CN111494433A - Application of novel oncolytic virus in preparation of medicine for treating colorectal cancer - Google Patents

Abstract

The invention belongs to the technical field of biotechnology and biological medicine, and discloses application of a novel oncolytic virus in preparation of a medicine for treating colorectal cancer, wherein the dose of the novel oncolytic virus is (5-10) × 10⁵PFU. The novel oncolytic virus was amplified in RD cells and virus purification and concentration was performed by ultracentrifugation. The enterovirus71 can infect and lyse colorectal cancer cells in an in vitro cell experiment, but has small influence on normal intestinal cells, which shows that EV71 has the advantages of specific infection and lysis of colorectal cancer cells. The EV71 can inhibit the tumor growth in a nude mouse in a xenograft tumor model, which shows that the EV71 can inhibit the tumor growth and delay the tumor progression in vivo. The EV71 is an RNA virus, does not encode oncogenes, is not integrated into a host genome, and has high safety; and virus cThe DNA is easy to operate and beneficial to the modification of viral genome.

Description

Application of novel oncolytic virus in preparation of medicine for treating colorectal cancer

Technical Field

The invention belongs to the technical field of biotechnology and biomedicine, and particularly relates to application of a novel oncolytic virus in preparation of a medicine for treating colorectal cancer.

Background

Colorectal cancer (colorectal cancer) is a malignant tumor of the intestinal tract derived from the colon or rectum, and the incidence and the fatality rate of the colorectal cancer are high in the front at present. The 5-year survival rate is about 90% when colorectal cancer is diagnosed early, and 13% when diagnosis is delayed, and most cases are determined only after the onset of symptoms, although colorectal cancer screening helps to reduce the number of patients diagnosed with advanced cancer. In medicine, the treatment mode of cancer is mainly determined by the occurrence part, stage and progression of cancer. In general, early stage cancers (solid tumors, pathological stages I-II, no or little lymph node metastasis, no distant metastasis) are treated by surgery, or assisted by preoperative or postoperative chemoradiotherapy, endocrine therapy, and the like. Conventional treatments (e.g., surgical removal of tumor mass, radiation therapy or chemotherapy) are often associated with serious side effects, including cancer recurrence and metastasis. Therefore, an efficient and safe means is urgently needed for the anti-tumor treatment of colorectal cancer.

Oncolytic Viruses (OV) are viruses that selectively infect and lyse cancer cells, where they replicate in cancer cells to produce progeny virus, which in turn is repeatedly infected in neighboring cells. In addition, viral infection can stimulate a cytotoxic immune response against cell antigens destroyed by viral infection. Therefore, it can not only kill tumor cells directly, but also indirectly activate the body's anti-tumor immune response.

In recent years, oncolytic viruses have received increasing attention as the cancer field has moved towards biological and immune based approaches to combat cancer. The common oncolytic viruses are two main types, DNA viruses and RNA viruses. At present, DNA virus is represented by genetically engineered herpes simplex virus type 1 (HSV-1), which has been approved by the FDA (T-VEC or Imlygic) in the United states in 2015 and put into clinical use. In addition, reports of DNA viruses as oncolytic viruses have been increasing, such as Adenovirus (Adenovirus) and Vaccinia virus (Vaccidia virus). With the progress of research, it has been found that various RNA virus families are also suitable candidates as oncolytic viruses, including echoviruses (echoviruses), coxsackieviruses (coxsackieviruses), Measles viruses (Measles viruses), Newcastle disease viruses (Newcastle disease viruses), reoviruses (reoviride), and the like. EV71 is an important member of the Picornaviridae (Picornaviridae) family of viruses.

Through the above analysis, the problems and defects of the prior art are as follows: (1) the prior art lacks relevant technical bases for the treatment effect of EV71 on various cancer patients, including colorectal cancer patients.

(2) The traditional surgical excision has limited curative effect and is easy to relapse.

(3) Chemotherapy is limited by toxicity to other normal tissues in the body, as is radiation therapy radiation.

(4) The DNA oncolytic virus encodes an oncogene, is easy to integrate into a host genome, and is difficult to ensure safety; and the viral genome is large, and is not easy to be genetically modified. However, the genetic characteristics of the currently known RNA oncolytic virus are unstable, and the specificity of infecting tumors is lacked.

The difficulty in solving the above problems and defects is: ensuring that the oncolytic virus has good tropism for colorectal cancer cells, and can locally infect and lyse the tumor cells; the gene does not encode oncogenes and is not integrated with host genomes, so that the safety is high; has relatively stable genetic characteristics and clear and definite life cycle.

