CN110092823B - Separated carp antiviral protein Pdcd6ip and antiviral activity - Google Patents

Abstract

The invention relates to the technical field of freshwater fish genetic engineering, and discloses a separated carp antiviral protein Pcdd 6ip and antiviral activity, wherein the nucleotide sequence of the gene of the carp antiviral protein Pcdd 6ip is SEQ ID NO: 1, 1-2610bp, and the coded amino acid sequence is SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof. Experiments show that the expression of the cloned Pdcd6ip protein can influence the proliferation of Spring Viremia of Carp Virus (SVCV), and the Pdcd6ip protein plays an important role in the process that cells resist the infection of SVCV, and has low influence on the cell activity of common cells. The gene or protein of the invention provides a new target for preparing SVCV resistant medicaments.

Description

Separated carp antiviral protein Pdcd6ip and antiviral activity

Technical Field

The invention relates to the technical field of freshwater fish genetic engineering, in particular to separated carp antiviral protein Pdcd6ip and antiviral activity.

Background

China is a big aquaculture country, but in recent years, along with the continuous development of aquaculture industry, the incidence rate of aquatic animal diseases, particularly viral diseases, shows a remarkable rising trend. This causes huge economic losses to both the aquaculture industry and import and export trade in our country, and severely restricts the health and sustainable development of the aquaculture industry in our country. Among them, Spring Viremia of Carp (SVC) is a fulminant hemorrhage caused by Spring Viremia of Carp Virus (SVCV). The disease is an acute epidemic disease which takes bleeding as a main clinical symptom and is accompanied by high infectivity, and can generate obvious symptoms in various cyprinid economic fishes and ornamental fishes such as carps, fancy carps, grass carps, silver carps, bighead carps, crucian carps and the like. SVC is often outbreak in spring at water temperature of 8-20 ℃, especially 13-15 ℃, and the outbreak of the SVC is closely related to the water temperature and the health condition of the fish body, and the more suitable the water temperature is, the worse the health condition of the fish body is, the more easily the SVC is infected. Diseased fish often gather at the water outlet, the body color is black, the eyeball is protruded, the anus is red and swollen, the abdomen is enlarged and severe ascites are caused, the breathing is slow, and the fish often loses balance and moves laterally. The disease is acute, the mortality rate can reach about 90 percent, the fishery production is seriously damaged, and destructive attack is caused, so the world animal health organization OIE classifies the disease as an important epidemic disease which needs to be declared. In 2008, the Ministry of agriculture announces 1125 that the disease is classified as an infectious disease of animals entering the country of the people's republic of China, and is also the only fish epidemic disease classified as an infectious disease so far, and is the first type of quarantine object for the port quarantine of fishes in China.

At present, the internationally prevailing effective measures for controlling the disease are to monitor the spring viremia of the carp, discover the viremia of the carp as early as possible, isolate or kill the viremia of the carp, and no medicine or method for effectively controlling the spring viremia of the carp is available. Therefore, the research for strengthening the antiviral mechanism of SVCV and the search for effective prevention and treatment methods have extremely important theoretical and practical significance.

The Programmed cell death 6 interacting protein Pdcd6ip (Programmed cell death 6-interacting protein), also known as Alix or Aip1, encoded by the Pdcd6ip gene, is a component of the Endosomal sorting transport complex III (endogenous sorting complexes required for transport III, ESCR-III), and plays an important role in regulating Programmed cell death. Studies have shown that Pdcd6ip can bind to proteins such as ALG-2, CIN85 in ESCR-III, endophilins, CHMP4B, and Tsg 101. furthermore, Pdcd6ip can bind to late domains of viruses including P (S/T) AP, YXXL, PPXY, etc., and is involved in the Endosomal transport mechanism of enveloped viruses such as human immunodeficiency virus PdHIV, equine infectious anemia virus, etc., budding and EIAV, etc., from the intracellular capsid of the vesicular cell replication mechanism 6ip, intracellular transport of viral components and budding of the whole virus are essential for normal replication of the virus. Therefore, Pdcd6ip plays an important role in regulating virus infection and replication, and the expression level thereof influence the infection and replication of the virus. Studies in EIAV showed that overexpression of Pdcd6ip inhibited its replication.

Therefore, those skilled in the art are devoted to develop an antiviral protein of carp, which has antiviral activity against spring viremia of carp, reduces SVCV infectivity, inhibits SVCV virus replication function, has low influence on cell activity of common cells, and provides a new drug target for treatment of SVCV virus infection.

Disclosure of Invention

In view of the above defects in the prior art, the technical problem to be solved by the present invention is to provide a carp antiviral protein (Pdcd6ip), which has antiviral activity against spring viremia of carp, reduces SVCV infectivity, inhibits SVCV virus replication function, does not affect the cell activity of common cells, provides a new drug target for SVCV treatment, and overcomes the defects in the prior art.

