ala Val Ser Val His Ala Tyr Gly Glu Arg Arg Ile Lys

275 280 285

Ile Thr Gly Gly Leu Pro Ser Gly Cys Ala Ala Thr Ser Leu Leu Asn

290 295 300

Thr Val Leu Asn Asn Val Ile Ile Arg Thr Ala Leu Ala Leu Thr Tyr

305 310 315 320

Lys Glu Phe Glu Tyr Asp Met Val Asp Ile Ile Ala Tyr Gly Asp Asp

325 330 335

Leu Leu Val Gly Ala Asp Tyr Asp Leu Asp Phe Asn Glu Val Ala Arg

340 345 350

Arg Ala Ala Lys Leu Gly Tyr Lys Met Thr Pro Ala Asn Lys Gly Ser

355 360 365

Val Phe Pro Pro Thr Ser Ser Leu Ser Asp Ala Val Phe Leu Lys Arg

370 375 380

Lys Phe Val Gln Asn Asn Asp Gly Leu Tyr Lys Pro Val Met Asp Leu

385 390 395 400

Lys Asn Leu Glu Ala Met Leu Ser Tyr Phe Lys Pro Gly Thr Leu Leu

405 410 415

Glu Lys Leu Gln Ser Val Ser Met Leu Ala Gln His Ser Gly Lys Glu

420 425 430

Glu Tyr Asp Arg Leu Met His Pro Phe Ala Asp Tyr Gly Ala Val Pro

435 440 445

Ser His Glu Tyr Leu Gln Ala Arg Trp Arg Ala Leu Phe Asp

450 455 460

<210> 2

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ataggtttaa ttaatgttaa gcgtctg 27

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtctgtggat ccctcgttgg agcc 24

<210> 4

<211> 1389

<212> DNA

<213> Senecavirus A

<400> 4

ggactgatga ctgagctaga gcctggagtc accgtacatg taccccgaaa atctaaattg 60

agaaagacga ccgcacacgc ggtgtacaaa ccggagtttg aacctgctgt gttgtcaaaa 120

tttgatccca gactgaacaa ggatgttgac ctagatgagg taatttggtc taaacacacc 180

gccaacgtcc cttatcaacc tcctttgttc tacacataca tgtcagagta cgctcatcgg 240

gttttctcct ttttgggaaa agacaatgac gttctgaccg tcaaagaagc aatcctgggc 300

atccctggac tagaccctat ggatccccac acagctccgg gtttgcccta cgccattagc 360

ggtcttcgac gtactgatct cgtcgatttt gcgaacggca cggtagaccc ggcactggcc 420

atgcagatcc agaaattctt agacggtgac tactctgacc atgtcttcca aacttttctg 480

aaagatgaaa tcagaccctc agagaaggtc cgggcgggaa aaacccgcat tgtcgatgtg 540

ccctccctgg cgcactgcat tgtgggcaga atgctgcttg ggcgctttgc cgccaagttt 600

caatcccatc ctggctttct ccttggctcc gctatcgggt ctgaccccga tgtcttctgg 660

accgtcatag gggctcagct cgagggaaga aagaacacgt atgacgtgga ctacagtgcc 720

tttgactctt cacacggcac tggctccttc gaggctctca tctatcactt tttcaccgtg 780

gacaatggtt tcagccctgc gctgggaccg tatctcagat ccctggctgt ctcggtgcac 840

gcttacggcg agcgtcgcat caagattacc ggaggcctcc cctctggttg tgccgcgacc 900

agcctgctga acacagtgct caacaatgtg atcatcagga ctgctctggc attgacctac 960

aaggaatttg aatatgacat ggttgatatc atcgcctacg gtgacgacct tttggttggt 1020

gcggattacg atctggactt caatgaggtg gcgcggcgcg ctgccaaact ggggtataag 1080

atgactcccg ccaacaaggg ttctgtcttc cctccgactt cctctctctc cgatgctgtt 1140

tttctaaaac gcaaattcgt ccaaaacaat gacggcttat ataaaccagt tatggattta 1200

aagaatttgg aagccatgct ctcctacttc aaaccaggaa cactactcga gaagctgcaa 1260

tctgtttcta tgttggctca acattctgga aaagaagaat atgatagatt gatgcacccc 1320

ttcgctgact acggtgccgt accgagtcac gagtacctgc aggcaagatg gagggccttg 1380

ttcgactga 1389

<210> 5

<211> 963

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggactaca aagacgatga cgacaaggga ctgatgactg agctagagcc tggagtcacc 60

