CN105853998B - Osteopetrosis correlation transmembrane protein is treating or preventing the application in EV71 infection medicine - Google Patents
Osteopetrosis correlation transmembrane protein is treating or preventing the application in EV71 infection medicine Download PDFInfo
- Publication number
- CN105853998B CN105853998B CN201610216836.4A CN201610216836A CN105853998B CN 105853998 B CN105853998 B CN 105853998B CN 201610216836 A CN201610216836 A CN 201610216836A CN 105853998 B CN105853998 B CN 105853998B
- Authority
- CN
- China
- Prior art keywords
- albumen
- ostm1
- virus
- cell
- osteopetrosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Abstract
The present invention discloses osteopetrosis correlation transmembrane protein and is treating or preventing the application in EV71 infection medicine, it the steps include: to express Ostm1 albumen in insect cell (SF9) first with insect baculovirus expression system, then Ostm1 albumen is purified using the method for affinity chromatography, the antiviral effect of Ostm1 albumen is finally verified in pernicious embryo's rhabdomyoma cell (RD cell) of infection EV71.The results show: Ostm1 albumen after purification can be in the duplication of mRNA level in-site and protein level inhibition EV71 virus in a certain concentration.The present invention evaluates the anti-EV71 virus function of osteopetrosis correlation transmembrane protein (Ostm1) from protein purification and nucleus molecular level, lays a good foundation for its further development and application.The albumen can directly inhibit the duplication of EV71 virus in concentration appropriate, and effect is obvious, is free from side effects to cell, easy to use.Show that the drug has the active drug for being developed into anti-EV71 virus and is applied to clinical prospect.
Description
Technical field
The present invention relates to antiviral drugs fields, are related to a kind of osteopetrosis correlation transmembrane protein (Osteopetrosis
Associated transmembrane protein 1) new application, be more particularly to a kind of osteopetrosis correlation cross-film egg
It is white to treat or prevent the application in EV71 infection medicine.
Background technique
Human enterovirus 71 (Hu-man enterovirus) belongs to Picornaviridae (Picomaradae) enteron aisle
Tobamovirus (Enterovirus).EV71 virion is positive icosahedral symmetry spherical structure, straight without coating and furcella
Diameter is in 24-30nm or so.Full length viral genome is 7408bp, is single stranded positive-sense RNA, only one open reading in genome
Frame (ORF), the noncoding region (UTRs) for being 5 ' and 3 ' in the two sides of ORF can there are one length at 3 ' end ends of genome
The polyadenylic acid tail (poly-A) of change.ORF in viral genome can encode 2194 amino acid, these amino acid groups
At polyprotein can produce P1, P2 and P3 and have 3 precursor proteins altogether.Wherein P1 precursor protein encodes 4 virus coat eggs
It is white, respectively VP1, VP2, VP3 and VP4;P2 and P3 precursor protein encodes altogether 7 non-structural proteins.Wherein, VP1 albumen is
Most important capsid protein, containing the main antigenic determinant of EV71, the gene order of coding and the serology of virus have very
High correlation, therefore it is frequently used to the identification as Virus type and the evolutionary analysis of gene.The capsid of virion has
60 subunit's compositions, the pentamer spline structure that each subunit has VP1-VP4 to be formed, antigenic determinant are substantially all
On VP1-VP3.
EV71 virus is intrusion object with the upper respiratory tract, throat and enteron aisle of human body, first in the mucous membrane and almond of part
The lymphoid tissues such as body and pharynx and intestinal lymphoid, which are concentrated, merges preliminary amplification, and EV71 virus is then released into blood, forms the
Viremia virusemia, EV71 virus are diffused into the target tissue with its receptor with blood, are proliferated again so as to cause second of disease
Toxaemia and some clinical symptoms.The infection of EV71 will cause long-term sequelae, such as nervous system sequelae and cognition
The delay and reduction of function.Pulmonary edema and bleeding are the main reason for causing death after childhood infection EV71.