In order to achieve the aim, the invention provides an isolated carp antiviral protein Pcdd 6ip gene, wherein the nucleotide sequence of the Pcdd 6ip gene is SEQ ID NO: 1, 1-2610 bp.

The invention also provides a separated carp antiviral protein Pcdd 6ip, wherein the amino acid sequence coded by the protein Pcdd 6ip is SEQ ID NO: 2.

Further, the protein Pdcd6ip has a fragment capable of binding to the PPXY domain in the matrix protein M of Spring Viraemia of Carp Virus (SVCV).

The invention also provides a recombinant expression plasmid containing the nucleotide sequence of the Pdcd6ip gene.

The invention also provides a preparation method for preparing the recombinant expression plasmid, which is characterized by comprising the following steps of:

step one, extracting RNA of the carp, and carrying out reverse transcription on the RNA to obtain total cDNA of the carp;

designing a forward primer and a reverse primer of the Pdcd6ip gene, and amplifying by taking the total cDNA of the carp obtained in the step one as a template to obtain an amplification product;

and step three, performing molecular cloning on the amplification product obtained in the step two to obtain a recombinant expression plasmid.

Further, the second step further comprises introducing Nhe I enzyme cutting sites and EcoR I enzyme cutting sites respectively at the upstream and downstream of the carp total cDNA before amplification.

Further, the forward primer and the reverse primer are pCI-Pcdd 6ip-F and pCI-Pcdd 6ip-R respectively, wherein the DNA sequence of pCI-Pcdd 6ip-F is TTAGCTAGCCACCATGGCGACGTTTATTTCTGTC, the DNA sequence of the pCI-Pdcd6ip-R is CGGAATTCCTACTGTTGGGGGTAGTAGGGCT。

Further, the amplification product is a 2610bp DNA fragment.

The invention also provides application of the carp antiviral protein Pcdd 6ip gene in preparation of a carp spring viremia virus resistant pharmaceutical composition.

The invention also provides application of the carp antiviral protein Pcdd 6ip in preparation of a carp spring viremia virus resistant pharmaceutical composition.

Compared with the prior art, the invention has at least the following beneficial technical effects:

(1) the expression of the carp antiviral protein Pdcd6ip can influence the proliferation of Spring Viremia of Carp Virus (SVCV), inhibit the replication function of the SVCV virus and reduce the infectivity of the SVCV virus;

(2) the influence of the over-expression of the carp antiviral protein Pdcd6ip on the cell activity of common cells is extremely low;

(3) the Pdcd6ip gene and the Pdcd6ip protein provide new targets for preparing anti-spring viremia of carp virus medicines.

The conception, the specific structure and the technical effects of the present invention will be further described with reference to the accompanying drawings to fully understand the objects, the features and the effects of the present invention.

Drawings

FIG. 1 is a schematic diagram showing the amplification result of a Pdcd6ip gene fragment according to a preferred embodiment of the present invention;

FIG. 2 is a diagram showing the result of detecting the overexpression of Pdcd6ip by immunoblotting in accordance with a preferred embodiment of the present invention;

FIG. 3 is a data graph showing the effect of Pdcd6ip overexpression on cell activity measured by using CCK-8 as a cell proliferation/toxicity test reagent according to a preferred embodiment of the present invention;

FIG. 4 is a fluorescent image of the effect of Pdcd6ip protein on viral infection detected by indirect immunofluorescence according to a preferred embodiment of the present invention;

FIG. 5 is a data graph showing the effect of Pdcd6ip protein on virus proliferation detected by fluorescence quantitative PCR according to a preferred embodiment of the present invention;

FIG. 6 is a schematic diagram of the structure of an empty pCI-neo vector for use in accordance with a preferred embodiment of the present invention;

FIG. 7 is a schematic structural map of a recombinant expression plasmid pCI-Pdcd6ip prepared in accordance with a preferred embodiment of the present invention;

FIG. 8 is a schematic structural diagram of a recombinant expression plasmid pCI-flag-Pdcd6ip prepared in a preferred embodiment of the present invention.

Detailed Description

The technical contents of the preferred embodiments of the present invention will be made clear and easily understood by referring to the drawings attached to the specification. The present invention may be embodied in many different forms of embodiments and the scope of the invention is not limited to the embodiments set forth herein.

(1) RNA extraction of carp

And extracting the total RNA of the sample to be detected by adopting a classical Trizol method. Shearing Cyprinus Carpio tissue block with ophthalmologic scissors, directly placing into mortar, adding small amount of liquid nitrogen, rapidly grinding, transferring into centrifuge tube after grinding thoroughly, adding 1mL Trizol into 50-100mg tissue, mixing, standing at room temperature (15-25 deg.C) for 10min, centrifuging at 4 deg.C 12000 Xg for 5 min.