gtacatgtac cccgaaaatc taaattgaga aagacgaccg cacacgcggt gtacaaaccg 120

gagtttgaac ctgctgtgtt gtcaaaattt gatcccagac tgaacaagga tgttgaccta 180

gatgaggtaa tttggtctaa acacaccgcc aacgtccctt atcaacctcc tttgttctac 240

acatacatgt cagagtacgc tcatcgggtt ttctcctttt tgggaaaaga caatgacgtt 300

ctgaccgtca aagaagcaat cctgggcatc cctggactag accctatgga tccccacaca 360

gctccgggtt tgccctacgc cattagcggt cttcgacgta ctgatctcgt cgattttgcg 420

aacggcacgg tagacccggc actggccatg cagatccaga aattcttaga cggtgactac 480

tctgaccatg tcttccaaac ttttctgaaa gatgaaatca gaccctcaga gaaggtccgg 540

gcgggaaaaa cccgcattgt cgatgtgccc tccctggcgc actgcattgt gggcagaatg 600

ctgcttgggc gctttgccgc caagtttcaa tcccatcctg gctttctcct tggctccgct 660

atcgggtctg accccgatgt cttctggacc gtcatagggg ctcagctcga gggaagaaag 720

aacacgtatg acgtggacta cagtgccttt gactcttcac acggcactgg ctccttcgag 780

gctctcatct atcacttttt caccgtggac aatggtttca gccctgcgct gggaccgtat 840

ctcagatccc tggctgtctc ggtgcacgct tacggcgagc gtcgcatcaa gattaccgga 900

ggcctcccct ctggttgtgc cgcgaccagc ctgctgaaca cagtgctcaa caatgtgatc 960

taa 963

<210> 6

<211> 927

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgggactga tgactgagct agagcctgga gtcaccgtac atgtaccccg aaaatctaaa 60

ttgagaaaga cgaccgcaca cgcggtgtac aaaccggagt ttgaacctgc tgtgttgtca 120

aaatttgatc ccagactgaa caaggatgtt gacctagatg aggtaatttg gtctaaacac 180

accgccaacg tcccttatca acctcctttg ttctacacat acatgtcaga gtacgctcat 240

cgggttttct cctttttggg aaaagacaat gacgttctga ccgtcaaaga agcaatcctg 300

ggcatccctg gactagaccc tatggatccc cacacagctc cgggtttgcc ctacgccatt 360

agcggtcttc gacgtactga tctcgtcgat tttgcgaacg gcacggtaga cccggcactg 420

gccatgcaga tccagaaatt cttagacggt gactactctg accatgtgat catcaggact 480

gctctggcat tgacctacaa ggaatttgaa tatgacatgg ttgatatcat cgcctacggt 540

gacgaccttt tggttggtgc ggattacgat ctggacttca atgaggtggc gcggcgcgct 600

gccaaactgg ggtataagat gactcccgcc aacaagggtt ctgtcttccc tccgacttcc 660

tctctctccg atgctgtttt tctaaaacgc aaattcgtcc aaaacaatga cggcttatat 720

aaaccagtta tggatttaaa gaatttggaa gccatgctct cctacttcaa accaggaaca 780

ctactcgaga agctgcaatc tgtttctatg ttggctcaac attctggaaa agaagaatat 840

gatagattga tgcacccctt cgctgactac ggtgccgtac cgagtcacga gtacctgcag 900

gcaagatgga gggccttgtt cgactga 927

<210> 7

<211> 927

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtcttccaaa cttttctgaa agatgaaatc agaccctcag agaaggtccg ggcgggaaaa 60