The significance of solving the problems and the defects is as follows: the present invention aims to exert the greatest influence on malignant tumors and minimize adverse effects on normal cells. The virus as a novel oncolytic virus has good tropism for colorectal cancer cells, and can locally infect and lyse the tumor cells. Provides an anticancer therapeutic agent with safety, high efficiency and small toxic and side effects for the clinical treatment of human colorectal cancer.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides application of a novel oncolytic virus in preparation of a medicine for treating colorectal cancer. In particular to application of Human enterovirus EV71(Human enterovirus 71) as a novel oncolytic virus in treating colorectal cancer. The invention provides an anticancer therapeutic agent with safety, high efficiency and small toxic and side effects for clinically treating human colorectal cancer. EV71 can obviously infect and lyse different strains of colorectal cancer cells in an in vitro cell experiment, and can not cause toxic and side effects on two normal colon epithelial cells in the experiment within a certain time. Therefore, the virus is further developed to be an oncolytic virus for treating colorectal cancer, and has wide application prospect.

The invention is thus achieved, the use of a novel oncolytic virus for the manufacture of a medicament for the treatment of colorectal cancer.

The dosage of the novel oncolytic virus (EV71) is (5-10) × 10⁵PFU. The novel oncolytic virus sequence is SEQ ID NO: 1.

the novel oncolytic virus was amplified in RD cells and purified and concentrated using ultracentrifugation.

The invention also aims to provide an application of the drug for treating colorectal cancer in cell activity detection of colorectal cancer cell lines.

Another object of the present invention is to provide a use of the drug for treating colorectal cancer in the detection of cytotoxicity of normal intestinal epithelial cells.

The invention also aims to provide the oral agent for treating the colorectal cancer, which is prepared by using the medicine for treating the colorectal cancer in the application.

By combining all the technical schemes, the invention has the advantages and positive effects that:

the virological classification of Enterovirus type 71(EV71) provided by the present invention is Enterovirus (Enterovirus) belonging to Picornaviridae (Picornaviridae), and picornavirus is a small, non-enveloped, forward single-stranded RNA virus that can infect a variety of hosts. They have several advantages for the development of cancer treatments: their genome is not integrated into the host chromosome; does not encode an oncogene; viral cDNA is easy to handle. In addition, it can infect a variety of cell lines of different tumor origin and can produce a strong cytopathic effect (CPE); has a common life cycle and relatively stable genetic characteristics. EV71 belongs to enteroviruses, can infect and lyse colorectal cancer cells, has small influence on normal intestinal epithelial cells, and therefore can realize oral noninvasive antitumor treatment.

The invention selects a laboratory preserved virus strain EV71(Human enterovirus71strain Xiangyang-Hubei-09) to carry out an experiment for colorectal cancer oncolytic effect. The results show that the virus strain has significant oncolytic properties. The invention effectively applies the oncolytic effect of EV71 to colorectal cancer, and has obvious anticancer effect, so the oncolytic virus has great clinical application prospect.

Compared with the prior art, the invention also has the following advantages:

EV71 can infect and lyse colorectal cancer cells in vitro cell experiments, but has little effect on normal intestinal cells, indicating that EV71 has the advantage of specifically infecting and lysing colorectal cancer cells.

EV71 inhibited tumor growth in nude mice in the xenograft tumor model, suggesting that EV71 inhibited tumor growth and delayed tumor progression in vivo.

EV71 is RNA virus, does not encode oncogene, does not integrate into host genome, the security is high; and the virus cDNA is easy to operate and beneficial to the modification of virus genome.

Compared with the prior art, the invention has the following technical effects or experimental effects:

compared with the classical therapy, the EV71 is a novel oncolytic virus, can infect and crack colorectal cancer cells in-vitro cell experiments, has small influence on normal intestinal epithelial cells, has good tumor tropism and can specifically kill the colorectal cancer cells. Can inhibit the growth of tumors in nude mice in a xenograft tumor model and delay the tumor progression, namely the experimental effect is consistent in vitro or in vivo.

Compared with oncolytic virus therapy, the prior art lacks relevant technical bases for the treatment effect of EV71 on cancer patients. The invention proves that the EV71 has good tumor targeting property and anti-tumor effect. In particular, the EV71 has great application prospect as a novel oncolytic virus.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained from the drawings without creative efforts.

FIG. 1 is a schematic diagram of the detection result of EV71 of example 1 on a colorectal cancer cell D L D1;

the test result of the activity of EV71 on a colorectal cancer cell D L D1 is shown in figure 1A, and the test result of the cytotoxicity of EV71 on a colorectal cancer cell D L D1 is shown in figure 1B.

FIG. 2 is a schematic diagram of the result of detecting the EV71 of example 1 on a colorectal cancer cell HCT116 according to the embodiment of the invention.

Wherein, fig. 2A: shows a graph of the results of an activity assay of EV71 on HCT116 cells, a colorectal cancer cell; FIG. 2B: a graph showing the results of the cytotoxicity assay of EV71 on HCT116, a colorectal cancer cell.

FIG. 3 is a graph showing the results of detecting EV71 of example 1 on a colorectal cancer cell L oVo.