Adding 200 μ L chloroform into the supernatant, shaking, mixing, standing at room temperature for 15min, centrifuging at 4 deg.C and 12000 Xg for 15 min.

The upper aqueous phase was transferred to a new centrifuge tube, 500. mu.L of isopropanol was added, and the mixture was left on ice for 10min at 4 ℃ and 12000 Xg and centrifuged for 15 min.

The supernatant was discarded, and 1mL of 75% ethanol precooled on ice was added to wash the precipitate, which was centrifuged at 7500 Xg for 10min at 4 ℃.

The supernatant was discarded, air-dried at room temperature, and the RNA precipitate was dissolved in RNase-free water and immediately subjected to reverse transcription.

(2) Reverse transcription to obtain total cDNA of carp;

the cDNA synthesis was carried out using Invitrogen's reverse transcription kit according to the protocol, and the specific procedures were as follows:

sequentially adding 1 mu g of the extracted RNA, 1 mu L of random hexamer primer and supplementary RNase-free water into a PCR reaction tube to reach the total volume of 12 mu L; reacted at 65 ℃ for 5min, immediately placed on ice, then 4. mu.L of 5 × Reaction Buffer, 1. mu.L of RiboLock RNase Inhibitor, 2. mu.L of 10mM dNTP Mix and 1. mu.L of RevertAid M-MuLV RT were added, reacted at 25 ℃ for 5min, and then incubated at 42 ℃ for 45min to obtain the total Cyprinus Carpio cDNA.

(3) Carp pdcd6ip gene amplification

Firstly, utilizing Primer Express 5.0 software to design a forward Primer and a reverse Primer of a pdcd6ip gene, respectively introducing Nhe I enzyme cutting sites and EcoR I enzyme cutting sites at the upstream and downstream of the total carp cDNA, and carrying out PCR amplification by taking the total carp cDNA as a template, wherein the Primer sequence is as follows:

pCI-Pdcd6ip-F：TTAGCTAGCCACCATGGCGACGTTTATTTCTGTC；

pCI-Pdcd6ip-R：CGGAATTCCTACTGTTGGGGGTAGTAGGGCT。

the PCR reaction system is as follows: 50 μ L reaction system comprising ddH₂O30.5. mu.L, 10 × LA Buffer II (Mg2+ plus) 5. mu.L, dNTP mix (2.5mmol/L) 8. mu.L, upstream and downstream primers (10. mu. mol/L) 2. mu.L each; LA Taq Polymerase (5U/. mu.L) 0.5. mu.L, cDNA template 2. mu.L.

The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 3min for 35 cycles; extending for 10min at 72 ℃; keeping the temperature at 4 ℃.

The PCR amplification product was subjected to 1.0% agarose electrophoresis and stained with a nucleic acid stain. The voltage is 120V, electrophoresis is carried out for 30min, standard molecular weight is used as a control, 2610bp amplification product is obtained by amplification, and the amplification result is shown in figure 1.

(4) Construction of recombinant expression plasmids pCI-Pdcd6ip and pCI-flag-Pdcd6ip

According to the classical molecular cloning operation method, the PCR fragment is cut, purified and recovered by using a DNA gel recovery kit, and then the pCI-neo vector (purchased from Promega corporation, the map is shown in figure 6) and the recovered PCR fragment of the amplification product are subjected to double enzyme digestion for 3h at 37 ℃ by Nhe I and EcoR I, and the cut fragment is purified and recovered. The recovered fragments were ligated overnight at 16 ℃ with T4-DNA ligase. And transforming the ligation product into DH5 alpha escherichia coli competent cells, selecting a monoclonal for amplification culture, and carrying out PCR identification. The positive clone is further sequenced and aligned to determine the correctness of the recombinant plasmid sequence, and is named as pCI-Pdcd6ip, and all samples are sequenced by biological engineering (Shanghai) GmbH.

The construction method of the pCI-flag-Pdcd6ip plasmid is as follows: inserting a flag tag sequence in front of an initiation codon ATG in a pCI-Pdcd6ip primer, and respectively designing and synthesizing primers pCI-flag-Pdcd6 ip-F1: TTAGCTAGCCACCATGGATTACA AGGATGACGACGATAnd pCI-flag-Pdcd6 ip-F2:GGATGACGACGATAAGATGGCGACGTTTATTTCTGTC, using pCI-Pcdd 6ip plasmid with correct sequencing as a template, using pCI-flag-Pcdd 6ip-F2 and pCI-Pcdd 6ip-R primer pairs to perform first round PCR, after PCR product gel is recovered, using the first round PCR product as a template, using pCI-flag-Pcdd 6ip-F1 and pCI-Pcdd 6ip-R primer pairs to perform second round PCR, recovering PCR product gel, and the rest steps are the same as the construction method of pCI-Pcdd 6ip plasmid.