acccgcattg tcgatgtgcc ctccctggcg cactgcattg tgggcagaat gctgcttggg 120

cgctttgccg ccaagtttca atcccatcct ggctttctcc ttggctccgc tatcgggtct 180

gaccccgatg tcttctggac cgtcataggg gctcagctcg agggaagaaa gaacacgtat 240

gacgtggact acagtgcctt tgactcttca cacggcactg gctccttcga ggctctcatc 300

tatcactttt tcaccgtgga caatggtttc agccctgcgc tgggaccgta tctcagatcc 360

ctggctgtct cggtgcacgc ttacggcgag cgtcgcatca agattaccgg aggcctcccc 420

tctggttgtg ccgcgaccag cctgctgaac acagtgctca acaatgtgat catcaggact 480

gctctggcat tgacctacaa ggaatttgaa tatgacatgg ttgatatcat cgcctacggt 540

gacgaccttt tggttggtgc ggattacgat ctggacttca atgaggtggc gcggcgcgct 600

gccaaactgg ggtataagat gactcccgcc aacaagggtt ctgtcttccc tccgacttcc 660

tctctctccg atgctgtttt tctaaaacgc aaattcgtcc aaaacaatga cggcttatat 720

aaaccagtta tggatttaaa gaatttggaa gccatgctct cctacttcaa accaggaaca 780

ctactcgaga agctgcaatc tgtttctatg ttggctcaac attctggaaa agaagaatat 840

gatagattga tgcacccctt cgctgactac ggtgccgtac cgagtcacga gtacctgcag 900

gcaagatgga gggccttgtt cgactga 927

<210> 8

<211> 3111

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgagcatgg caagcgtccg ctgcaagctg gctcgttacc tggaggacct agaagatgta 60