Wherein, FIG. 3A shows the result of detecting the cell activity of EV71 on a colorectal cancer cell L oVo, and FIG. 3B shows the result of detecting the cell toxicity of EV71 on a colorectal cancer cell L oVo.

FIG. 4 is a schematic diagram of the result of detecting the EV71 of example 1 on a colorectal cancer cell HT 29.

Wherein, fig. 4A: shows a graph of the results of an activity assay of EV71 on HT29 cells of a colorectal cancer cell; FIG. 4B: a graph showing the results of the cytotoxicity assay of EV71 on a colorectal cancer cell HT 29.

FIG. 5 is a schematic diagram of the detection result of EV71 of example 1 on a colorectal cancer cell SW48 provided by the embodiment of the invention.

Wherein, fig. 5A: shows a graph of the results of detection of the activity of EV71 on SW48 cells of a colorectal cancer cell; FIG. 5B: a graph showing the results of the EV71 cytotoxicity assay on SW48, a colorectal cancer cell.

FIG. 6 is a graph showing the results of the detection of EV71 of example 2 on FHC of normal colonic epithelial cells according to an embodiment of the present invention.

Among them, fig. 6A: shows a chart of the activity detection result of EV71 on FHC cells of normal colon epithelial cells; FIG. 6B: a chart showing the results of the cytotoxicity test of EV71 on FHC of a normal colon epithelial cell is shown.

FIG. 7 is a graph showing the results of detection of EV71 of example 2 on HCoEpic, a normal colonic epithelial cell, according to an embodiment of the present invention.

Among them, fig. 7A: shows a chart of the activity detection result of EV71 on HCoEpic cells of a normal colon epithelial cell; FIG. 7B: a chart showing the results of the cytotoxicity assay of EV71 on HCoEpic, a normal colon epithelial cell, is shown.

FIG. 8 is a first in vivo oncolytic effect assay of EV71 of example 3, provided by an embodiment of the present invention.

Fig. 9 is a second in vivo oncolytic effect assay of EV71 of example 3 provided by an embodiment of the present invention.

Fig. 10 is a third in vivo oncolytic effect assay of EV71 of example 3 provided by an embodiment of the present invention.

Fig. 11 is a fourth in vivo oncolytic effect assay of EV71 of example 3 provided by an embodiment of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. The reagents or instruments used in the present invention are not indicated by manufacturers, and are all conventional products commercially available. The present example illustrates the oncolytic effect of EV71 on colorectal cancer.

The prior art lacks relevant technical basis for the treatment effect of EV71 on colorectal cancer patients.

In view of the problems of the prior art, the present invention provides the use of a novel oncolytic virus for the preparation of a medicament for the treatment of colorectal cancer, and the present invention is described in detail below with reference to the accompanying drawings.

The invention provides a medicine for treating colorectal cancer, which is a novel oncolytic virus.

The novel oncolytic virus dosage is (5-10) × 10⁵PFU。

The novel oncolytic virus is amplified in RD cells; can produce a large amount of progeny virus in a short time (within 48 hours), and the virus is purified and concentrated by a super-high speed centrifugation method (80000 g for 2 hours), so that the oncolytic virus preparation can be conveniently and quickly obtained.

The Enterovirus71 (EV71) provided by the invention belongs to a member of Enterovirus (Enterovirus) in parvoviridae (Picornaviridae) and belongs to human Enterovirus A. The virus particle is an icosahedral three-dimensional symmetrical spherical structure, has no envelope and protrusion, has the diameter of about 24-30nm, has a nucleic acid of single-strand positive-strand RNA, and has a 5 ' non-coding region, a coding region 1A (polypeptide VP4), a 1B (polypeptide VP2), a 1C (polypeptide VP3), a 1D (polypeptide VP1), a 2A (specific protease), a 2B, a 2C (ATP hydrolase), a 3A, a 3B (5 ' binding protein), a 3C (specific protease), a 3D (RNA-dependent polymerase), a 3 ' non-coding region (83 nucleotides) and a poly A tail (AAAn) which are arranged in sequence from the 5 ' end to the 3 ' end. The background of the EV71 genome is clear in the invention, and the coding region of the virus, namely Open Reading Frame (ORF) is published in GenBank, and the specific sequence is as follows.

EV71 sequence is SEQ ID NO: 1, EV71(Hubei Xiangyang-09 strain) ORF sequence (encoding VP4, VP2, VP3, VP1,2A,2B,2C,3A,3B,3C,3D in this order) (GenBank: JN 230523.1).