The EV71 infection for treating severe there is no effective antiviral drugs at present, does not enter into the epidemic disease of clinical stage yet
Seedling can be used, so, the patient and suspected infection patient for avoiding contact with infection are the main methods for preventing EV71 infection.Anti-
In terms of the research of EV71 virus drugs, Pyridinylimidazoles quinoline ketone is the drug of a kind of new type bonding agent class, it can be with EV71's
The interaction of VP1 albumen, by makingVP1The expansion of the hydrophobic region of gene, to interfere method of the VP1 in conjunction with its receptor
To inhibit the duplication of EV71.In addition, cytokine mediated method can be used to treat the caused oedema of EV71 infection, such as
As Ribavirin can reduce the death rate and subsequent of EV71 infection by reducing the virus load in infecting mouse tissue
Sequela of paralysis.Finally, we can prevent the infection of EV71 by the method for vaccine inoculation, the candidate vaccine of EV71 at present
Main includes attenuation active vaccine, recombinant vaccine, DNA vaccination, virus-like particle and transgene vaccine, these vaccines are
Obtaining assessment in animal experiments, still clinical test not yet carries out.
Osteopetrosis correlation transmembrane protein (Ostm1) has 338 amino acid, has a single transmembrane domain,
One short cytoplasmic tail, a long lumen structural domain and a letter that can be sheared containing multiple high-glycosylation sites
Number peptide.The lumen structural domain of Ostm1 albumen contains a faint RING-finger albumen.The function of the albumen most initial
It may be similar with E3 ubiquitin ligase.
Ostm1 albumen can be in osteoclast, candidate stem cell and other hematopoietic cell families such as B cell, NK
It is expressed in cell and mast cell.Ostm1Gene can be independently ofCIC-7Gene plays important in the differentiation of candidate stem cell
Effect, in addition, Ostm1 albumen can also regulate and control typical Wnt signal path, to play important work in bone homeostasis
With.Osteopetrosis patient'sOstm1Mutation on gene produces a truncated albumen, this hypoproteinosis transmembrane region and
To allow the albumen to secrete, which can inhibit Wnt signal path and can be incorporated into osteoclastic cytoplasmic tail
Inhibit the generation of osteoclast on the repressor of cell precursors.Ostm1 albumen is the target position of miR-140 in multipotential stem cell
Point, has the function of anti-cellulite formation, and Ostm1 albumen also has connection bone morphogenetic protein (BMP) and Wnt signal path
Potentiality.But there is presently no the document report of relationship between Ostm1 albumen and viral disease and correlated virus, do not have yet
There is the report of prevention and treatment of the virus to now extensive popular and pathogenic relatively high enterovirus (EV71)
Road.
Summary of the invention
The purpose of the invention is to provide a kind of people's bone hardening illness correlation transmembrane proteins to treat and prevent people in preparation
Application in enterovirus EV 71 infection medicine, it is anti-to the related transmembrane protein of osteopetrosis (Ostm1) to molecular level from cell
The effect of EV71 virus is evaluated, and is had laid a good foundation for its further development and application, which can be
Concentration appropriate directly inhibits the duplication of EV71 virus, and effect is obvious, is free from side effects to cell, easy to use.
In order to achieve the above purpose, the invention is realized by the following technical scheme:
A kind of osteopetrosis correlation transmembrane protein treats or prevents in enterovirns type 71 (EV71) infection medicine in preparation
Application, the steps include:
(1) willOstm1The C-terminal of gene (GenBank NP054747) connects upper His label, is then cloned into
Under the PH promoter (above plasmid) of pFastBac Dual carrier (Invitrogen), correct gram is obtained by sequencing
Grand pFastBac Dual-Ostm1;
(2) pFastBac Dual-Ostm1 conversion Escherichia coli (DH10 β) (is purchased from the limited public affairs of gram labor biotechnology
Department), by Tn7 transposons (DH10 β), genetic recombination obtains carrying the baculoviral Bacmid-Ostm1 of Ostm1 gene;
(3) Bacmid-Ostm1 transfection SF9 cell (from China typical culture collection center) is obtained into P1 generation weight
Group virus obtains the highest P3 of activity for recombinant baculovirus by virus amplification, and demonstrates the successful table of Ostm1 albumen
It reaches;
(4) large-scale protein expression is carried out for virus infection SF9 suspension cell with P3, then utilizes the affine layer of nickel column
The Ostm1 albumen that analysis method is successfully purified;
(5) Ostm1 albumen after purification is acted on into infection EV71 virus (GenBank with different concentration
JN230523.1 RD cell), extracts total serum IgE after 8h, using the VP1 structural proteins of virus as detection EV71 virus replication
Marker detects the antiviral effect of the albumen in RNA and protein level respectively.