gattttaaga aattcaagat gcacttagaa gactatcctt ctcagaaggg ctgcatctct 120

ctccctcggg gccagacaga aaaagcagat catgtggatc tagccactct gatgatagat 180

ttcaatggag aggagaaggc atgggccatg gccacatgga tttttgctgc gatcaacagg 240

agagaccttt atgagaaagc taagagggat gagccagaat gggacaatgc aaatctttct 300

gtgataagcc aggaagaaag ccttgaagag gaatggatgg gtttactggg gtacctttcc 360

agaatctcta tttgtaagaa aaagaaagat tattgtaaga agtacagaaa gcacgtgaga 420

agcagattcc agtgcatcaa agacaggaat gcacgtctgg gtgagagtgt gaacctcaac 480

aaacgcttca ccaggctgcg tctcatcaag gaacaccgga gtcagcagga gagggagcat 540

gagctccttg ccattggcag gacctcagcc aagatgcaag atggccccgt gagttccctg 600

aacttggaat tgctgtttga tcctgaggac caacactctg agcctgtgca cacggtagta 660

ttccagggag cagcaggcat tgggaaaaca atactggcca ggaagatcat gttggactgg 720

gcatcagaga aactttacca ggaaaaattt gactatttgt tttacattca ctgtcgggag 780

gtgagcctag gaactcggag gagcctggga gacctgatcg ccagctgctg ccctggccca 840

aacccaccca taggcaagat tgtgagcaag ccttccagga tcctcttcct catggatggc 900

tttgatgagc tgcaaggtgc ctttgatgag cgcacagagg cactctgcac aaactggcag 960

aaggtggagc ggggagacat tctcctgagc agcctcatca gaaaaagact gcttcctgag 1020

gcctccctgc tcatcaccac aagacctgtg gccctggaga aacttcagca cttgctgggc 1080

cgggctcgtc atgtggagat tctgggtttc tcagaggcca agaggaagga atatttcttt 1140

aagtattttt cagatgaaca gcaagcaagg gaagccttca ggctgattca ggagaatgag 1200

gtcctgttca ccatgtgctt tattcccctg gtctgctgga ttgtgtgcac tgggctgaaa 1260

cagcagatgg atagcggcaa gagtcttgcc aggacatcca agaccaccac tgccgtgtat 1320

atcttcttcc tctccacttt gttgcaatct caagaaggga gccaggacca ccacgtctct 1380

gccaccctct ggggtctctg ctcactggct gcggatggaa tctggaatca gaaaatcctg 1440

tttgaggagt gtgatctcag gaaccatggc ctgcagaagg cagatgtgtc tgctttcctg 1500

aggatgaacc tattccaaaa ggaagtagac tgtgagaaat tctacagctt cattcacatg 1560

actttccagg agttctttgc tgccatgtac tatctactgg aaaaggagga tcagggggag 1620

atgaggaatg tgccacgaag ctgtttgaag cttcccagtc gagacgtgac agttcttctt 1680

gaaaactatg gcaaatttga aaaggggtat ctgatttttg ttgtccgttt cctctttggc 1740

cttgtaaacc aggagagaac gtcctacttg gagaaaaaac tgagttgtaa gatctctcag 1800

aaaatcaggc tagagctgct taaatggatt gaagcgaaag ccaaggccaa gaagctacag 1860

attgagccca gccagctgga attattttac tgtttgtacg aaatgcagga ggaggacttt 1920

gtgcaaaagg ccatgggcca tttccctaaa attgagatca atctctccac cagaatggac 1980

catgtagttt cttctttttg tattgagaac tgtcgccatg tggaatcact ttctctgagg 2040

ttgctccata attcacccaa agaggaggag gaggaagagg agatagagga ggaggatgtt 2100

caacactctg atgtggacaa ttgtatcctc tctgagtctc atgttgcata ttctcagcga 2160

ttggtgaact atctcacttc cagcttttgt agtggcatct tctcagtcct gagcaataac 2220

tggaatctca ctgaattgaa cctcagtggt aacagcctgg gagacccagg gatgaaggtg 2280

ttatgtgaaa cgctccagca acctggctgt aacattcgaa gattatggtt gggacagtgt 2340

tgcctgtccc atcagtgctg cttcaacatc tcctctgtcc tgagcaacaa ccagaagttg 2400

gtggaactgg atctgagcca caatgccctg ggagactttg ggatcagact tttgtgtgtg 2460

ggactgaggc atctattctg caagctaaag aagctctggt tggtcagttg ctgtctcaca 2520

tcagcgtgtt gtgaggatct tgcgtccgtc ctgagcagca atcattccct gaccagactc 2580

tacttgggtg aaaatgccct gggagactca ggagttggaa ttttatgtga aaaagcaaag 2640

catccacaat gtaacctgca aaaactgggg ttggtgaatt ctggccttac atcaggttgt 2700

tgtctagctc tatcctcagt gctcagcacg aaccagaatc tcactcacct ctatctacgg 2760

ggaaatgctc ttggagacat cggagtcaag caactctgtg agggactgtt gcacccgaac 2820

tgcaagcttc aagtgttgga attagagaac tgcagcctca catcacactg ctgctgggat 2880

ctttccacac ttctgacttc taaccagagc ctgcgaaagc tgagcctagg caacaatgac 2940

ctgggtgatc tgggggtcat gctactctgt gaagtgttga aacagcaggg gtgcctcctg 3000

aaaagcctta agttgtgtga aatgtatttc aattatgata caaaacatgc attacaaaca 3060

ctgcaagaag aaaagcctga gttgaccatt gtctttgagc cttcccagta g 3111

<210> 9

<211> 1215

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atggccgaca aggtcctgaa ggagaagaga aagctgttta tccgttccat gggtgaaggt 60