The application of EV71 in treating colorectal cancer comprises the following steps:

A. EV71 colorectal cancer cell line (D L D1, HCT116, L oVo, HT29, SW48)The colorectal cancer cells (D L D1, HCT116, L oVo, HT29, SW48) were tested according to 1 × 10⁵Each cell/well was plated in 96-well cell culture plates, and after adherent growth, infection was performed with EV71 (MOI 0,0.005,0.01,0.02,0.04,0.05,0.1,0.2,0.4,0.5,1,2), three wells in each set, placed at 37 ℃ and 5% CO₂After 24 and 48 hours of incubation in the incubator, the cells were examined for cytotoxicity and for survival by CCK8 and by crystal violet staining, respectively. The result shows that the lysis effect of EV71 on colorectal cancer cells is enhanced along with the increase of the virus infection amount and the infection time.

B. Cytotoxicity test of EV71 on Normal intestinal epithelial cells (FHC, HCoEpic) were treated in accordance with 1 × 10⁵Each cell/well was seeded in a 96-well cell culture plate, and after cell attachment, infection was performed with EV71 (MOI 0,0.005,0.01,0.02,0.04,0.05,0.1,0.2,0.4,0.5,1,2), three wells in each set, placed at 37 ℃ and 5% CO₂After 24 and 48 hours of incubation in the incubator, the cells were examined for cytotoxicity and for survival by CCK8 and by crystal violet staining, respectively. The results show that EV71 has no obvious lysis effect on normal intestinal cells within the experimental time.

C. Effect of EV71 on tumors in vivo human colorectal cancer cells HT29 as 2 × 10⁶After the flank of 5-week-old BA L B/c male nude mice injected subcutaneously with one cell/dose, the nude mice were divided into three groups, one group was administered to each of 1 × 10⁶PFU EV71, one group given to each 5 × 10⁵PFU EV71, one group was given an equal volume of PBS as a blank control and injected directly into the tumor for treatment, two days in a row. The tumor size and the weight change of the nude mice were observed and measured, the nude mice were sacrificed after 16 days, the tumors were weighed and the volume was measured. The results show that the tumor volume and the tumor weight of two groups of nude mice injected with EV71 increase more slowly than those of the group injected with PBS; and the anti-tumor effect is more obvious along with the increase of the virus load.

The invention is further described with reference to specific examples.

Example 1 in vitro detection of the killing Effect of EV71

The method for detecting the killing effect of EV71 on colorectal cancer cells comprises the following steps:

1. experimental materials:

1.1 cell, virus:

d L D1, HCT116, L oVo, HT29, SW48 colorectal cancer cell lines were from American ATCC corporation Enterovirus71 (EV71) strain (Xiangyang-Hubei-09) was derived from EV71 infected brain tissue of Xiangyang City, Hubei, China, previously isolated in the national laboratory of virology, Wuhan university (GenBank: JN230523.1), and the virus stocks were expanded in RD cells.

1.2 reagent:

DMEM medium and Fetal Bovine Serum (FBS) were purchased from GIBCO; CCK8(Cell Counting Kit-8) assay Kit was purchased from Biotechnology engineering (Shanghai) Co., Ltd.

1.3 Experimental instruments:

the enzyme-labeling instrument is a product of Thermo company; the cell culture box is a product of Thermo company.

2. Experimental methods and results:

2.1 detection of the killing Effect of EV71 on colorectal cancer cells

(1) Colorectal cancer cells were prepared according to 1 × 10⁵Each cell/well was seeded in 96-well cell culture plates using DMEM medium supplemented with 10% serum (FBS) supplemented with 1% penicillin and streptomycin. At 37 ℃ 5% CO₂Culturing in a humidifying incubator.

(2) EV71 is added for treatment after the colorectal cancer cells are grown adherently. MOI is respectively: 0,0.005,0.01,0.02,0.04,0.05,0.1,0.2,0.4,0.5,1,2. Three replicates per group. The cells added with EV71 are placed at 37 ℃ and 5% CO₂Culturing in an incubator.

(3) After 24 hours, the CCK8 detection kit is used for detecting the cell activity, the operating principle of the kit is that under the condition that an electronic coupling reagent exists, the kit can be reduced by dehydrogenase in mitochondria to generate a highly water-soluble orange-yellow formazan product (formazan), and the finally formed color shade is in direct proportion to the cell proliferation condition and in inverse proportion to the cytotoxicity. OD values were read using a microplate reader at wavelength 450, indirectly reflecting the number of viable cells.

(4) After 48 hours, the cell activity of the colorectal cancer cells was measured in the same manner as in the step (3). The medium was aspirated, fixed, and stained with 0.5% crystal violet solution.

(5) Each group of data was blank with equal volume of DMEM medium without cells and virus plus CCK8, control without virus (MOI ═ 0), calculated as (plus virus group-blank group)/(control-blank group) × 100, mean and standard deviation were calculated by GraphPad Prism 6 software.

(6) And (5) utilizing the calculation result in the step (5) to draw a cell activity detection result graph of the EV71 on the colorectal cancer cells. As shown in fig. 1A, B, fig. 2A, B, fig. 3A, B, fig. 4A, B, fig. 5A, B.

The results of FIG. 1A, B show that, over time, the oncolytic effect of EV71 on colorectal cancer cells D L D1 is significant.