It is above-mentioned the results showed that Ostm1 albumen after purification can significantly inhibit EV71 viral in a certain concentration
The mRNA level in-site of VP1, immunoblot results also show the albumen can inhibit the expression of VP1 protein level in same concentrations.
To demonstrate the function that the albumen just uses anti-E71 virus replication.
Present invention finds the new medical value of osteopetrosis correlation transmembrane protein, for anti-enterovirns type 71, treatment and/
Or prevention EV71 infection provides new active drug.
A kind of osteopetrosis correlation transmembrane protein treats or prevents enterovirns type 71 (EV71) infection in preparation
Application in drug has particular application as the cell that the Ostm1 albumen of purifying is directly acted on to infection EV71 with suitable concentration,
The albumen can significantly inhibit the duplication (as shown in Figure 5) of EV71
The EV71 infection for treating severe there is no effective antiviral drugs at present, does not enter into the epidemic disease of clinical stage yet
Seedling can be used, so, the patient and suspected infection patient for avoiding contact with infection are the main methods for preventing EV71 infection.Anti-
In terms of the research of EV71 virus drugs, Pyridinylimidazoles quinoline ketone is the drug of a kind of new type bonding agent class, it can be with EV71's
The interaction of VP1 albumen, the expansion of the hydrophobic region by making VP1 gene, to interfere method of the VP1 in conjunction with its receptor
To inhibit the duplication of EV71.In addition, cytokine mediated method can be used to treat the caused oedema of EV71 infection, such as
As Ribavirin can reduce the death rate and subsequent of EV71 infection by reducing the virus load in infecting mouse tissue
Sequela of paralysis.Finally, applicant can prevent the infection of EV71 by the method for vaccine inoculation, the candidate epidemic disease of EV71 at present
Seedling mainly includes attenuation active vaccine, recombinant vaccine, DNA vaccination, virus-like particle and transgene vaccine, these vaccines
Obtaining assessment in animal experiments, still clinical test not yet carries out.
Compared with prior art, the present invention having the following advantages that and effect:
The present invention is from protein purification and cell to molecular level to the related transmembrane protein of osteopetrosis (Ostm1) anti-EV71
Virus function is evaluated, and is laid a good foundation for its further development and application.Show that the drug is anti-with being developed into
The active drug of EV71 virus and be applied to clinical prospect.
Finally, by experiment it is found by the applicant that osteopetrosis correlation transmembrane protein can be right when concentration is 13.5ng/ml
EV71 virus is replicated with apparent inhibiting effect, which can be made related drugs by this prompt applicant, thus
Its antiviral effect is played during treating after the prevention and infection of EV71 virus.
Detailed description of the invention:
Fig. 1 is a kind of P3 for the time of baculovirus expression Ostm1 albumen and the schematic diagram of expression environmental appraisal.
As a result prove that P3 is best for virus infection insect cell (sf9) third day OStm1 protein expression effect, and the albumen
It is intracellular expression.
Fig. 2 be it is a kind of using affinity chromatography method come the different imidazole concentration gradient elution figures of purifying protein.
As a result prove that Ostm1 albumen can be eluted largely, and foreign protein when imidazole concentration is 112mM
Seldom, the albumen so as to be purified.
Fig. 3,4 inhibit the schematic diagram of EV71 virus mRNA level in-site for a kind of Ostm1 albumen of various concentration.