acaataaatg gcttactgga tgaattatta cagacaaggg tgctgaacaa ggaagagatg 120

gagaaagtaa aacgtgaaaa tgctacagtt atggataaga cccgagcttt gattgactcc 180

gttattccga aaggggcaca ggcatgccaa atttgcatca catacatttg tgaagaagac 240

agttacctgg cagggacgct gggactctca gcagatcaaa catctggaaa ttaccttaat 300

atgcaagact ctcaaggagt actttcttcc tttccagctc ctcaggcagt gcaggacaac 360

ccagctatgc ccacatcctc aggctcagaa gggaatgtca agctttgctc cctagaagaa 420

gctcaaagga tatggaaaca aaagtcggca gagatttatc caataatgga caagtcaagc 480

cgcacacgtc ttgctctcat tatctgcaat gaagaatttg acagtattcc tagaagaact 540

ggagctgagg ttgacatcac aggcatgaca atgctgctac aaaatctggg gtacagcgta 600

gatgtgaaaa aaaatctcac tgcttcggac atgactacag agctggaggc atttgcacac 660

cgcccagagc acaagacctc tgacagcacg ttcctggtgt tcatgtctca tggtattcgg 720

gaaggcattt gtgggaagaa acactctgag caagtcccag atatactaca actcaatgca 780

atctttaaca tgttgaatac caagaactgc ccaagtttga aggacaaacc gaaggtgatc 840

atcatccagg cctgccgtgg tgacagccct ggtgtggtgt ggtttaaaga ttcagtagga 900

gtttctggaa acctatcttt accaactaca gaagagtttg aggatgatgc tattaagaaa 960

gcccacatag agaaggattt tatcgctttc tgctcttcca caccagataa tgtttcttgg 1020

agacatccca caatgggctc tgtttttatt ggaagactca ttgaacatat gcaagaatat 1080

gcctgttcct gtgatgtgga ggaaattttc cgcaaggttc gattttcatt tgagcagcca 1140

gatggtagag cgcagatgcc caccactgaa agagtgactt tgacaagatg tttctacctc 1200

ttcccaggac attaa 1215

<210> 10

<211> 810

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggcagaag tacctgagct cgccagtgaa atgatggctt attacagtgg caatgaggat 60

gacttgttct ttgaagctga tggccctaaa cagatgaagt gctccttcca ggacctggac 120

ctctgccctc tggatggcgg catccagcta cgaatctccg accaccacta cagcaagggc 180

ttcaggcagg ccgcgtcagt tgttgtggcc atggacaagc tgaggaagat gctggttccc 240

tgcccacaga ccttccagga gaatgacctg agcaccttct ttcccttcat ctttgaagaa 300

gaacctatct tcttcgacac atgggataac gaggcttatg tgcacgatgc acctgtacga 360

tcactgaact gcacgctccg ggactcacag caaaaaagct tggtgatgtc tggtccatat 420

gaactgaaag ctctccacct ccagggacag gatatggagc aacaagtggt gttctccatg 480

tcctttgtac aaggagaaga aagtaatgac aaaatacctg tggccttggg cctcaaggaa 540

aagaatctgt acctgtcctg cgtgttgaaa gatgataagc ccactctaca gctggagagt 600

gtagatccca aaaattaccc aaagaagaag atggaaaagc gatttgtctt caacaagata 660

gaaatcaata acaagctgga atttgagtct gcccagttcc ccaactggta catcagcacc 720

tctcaagcag aaaacatgcc cgtcttcctg ggagggacca aaggcggcca ggatataact 780

gacttcacca tgcaatttgt gtcttcctaa 810

<210> 11

<211> 2046

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atgccagctc tgcccctgga ccaactccag atcacccaca aggacccgaa gacaggaaag 60