The results of FIG. 2A, B show: over time, the oncolytic effect of EV71 on colorectal cancer cell HCT116 was evident.

The results of FIG. 3A, B show that, over time, the oncolytic effect of EV71 on colorectal cancer cells L oVo is significant.

The results of FIG. 4A, B show: over time, the oncolytic effect of EV71 on colorectal cancer cells HT29 was evident.

The results of FIG. 5A, B show: over time, the oncolytic effect of EV71 on colorectal cancer cells SW48 was evident.

Example 2 in vitro detection of the Effect of EV71 on killing Normal intestinal cells

The invention provides an application of human enterovirus EV71 in human colorectal cancer, which comprises the following steps:

1. experimental Material

1.1 cells, viruses

Human primary intestinal epithelial cells FHC and HCoEpic were purchased from ATCC company, usa. EV71(Human enterovirus71strain Xiaongyang-Hubei-09) was isolated from the national laboratory of virology, university of Wuhan (GenBank: JN230523.1) and the virus stocks were expanded in RD cells.

1.2 reagents

DMEM medium and FBS were purchased from GIBCO; CCK8(Cell Counting Kit-8) assay Kit was purchased from Biotechnology engineering (Shanghai) Co., Ltd.

1.3 Experimental instruments

The enzyme-labeling instrument is a product of Thermo company; the cell culture box is a product of Thermo company.

2. Experimental methods and results

2.1 detection of the killing Effect of EV71 on Normal intestinal cells

(1) Normal intestinal cells are prepared according to the specification of 1 × 10⁵Each cell/well was seeded in 96-well cell culture plates using DMEM medium supplemented with 10% Fetal Bovine Serum (FBS) supplemented with 1% penicillin and streptomycin. At 37 ℃ 5% CO₂The humidified incubator of (1) for cultivation.

(2) Normal intestinal cell adherent growth was pooled and treated with addition of EV 71. MOI is respectively: 0,0.005,0.01,0.02,0.04,0.05,0.1,0.2,0.4,0.5,1,2. Three replicates per group. The cells added with EV71 are placed at 37 ℃ and 5% CO₂Culturing in an incubator.

(3) After 24 hours, the cytotoxicity of EV71 is detected by using a CCK8 detection kit, the operating principle of the kit is that under the condition that an electronic coupling reagent exists, the kit can be reduced by dehydrogenase in mitochondria to generate a highly water-soluble orange-yellow formazan product (formazan), and the finally formed color shade is in direct proportion to the cell proliferation condition and in inverse proportion to the cytotoxicity. OD values were read using a microplate reader at wavelength 450, indirectly reflecting the number of viable cells.

(4) After 48 hours, the cytotoxicity of normal intestinal cells was measured in the same manner as in the step (3). The medium was aspirated and stained with 0.5% crystal violet solution.

(5) The data for each group were calculated as percent Cell viability (Cell viability) using a blank of equal volume of DMEN medium without cells and virus plus CCK8 and a control without added virus (MOI 0) using × 100% Cell viability (plus virus-blank)/(control-blank) × and mean and standard deviation were calculated by GraphPad Prism 6 software.

(6) And (5) utilizing the calculation result in the step (5) to draw a cell activity detection result graph of the EV71 on the colorectal cancer cells. As shown in fig. 2A.

The results of FIG. 6A, B show: within 48 hours, the lysis of normal intestinal cell FHC by EV71 was not evident.

The results of FIG. 7A, B show: within 48 hours, the lysis of normal intestinal cells by EV71 was not evident.

Example 3 detection of oncolytic Effect of EV71 in vivo

The invention relates to an application of human enterovirus EV71 in human colorectal cancer, which comprises the following steps:

1. experimental materials:

1.1 cells, viruses, nude mice:

HT29 cells were purchased from ATCC, Inc., USA. Nude mice (5 weeks old, male) were purchased from experimental animals center, Guangdong province, China. EV71(Human enterovirus71strain Xiaongyang-Hubei-09) was isolated from the national laboratory of virology, university of Wuhan (GenBank: JN230523.1) and the virus stocks were expanded in RD cells.

1.2 reagent:

DMEM medium, FBS and PBS buffer (pH 7.4) were purchased from GIBCO.

1.3 Experimental instruments:

the cell culture box is a product of Thermo company.

2. Experimental methods and results:

2.1 construction of nude mouse xenogeneic tumor transplantation model:

(1) HT29 cells were cultured at 37 ℃ in 5% CO₂The humidified incubator of (1) was cultured in a DMEM medium containing 10% Fetal Bovine Serum (FBS), and 1% penicillin and streptomycin were added to the culture medium. The cells were in good condition, growing to around 80% for inoculation.

(2) The culture medium was changed to fresh medium before and after inoculation. The next day, the cells were fully digested to a single cell suspension, washed three times with PBS to remove serum, counted, and resuspended in the cell suspension with the corresponding volume of PBS.