As the result is shown when Ostm1 protein concentration is 13.5ng/ml and 337.5ng/ml, the VP1 albumen of EV71 virus
MRNA level in-site significantly decreases compared with the control group that virus is not added, and illustrates when albumen is in this concentration to EV71 virus
MRNA's has obvious inhibiting effect.
Fig. 5 is that a kind of Ostm1 albumen of various concentration inhibits the schematic diagram of EV71 virus protein level.
As the result is shown when the concentration of albumen is 189ng/ml and 360ng/ml, compared with the control group that virus is only added,
The protein level of VP1 significantly decreases, and illustrates in this concentration, and Ostm1 albumen is brighter for being replicated with for EV71 virus
Aobvious inhibiting effect.
Specific embodiment
Embodiment 1:
A kind of application of osteopetrosis correlation transmembrane protein in preparation prevention and/or treatment EV71 infection medicine, step
Suddenly it is:
1. expression and purifying of the Ostm1 albumen in insect baculovirus expression system:
Applicant is using the cDNA of HepG2 cell (from China typical culture collection center) as template first, with spy
Anisotropic primer (sequence is as follows) carrys out amplifying target genes, then connects at plasmid vector pCAGG-HA (Invitrogen)
Above.Primer sequence is as follows:
Forward:GCGACCGAATTCATGGAGCCGGGCCCGACAGC
Reverse:CGCGCTCGAGGTTTGAATTTTCCTGAATATTTGC
Then again with specificity primer above above-mentioned plasmid come amplifying target genes, be cloned into pFastBac
On Dual carrier.The sequence of primer is as follows:
Forward:CTGAATTCATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTGTACATT
TGGTCGTGTACATTTCTTACATCTATGCGATCGAGGGAAGGGAGCCGGGCCCGACAG
Reverse:CGCTCGAGTTAGTGATGGTGATGGTGATGCCTTCCCTCGATTCAGTTTGAATTTTC
Then pFastBac Dual-Ostm1 plasmid is converted into competent escherichia coli cell DH10 β, is coated on and is added
There are kanamycins, tetracycline, a gentamicin, on the LB solid plate of x-gal and IPTG, it is raw to be then placed on 37 DEG C of constant temperature
Change and is protected from light culture 72h in incubator.Then 3 white colonies of picking, scribing line is incubated at above-mentioned solid plate again, chooses after 72h
Monoclonal colonies are taken, are inoculated into the LB liquid medium of containing kanamycin, tetracycline and gentamicin, 200rpm,
37 DEG C of shake cultures are stayed overnight.Next day extracts plasmid, and the insertion of Ostm1 gene is identified with M13 primer.M13 primer sequence is as follows
Forward: GTAAAACGACGGCCAGT
Reverse: AACAGCTATGACCATG
The SF9 cell (from China typical culture collection center) frozen is taken out from liquid nitrogen container, is put into 37 rapidly
In DEG C water-bath, quick-thawing, recovery cell.Then the SF900 of 4ml is addedCulture is put into 27 DEG C based in T25 cell bottle
It is cultivated in the cell incubator of no carbon dioxide.When cell can be very good passage, the shuttle plasmid Bacmid- that will obtain
2) Ostm1(, which is shown in technical solution, to be transfected into SF9 cell, transfect 72h or after lesion occurs in cell, collect culture medium
Supernatant is transferred in sterile 15ml centrifuge tube, and 1000rpm is centrifuged 10min, and P1 can be obtained for baculoviral, then by it
Continue to infect the good SF9 cell of growth conditions, P2 can be obtained for baculoviral, obtains P3 in this approach for baculoviral,
If virus should be placed in -80 DEG C of preservations by long-term preservation virus.
In order to verify expression of the Ostm1 albumen in SF9 cell, applicant takes P1 generation respectively, P2 generation, P3 generation and
P3 does Western-blot experiment for the cell and culture medium supernatant of virus infection SF9 cell 1d, 2d, 3d, passes through experiment
As a result it is best to obtain P3 generation virus expression Ostm1 albumen effect when infecting third day by applicant, and the albumen is non-secreting
Type expression.