ctgaggactt caccagcgct ggtgatcttt gacgagactc tacagaagtg cctggactcc 120

tacctgcgct atgtcccccg caaattcgac gagggggtgg cctcagcccc tgaggttgtt 180

gacatgcaga agcgcctcca tcgaagtgtt tttctcacct tcctccgcat gtccactcac 240

aaggaatcca aaatcctgga cctctgcgtg ctctttggaa aaggcaactc accactgctc 300

cagaagatga taggaaacat ctttacacag cagccaagtt actacagtga cctggatgaa 360

accctgccta ccatccttca ggtcttcagc aatatcctcc agcactgtgg tttgcaaggg 420

gacggggcca ataccacacc ccagaagctt gaggagaggg gccgattgac ccccagtgac 480

atgcctctcc tggaattaaa ggacattgtt ctctaccttt gtgatacctg caccacactt 540

tgggcctttc tggatatctt ccctttggct tgccagacct tccagaagca cgacttttgt 600

tacagactag cttccttcta cgaagcagca attcccgaaa tggagtctgc aattaagaag 660

aggaggcttg aagatagcaa gcttcttggt gacctgtggc agaggctctc ccattccagg 720

aagaagctaa tggagatttt ccacatcatc ctgaaccaga tctgcctcct tcccatccta 780

gaaagcagct gtgacaacat tcagggcttc atcgaagagt tccttcagat cttcagctcc 840

ttgctgcagg agaagaggtt cctccgggac tatgatgcac tcttccccgt ggccgaagac 900

atcagcttgc tgcagcaggc ctcatcagtc ttggacgaga cgcggactgc ctacatcctc 960

caggcagtcg agagtgcatg ggaaggggtg gacagacgga aagccacaga tgctaaagac 1020

ccatcggtga ttgaggagcc taatggggag cctaacgggg tcacggtgac agcagaggca 1080

gtcagtcaag catcatcaca tccggagaac tcggaggaag aggagtgcat gggagcagcc 1140

gcggctgtgg gccctgccat gtgtggggtg gaactggact ctctcatctc ccaagtgaag 1200

gacctgctgc cagaccttgg tgagggcttc atcctggcct gcctggagta ctaccactac 1260

gacccagagc aggtgatcaa caatatcctg gaggagcggc tggcccccac cctcagccag 1320

ctggaccgca acctagacag agaaatgaaa ccagacccta cacccctgct gacgtctcgc 1380

cacaacgtct tccagaatga cgagtttgat gtgttcagca gggactcagt agacctgagc 1440

cgggtgcaca agggcaagag caccaggaag gaggaaaaca cgcggagttt gctgaacgac 1500

aagcgtgcag tggcggcaca gcggcagcgc tacgagcagt acagcgtggt ggtggaggag 1560

gtgccactgc agccaggcga gagcctgccc taccacagtg tctactacga ggatgagtac 1620

gatgacacat acgatggcaa ccaggtgggc gccaatgatg cagactctga tgacgagctc 1680

atcagccgca ggccattcac catccctcag gtgctgagaa ccaaagtgcc tagagaaggg 1740

caggaggagg atgacgacga tgaggaagac gatgctgacg aggaggctcc caagcccgac 1800

cattttgttc aggaccctgc agtgctgaga gagaaggcag aagccaggcg catggccttt 1860

ctcgccaaga aagggtaccg gcatgacagc tcaacagcag tggccggcag cccccgaggc 1920

catgggcaga gccgcgagac aacccaggaa cgcaggaaga aggaagccaa caaggcgaca 1980

agagccaacc acaaccggag aaccatggcc gaccgcaaga ggagcaaagg catgatccca 2040

tcctga 2046

Claims (8)

1. The application of SVA 3D protein in preparing an immune response inducer or adjuvant is characterized in that the amino acid sequence of the 3D protein is shown as SEQ ID NO. 1.
2. The application of SVA 3D protein in the preparation of IL-1 beta activator is characterized in that the amino acid sequence of 3D protein is shown as SEQ ID NO. 1.
3. 3. The use according to claim 1, characterized in that the 3D protein induces IL-1 β production by activating NLRP3 inflammatory bodies of host cells.
4. 4. The use according to claim 2, characterized in that the 3D protein activates NLRP3 inflammasome by inducing activation of NF- κ B.
5. 5. The use according to claim 3, characterized in that the 3D protein also activates NLRP3 inflammasome by means of altering the ion concentration changes within the host cell.
6. 6. Use according to claim 4, wherein the ion concentration is varied in such a way that: the outflow of potassium ions and the inflow of calcium ions within the host cell.
7. 7. The use of claim 2, wherein the N-terminal 1-154aa of the 3D protein interacts with the NATCH motif of NLRP3 to activate NLRP3 inflammasome.
8. The application of the SVA 3D protein in preparing SVA vaccine adjuvant is characterized in that the amino acid sequence of the 3D protein is shown as SEQ ID NO. 1.

Images