(3) HT29 cells were injected subcutaneously into the flank of 5-week-old BA L B/c male nude mice, 2 × 10⁶One cell/one.

(4) The nude mice were observed for tumor formation every two days, and the tumor volume was measured by the formula (length × width)²)/2。

2.2 detection of EV71 in vivo oncolytic effects:

(1) after the tumor had grown to a certain volume, the nude mice were divided into three groups.

(2) One group is given to each 1 × 10⁶PFU EV71, one group given to each 5 × 10⁵PFU EV71, one group was given an equal volume of PBS and injected directly onto the tumor for treatment, two days in a row.

(3) Observing and measuring the tumor size and the weight change of the nude mice and recording, wherein the tumor volume calculation formula is the same as the above.

(4) Nude mice were sacrificed 16 days later and tumors were weighed.

(5) The tumor morphology results are shown in fig. 8, the volume size results are shown in fig. 9, the weight results are shown in fig. 10, and the mouse weight change is shown in fig. 11.

The results in fig. 8 show that there are differences in tumor morphology between the three groups, and the effect of EV71 treatment is significant.

The results in FIG. 9 show that: the tumor volumes of the three groups are different, and the EV71 treatment effect is obvious.

The results in FIG. 10 show that: the weight of the tumor is different among the three groups, and the EV71 has obvious treatment effect.

The results in FIG. 11 show that: the change trend of the body weight of the nude mice is obviously different in the treatment period, and the EV71 has obvious treatment effect.

The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Wu Jian Guo

Application of novel oncolytic virus in preparation of medicine for treating colorectal cancer

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>6579

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgggttcac aggtgtccac acagcgctcc ggttctcacg aaaattcaaa ctcagccact 60