It is being determined that Ostm1 albumen successful expression is followed by exactly the purifying of albumen.It is the training of SF9 suspension cell first
It supports: taking out the SF9 suspension cell frozen from liquid nitrogen container, be inoculated into sterile shaking flask that (general inoculum concentration is shaking flask body
Long-pending 1/3).110rpm, 27 DEG C of shake cultures;The number and survival rate of observation daily and measurement cell, the concentration to its cell
Reach 4 × 106A/ml, and its survival rate is at 95% or more, so that it may carry out the passage of cell;It is added in original culture bottle bottle
Suitable fresh culture makes the concentration of cell reach 2 × 106A/ml, be then dispensed into two it is sterile in shaking flask.
110rpm continues shake culture under the conditions of 27 DEG C.Density to SF9 suspension cell reaches 2 × 106When a/ml, MOI=1 is added
P3 generation virus, continue to abandon culture medium after cultivating 3d, collect cell.The weight in wet base for weighing insect cell, then according to 1:10's
Insect cell lysate is added in ratio.Cell is placed under sonicator, the time that ultrasound is arranged and frequency are (usually
The ultrasonic interval 2s 2s, ultrasonic 30min or so).It needs for cell to be placed on ice chest always during entire ultrasound, ultrasound terminates
After collect supernatant.Herein applicant use the BioLogic DuoFlow protein purification instrument of BIO-RAD company come into
The purifying of row albumen, specific experiment step clean nickel column with deionized water for (1): A pump (carrying on above-mentioned machine) and B
(carrying on above-mentioned machine) all into the water, flow velocity 1.5ml/s cleans 20min;(2) balance nickel column: it is slow that A pump is put into balance
Fliud flushing, B are pumped into the water, this step only has A pump work, and flow velocity 1.5ml/s balances 20min;(3) loading: A pump is put into sample
In, B is pumped into the water, this step is also to be determined by sample volume only A pump work, flow velocity 1.5ml/s, the time, collection part
Efflux;(4) rinse: A pump is put into wash buffer, and B is pumped into the water, is also only A pump work, flow velocity in this step
1.5ml/s rinses 20min, collects rinsing liquid;(5) linear gradient elution: A pump is put into the imidazoles of high concentration (200mM), B pump
Into the water, this step two pump works at the same time, and the pipe number of collection is arranged.The concentration of eluent is exactly from 0-200mM linear gradient
Variation, collects every pipe eluent;(6) high concentration rinses: A pump being put into high concentration imidazoles (200mM), B is pumped into the water, this step
Suddenly only A pump work, flow velocity 2ml/s rinse 15min, to wash away albumen remaining in nickel column;(7) cleaning system: A is pumped
It pumps while is put into the ethyl alcohol for being 20% containing concentration with B, flow velocity 2ml/s cleans 30min.Whole system is set to be in 20% second
In alcohol environment, finally two pumps are stored in 20% ethanol solution.
Note: A pump will be cleaned up during exchange with deionized water.
2. the anti-EV71 virus activity research of the Ostm1 albumen of purifying:
2.1 cells and virus:
Human rhabdomyosarcoma's cell line RD from China typical culture collection center (CTCC) (Wuhan University), and
It is saved by this laboratory.
EV71 Strain is separated by this laboratory and is obtained.
2.2 experimental methods:
RD cell in logarithmic phase is spread 12 orifice plates to change when and cell adherent when RD cell is paved with each hole substantially
It with serum free medium, then only stays a hole as control, virus is not added, the EV71 disease of MOI=1 is added in remaining each hole
Poison.After 90min, former culture medium is discarded, fresh serum free medium is then added, the purifying of different quality is added in each hole
Ostm1 albumen afterwards collects cell after 8h, extracts the middle total serum IgE in cell using Trizol method, reverse transcription becomes cDNA, so
Situation of change of the VP1 albumen on rna level in EV71 virus is detected using the method for quantitative fluorescent PCR afterwards.Primer sequence
It is as follows:
VP1: Forward AATTGAGTTCCATAGGTG
Reverse CTGTGCGAATTAAGGACAG
GAPDH: Forward AAGGCTGTGGGCAAGG
Reverse TGGAGGAGTGGGTGTCG
Because not knowing the optimum concentration range of Ostm1 albumen suppressing virus replication, apply in the experiment of early period
People amplifies the mass range (6.75ng-1350ng) for the Ostm1 albumen being added in cell, dense for screening its most suitable effect
Degree.Experimental result is as shown in Figure 3.
As shown in Figure 3: when it is 6.75ng, 33.75ng and 270ng that Ostm1 albumen quality, which is added, VP1 albumen
MRNA level in-site with only plus virus control group compared with decline it is obvious, illustrate Ostm1 albumen in this concentration to EV71 disease
The mRNA's of poison has obvious inhibiting effect.But when continuing to improve the concentration of Ostm1 albumen, it is found that its is right
The no inhibiting effect of duplication of EV71 virus.In order to further verify above-mentioned experimental result, in next experiment, application
The mass range that albumen in cell is added is further reduced (13.5ng-405ng) by people, and experimental result is as shown in Figure 4:
As shown in Figure 4, when the quality that Ostm1 albumen is added is 13.5ng and 337.5ng, the VP1 albumen of EV71 virus
MRNA level in-site with the control group that virus is not added compared to significantly decreasing, illustrate viral to EV71 when albumen is in this concentration
MRNA's has obvious inhibiting effect.This is consistent substantially with the experimental result of Fig. 4, thus applicant it can be concluded that
Ostm1 albumen can inhibit the generation of EV71 virus mRNA in suitable concentration range.
RD cell in logarithmic phase is spread into six orifice plates, it is completely adherent and cover with six orifice plates to cell.Former culture medium is discarded,
Use serum free medium instead.Virus is not added as control in one of hole, and EV71 virus MOI=1 is added in remaining every hole.90min
Afterwards, former culture medium is discarded, uses fresh serum free medium instead.The Ostm1 albumen of different quality is added in each hole.It is received after 12h
Collect cell, ultrasonic disruption cell.Then it is detected by Western-blot experiment under different protein concentrations in EV71 virus
The situation of change of VP1 albumen.Experimental result is as shown in Figure 5:
In Fig. 5, the quality of added Ostm1 albumen is followed successively by 7ng, 21ng, 63ng, 189ng, 360ng and 567ng.
As shown in Figure 5 when the quality that albumen is added is 189ng and 360ng, compared with the control group that virus is only added, the albumen of VP1
Level significantly decreases, and illustrates in this concentration, and Ostm1 albumen makees the obvious inhibition that is replicated with of EV71 virus
With.
Pass through the double verification in mRNA level in-site and protein level, it was demonstrated that Ostm1 albumen is in certain concentration range
There is inhibiting effect really to the duplication of EV71 virus, expresses and be purified by baculovirus expression system to also demonstrate
The Ostm1 albumen come is active.