gagggttcca ccataaacta cactaccatt aattactata aagactccta tgctgccaca 120

gcaggcaagc agagtctcaa gcaggatcca gacaaatttg caaatcctgt taaagacatt 180

ttcactgaaa tggcagcacc actgaagtcc ccatccgctg aggcatgtgg atacagcgat 240

cgagtggcgc aattaactat tggcaactcc accatcacca cacaagaagc ggcaaacatc 300

atagtcggct atggtgagtg gccttcctac tgctcggatt ctgacgctac agcagtggat 360

aaaccgacgc gcccggatgt ttcggtgaat aggttttata cattggacac taaattgtgg 420

gagaaatcgt ccaagggatg gtactggaag ttcccggatg tgttaactga aaccggggtt 480

tttgggcaaa atgcacaatt ccactacctc tatcgatcag ggttctgtat ccacgtgcaa 540

tgcaatgcta gtaaattcca ccaaggagca ctcctagtcg ctgtcctacc agagtatgtc 600

attgggacag tggcaggcgg tacaggaacg gaagacagtc acccccctta caagcagact 660

caacccggcg ccgatggctt cgaattgcaa cacccgtacg tgcttgatgc tggcattcca 720

atatcacaat taacagtgtg cccacatcag tggattaatt tgaggaccaa caattgtgcc 780

acaataatag tgccatacat aaacgcactg ccctttgatt ctgccttgaa ccactgtaac 840

tttggcctgt tagttgtgcc tattagccca ctagattacg accaaggagc aacgccagtg 900

atccctataa ctatcacatt ggctccaatg tgttctgaat ttgcaggtct taggcaagca 960

gttacgcaag ggtttcccac tgagttgaaa cctggcacaa accaattttt aaccactgac 1020

gacggcgttt cagcacccat tctaccaaac tttcacccca ccccgtgtat ccatatacct 1080

ggtgaagtta ggaatttgct agagctatgc caggtggaga ccattttgga ggtcaacaat 1140

gtacccacga atgccactag cttgatggag agactgcgct ttccggtctc agcacaagca 1200

gggaaaggtg agctgtgtgc ggtgttcaga gccgatcctg ggcgaaatgg accgtggcag 1260

tctaccttat taggtcagtt gtgcgggtac tacacccaat ggtcaggatc attggaagtc 1320

accttcatgt tcactggatc cttcatggct accggcaaga tgctcatagc ctatacacca 1380

ccaggaggtc ctttgcccaa ggaccgggcg accgccatgt tgggaacgca cgtcatctgg 1440

gattttgggc tgcagtcgtc tgttaccctt gtaataccat ggatcagcaa cactcactac 1500

agagcacatg cccgagatgg agtatttgac tactacacca cagggttggt cagcatatgg 1560

tatcagacaa attatgtggt tccaattggg gcacccaata cagcctatat aatagcacta 1620

gcggcagccc aaaagaattt cactatgaag ttgtgtaagg atgctagtga tatcctgcag 1680

acgggcacca tccagggaga tagggtggca gatgtaattg agagttccat aggtgacagc 1740

gtgagcagag ccctcactca agctctaccg gcacccacag gccagaacac acaggtgagc 1800

agtcaccgat tggacactgg taaggttcca gcactccaag ctgctgaaat tggagcatca 1860

tcaaatgcta gtgatgagag tatgattgag acacgctgtg tccttaattc gcacagcaca 1920

gctgagacca ctctcgatag tttcttcagc agagcggggt tagttggaga gatagacctc 1980

cctcttaaag gcacaactaa cccaaatggt tatgctaact gggatataga tataacaggt 2040

tacgcgcaaa tgcgtagaaa ggtggagcta ttcacctaca tgcgctttga cgcagagttc 2100

acttttgttg cgtgcacacc caccggggag gttgtcccac aattgctcca atatatgttt 2160

gtaccacctg gggcccccaa gccagattcc agggaatccc tcgcatggca aactgccact 2220

aacccctcag tttttgttaa gctgtcagac cctccagcac aggtttcagt accattcatg 2280

tcacctgcga gtgcttatca atggttttat gatggatatc ctacattcgg tgaacacaaa 2340

caggagaaag atcttgaata tggggcatgt cctaacaaca tgatgggtac attctcagtg 2400

cggaccgtag gaacctccaa gtccaagtac cctttagtgg ttaggattta catgaggatg 2460

aagcacgtca gggcgtggat acctcgccca atgcgcaacc aaaactacct attcaaagcc 2520

aacccaaatt atgctggcaa ctccattaag ccaactggtg ccagtcgcgc agcgatcacc 2580

actctcggga aatttgggca acagtccggg gccatttacg tgggtaattt tagagtggtt 2640

aaccgtcatc ttgccactca caatgattgg gcaaatcttg tttgggagaa cagctctcgc 2700

gacttgctcg tgtcatctac caccgcccaa ggttgtgaca cgattgcccg ttgcaattgc 2760

cagacagggg tgtattattg taattcaagg agaaaacact acccagtcag tttctcaaaa 2820

cccagcctaa tctacgtaga ggctagcgag tactacccag ccagatacca gtcacatctc 2880

atgctcgcac aaggtcactc agaacctggt gattgtggcg gtatccttag atgccaacat 2940

ggtgtcgtcg gtatagtgtc tactggtggc aatgggctcg ttggctttgc agacgtcagg 3000

gatctcctgt ggttggatga agaagctatg gagcagggcg tgtccgatta catcaagggt 3060

ctcggagatg ctttcgagac aggcttcact gatgcagtct cgagggaggt tgaagctctc 3120

aagaactatc ttataggatc tgaaggagca gttgagaaaa ttttaaaaaa tctcattaaa 3180

ctaatctctg cactggtgat tgtaatcaga agtgattacg acatggttac ccttacagca 3240

accttagctc tgataggttg tcatggcagt ccttgggctt ggatcaaagc caaaacagct 3300

tctatcttag gtatccctat cgctcaaaag caaagcgctt cctggctcaa gaagttcaat 3360

gacatggcca acgctgctaa ggggttagag tgggtttcca acaagatcag caaattcatt 3420

gattggctta aggagaaaat tataccagca gccaaggaga aggttgaatt cctaaacaac 3480

ttgaaacagt tgccactgct agagaatcag atctcaaact tggaacaatc tgctgcctca 3540

caagaggacc ttgaggtcat gtttgggaat gtgtcgtatc tagcccactt ctgtcgcaag 3600

ttccaaccgc tatatgccac agaagctaaa agagtttatg ccctggagaa aagaatgaat 3660

aattacatgc agttcaagag caaacaccga attgaacctg tatgtcttat tattaggggc 3720

tcaccaggca ctgggaagtc tctagccact ggcatcattg ctcgagcaat cgctgataag 3780

taccactcca gcgtgtactc acttccacca gacccagacc attttgatgg atacaaacaa 3840

caggtggtta cagtaatgga tgacttgtgt caaaaccctg atggcaagga tatgtcttta 3900

ttctgtcaaa tggtatccac cgtagacttc attccaccaa tggcttctct tgaggagaag 3960

ggagtttcct tcacatctaa gtttgttatc gcatccacca atgccagcaa catcatagtg 4020

ccaacagtgt ccgactctga cgctattcgc cgcagattct acatggattg tgacattgaa 4080

gtgacagact catacaaaac agatctaggc agactggatg ctgggcgggc cgccaaactg 4140

tgctctgaaa acaacaccgc aaatttcaaa cgctgcagcc cattagtgtg tgggaaagct 4200

atccagctcagagatagaaa atctaaggtt agatatagtg tggatacggt agtttcagag 4260

cttattaggg aatacaataa taggtccgcc attggcaaca caatcgaggc tctattccaa 4320

ggcccaccca agttcaggcc aattagaatt agccttgaag agaaaccagc cccagacgct 4380

attagcgatc tccttgccag cgtagatagt gaagaagtgc gccagtactg cagggatcaa 4440

ggctggatca tccctgaaac tcccaccaac gtggaacggc accttaatag agcagtgctt 4500

gtcttgcaat ccatcgccac agtagtggcg gttgtatcgc tagtgtatgt catctacaag 4560

ctctttgcag ggtttcaagg tgcgtattct ggtgctccta agcaagtact taagaaacct 4620

gctcttcgca cagcaacagt gcagggtccg agccttgatt ttgctctctc cttgctgagg 4680

aggaacatca ggcaagtcca aacagaccag ggccatttca ctatgttggg tgttagggat 4740

cgtttagcag tcctcccacg tcactcacaa cccggcaaaa ctatttgggt tgagcacaaa 4800

ctcgtgaaca tccttgatgc ggttgaattg gtggatgagc aaggagtcaa cctggaacta 4860

acccttatca ctcttgacac taatgaaaag tttagggata tcaccaaatt tatcccagaa 4920

aatatcagca ccgccagtga tgccacccta gtgatcaaca cggagcacat gccctcaatg 4980

tttgtaccgg tgggtgacgt tgtgcagtat ggcttcttga atctcagtgg taagcctacc 5040

catcgcacca tgatgtacaa ctttcctact aaagcgggac agtgtggagg agtggtgaca 5100

tctgttggga aggttatcgg tattcacatt ggcggtaatg gcagacaagg tttttgcgca 5160

ggtcttaaaa ggagttactt tgctagtgaa caaggagaga tccagtgggt taagcccaac 5220

aaagagactg gaagactcag catcaatggg ccaacccgca ccaagctaga gcccagtgtg 5280

ttccatgatg tcttcgaggg aaataaggaa ccagctgtct tgcacagtaa agacccccgc 5340

ctcgaggtag actttgagca ggccttgttc tctaagtatg taggaaatac actatatgag 5400

cctgacgagt acatcaaaga ggcagccctt cattatgcaa atcaattgaa gcagctagaa 5460

attaatacct ctcaaatgag tatggaggag gcctgctacg gtactgagaa ccttgaggct 5520

attgatcttc atactagtgc aggttacccc tatagtgccc tggggataaa gaaaagagac 5580

atcctagacc ctaccaccag agatgtgagt aaaatgaagt tctacatgga caaatatggt 5640

cttgatctcc cttactccac ttatgtcaag gacgagcttc gctcaattga taaaattaag 5700

aaagggaagt cccgtctgat tgaggctagt agtctaaatg attcagtgta ccttagaatg 5760

gctttcggtc atttgtatga gactttccac gcaaatcctg ggacgataac tggatcagcc 5820

gtggggtgta accctgacac attctggagc aagttgccaa ttttgctccc tggttcactc 5880

tttgcctttg actactcagg ttatgatgct agccttagcc ctgtctggtt cagggcgtta 5940

gaattggtcc ttagggagat agggtatagt gagggagcaa tctcactcat tgagggaatc 6000

aatcacacac accatgtgta tcgtaataag acctattgtg tgcttggtgg gatgccctca 6060

gggtgttcgg gaacatccat tttcaactca atgatcaaca acattattat cagagcacta 6120

ctcataaaaa catttaaggg cattgatttg gatgagctca acatggtcgc ctatggagat 6180

gatgtcctcg ccagctaccc cttcccaatt gattgcttgg agttagcaaa gacaggcaag 6240

gagtatggtc taaccatgac tcctgcagat aagtctcctt gctttaatga ggttaattgg 6300

gataatgcaa ccttcctcaa gaggggcttt ttacccgatg agcagtttcc atttttgatc 6360

caccctacca tgccaatgag ggagatccat gagtccattc gatggaccaa ggacgcacga 6420

aacactcaag accatgtgcg gtccttgtgt ctcctagcat ggcacaatgg taagcaagaa 6480

tatgaaaaat ttgtgagcac aatcaggtct gtcccagtag gaagagcatt ggctattcca 6540

aattatgaaa atctcagacg caattggctc gagttattt 6579

Claims (6)

1. Use of a novel oncolytic virus for the manufacture of a medicament for the treatment of colorectal cancer.

2. The use of claim 1, wherein the novel oncolytic virus is present in an amount of (5-10) × 10⁵PFU; the novel oncolytic virus sequence is SEQ ID NO: 1.

3. the use of claim 1, wherein the novel oncolytic virus is expanded in RD cells and purified and concentrated by ultracentrifugation.

4. Use of a medicament for the treatment of colorectal cancer according to any one of claims 1 to 3 for the detection of cell activity in colorectal cancer cell lines.

5. Use of a medicament as claimed in any one of claims 1 to 3 for the treatment of colorectal cancer in the detection of cytotoxicity of normal intestinal epithelial cells.

6. An oral preparation for treating colorectal cancer, which is prepared from the drug for treating colorectal cancer according to any one of claims 1 to 3.

Images