Claims (1)
1. the osteopetrosis correlation transmembrane protein Ostml that sequence is GenBank NP054747 treats or prevents EV71 sense in preparation
Contaminate the application in drug.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610216836.4A CN105853998B (en) | 2016-04-08 | 2016-04-08 | Osteopetrosis correlation transmembrane protein is treating or preventing the application in EV71 infection medicine |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610216836.4A CN105853998B (en) | 2016-04-08 | 2016-04-08 | Osteopetrosis correlation transmembrane protein is treating or preventing the application in EV71 infection medicine |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105853998A CN105853998A (en) | 2016-08-17 |
CN105853998B true CN105853998B (en) | 2019-09-24 |
Family
ID=56637221
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610216836.4A Expired - Fee Related CN105853998B (en) | 2016-04-08 | 2016-04-08 | Osteopetrosis correlation transmembrane protein is treating or preventing the application in EV71 infection medicine |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105853998B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107460256B (en) * | 2017-09-30 | 2019-12-20 | 泰山医学院 | Application of lncRNA as biomarker in detection of enterovirus EV71 |
CN111494433A (en) * | 2020-04-26 | 2020-08-07 | 吴建国 | Application of novel oncolytic virus in preparation of medicine for treating colorectal cancer |
CN111544581B (en) * | 2020-06-17 | 2023-07-04 | 广东龙帆生物科技有限公司 | New application of peroxidase acyl-coa oxidase 1 |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007071645A1 (en) * | 2005-12-20 | 2007-06-28 | Pharmos Bioscience A/S | Screening compounds for activity in modulating chloride ion transport |
CN102240286A (en) * | 2011-05-17 | 2011-11-16 | 武汉大学 | Application of matrine to medicament for treating or preventing enterovirus 71 type infection |
-
2016
- 2016-04-08 CN CN201610216836.4A patent/CN105853998B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007071645A1 (en) * | 2005-12-20 | 2007-06-28 | Pharmos Bioscience A/S | Screening compounds for activity in modulating chloride ion transport |
CN102240286A (en) * | 2011-05-17 | 2011-11-16 | 武汉大学 | Application of matrine to medicament for treating or preventing enterovirus 71 type infection |
Non-Patent Citations (2)
Title |
---|
Lysosomal Membrane Proteins and Their Central Role in Physiology;Michael Schwake等;《Traffic》;20130206(第14期);739-748 * |
阿尔茨海默病患者外周血OSTM1表达的变化;杨彩平等;《脑与神经疾病杂志》;20141231;第22卷(第6期);401-404 * |
Also Published As
Publication number | Publication date |
---|---|
CN105853998A (en) | 2016-08-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Chen et al. | Overview of lethal human coronaviruses | |
Narayanan et al. | SARS coronavirus accessory proteins | |
Smiley et al. | Characterization of an enteropathogenic bovine calicivirus representing a potentially new calicivirus genus | |
Schwartz-Cornil et al. | Bluetongue virus: virology, pathogenesis and immunity | |
TWI508974B (en) | Porcine circovirus type 2, immunogenic composition containing the same, test kit, and application thereof | |
Ababneh et al. | Presence of infectious bronchitis virus strain CK/CH/LDL/97I in the Middle East | |
An et al. | Novel goose-origin astrovirus infection in geese: the effect of age at infection | |
CN105853998B (en) | Osteopetrosis correlation transmembrane protein is treating or preventing the application in EV71 infection medicine | |
CN112552379A (en) | Application of synthetic peptide in preparing medicine for preventing and treating novel coronavirus infection | |
Pratelli et al. | The knotty biology of canine coronavirus: A worrying model of coronaviruses' danger | |
Glineur et al. | Novel pneumoviruses (PnVs): evolution and inflammatory pathology | |
JP2023532735A (en) | Recombinant enteroviruses and their uses | |
CN105602989B (en) | A kind of recombinant vector and its application in preparation or screening Tamiflu | |
Ma et al. | Isolation and characterization of an Aves polyomavirus 1 from diseased budgerigars in China | |
Yang et al. | Biophysical characterization of Japanese encephalitis virus (KV1899) isolated from pigs in Korea | |
Sentsui et al. | Mucosal disease induced in cattle persistently infected with bovine viral diarrhea virus by antigenically different cytopathic virus | |
Chen et al. | Construction and characterization of an improved DNA-launched infectious clone of duck hepatitis a virus type 1 | |
CN113174374B (en) | Bovine viral diarrhea virus attenuated strain and application thereof | |
ES2872500T3 (en) | Attenuated strain of PRRS and potential use in immunizing preparations | |
CN116121202A (en) | Coxsackie virus B group 1 strain and application thereof | |
TWI328039B (en) | ||
CN1242065C (en) | Pig breeding and respiratory syndrome recombined adenovirus and vaccine | |
Zeng et al. | Experimental infection of dogs with H3N2 canine influenza virus from China | |
PT1780216E (en) | Pantropic canine coronavirus | |
CN112587660B (en) | Application of Seneca valley virus 3D protein in preparation of immune response inducer or adjuvant |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190924 Termination date: 20200408 |
|
CF01 | Termination of patent right due to non-payment of annual fee |