Maps of the recombinant expression plasmids pCI-Pdcd6ip and pCI-flag-Pdcd6ip are shown in FIGS. 7 and 8, respectively.

(5) Preparation of recombinant expression plasmids and empty vectors

mu.L of the well sequenced monoclonal antibody was inoculated into 3mL LB broth containing 50ug/mL ampicillin, cultured overnight on a shaker at 37 ℃ and 220rpm, and the recombinant plasmid pCI-Pdcd6ip and the empty vector pCI-neo plasmid were extracted using a plasmid extraction kit (purchased from Invitrogen) according to the following steps:

placing the overnight cultured bacterial liquid in a 1.5mL centrifuge tube, centrifuging at room temperature at 12000 Xg for 1min, discarding the supernatant, and repeating the above operations until all bacterial liquid is centrifuged;

adding 250 mu L of Resuspension Solution to the bacterial sediment for suspension precipitation;

adding 250 μ L lysine Solution, gently turning over 4-6 times, mixing to crack thallus completely until a clear Solution is formed, wherein the step is not longer than 5 min;

adding 350 μ L of Neutralization Solution, fully turning over 4-6 times, at room temperature, 12000 Xg, and centrifuging for 5 min;

the supernatant was aspirated and transferred to an adsorption column (provided in the kit), centrifuged at 12000 Xg for 1min at room temperature, and the filtrate was discarded;

washing twice with 500 μ L of Wash Solution, and discarding the filtrate; centrifuging at 12000 Xg for 1 min;

the column was transferred to a new 1.5mL centrifuge tube, 50. mu.L of Eluent was added to the center of the column membrane, and the column was allowed to stand at room temperature for 2min and centrifuged at 12000 Xg for 1 min.

(6) Transfection of EPC cells with recombinant expression plasmids and empty vectors

The specific steps are as follows (taking a 24-hole cell culture plate as an example):

determining the cell density according to the transfection purpose one day before transfection, if the cell is collected for western detection after transfection, performing transfection when the cell density reaches about 90% on the next day, and if protein positioning is observed after transfection, properly reducing the density;

transfection: a0.8. mu.g of DNA was first dissolved in 50. mu.L of Opti-MEM medium; dissolving 2 μ L Lipo 2000 in 50 μ L Opti-MEM medium, mixing, standing at room temperature for 5 min; then mixing the AB tubes, and standing at room temperature for 20 min;

during this period, the medium in the 24-well plate was changed to serum-free medium at 400. mu.L per well. If no dead cells exist in the hole, the cells can not be replaced, and the transfection efficiency is not influenced;

and adding the AB tube mixture into corresponding holes of a 24-hole plate, gently mixing uniformly at front, back, left and right, placing in an incubator, and changing into a culture medium containing 10% serum after 4-6 h.

(7) Detecting the influence of the overexpression of the recombinant plasmid pCI-Pdcd6ip on the activity of cells

The cell proliferation/toxicity detection reagent CCK-8 (purchased from Dojindo company) is used for detecting the influence of overexpression on cell activity, the CCK-8 reagent can be used for simple and accurate cell proliferation and toxicity analysis, the basic principle is that the reagent contains 2- (2-Methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2, 4-disulfonic acid benzene) -2H-tetrazole monosodium salt (WST-8), the reagent can be reduced into water-soluble orange yellow formazan by dehydrogenase in cells under the action of an electron carrier 1-Methoxy PMS, the amount of generated formazan is in direct proportion to the number of cells, and the number of living cells can be indirectly determined. The method comprises the following specific steps:

one day before transfection, inoculating 100 μ L of EPC cell suspension into 96-well cell culture plate, culturing overnight, and transfecting the recombinant expression plasmid pCI-Pdcd6ip and the empty vector pCI-neo according to the method when the cell density reaches about 70% -90%;

add 10. mu.L of CCK-8 to each well at 12h, 36h and 72h post-transfection, respectively;

the plate was incubated in an incubator for 1 hour, and absorbance at 450nm was measured using a microplate reader.

The results are shown in FIG. 3, which shows that the overexpression of the recombinant plasmid pCI-Pdcd6ip does not affect the activity of the cells.

(8) Western blot immunoblotting experiment

The method comprises the following specific steps:

after transfecting the EPC cells by the recombinant expression plasmid pCI-flag-Pdcd6ip and the empty vector pCI-neo for 24 hours, discarding the supernatant, washing twice by PBS (phosphate buffer solution) for 3min each time, adding RIPA cell lysate, fully contacting the lysate with the cells by blowing with a gun, incubating on ice for 10min to lyse the cells, transferring the lysate to a 1.5mL EP tube, 12000 Xg, centrifuging for 5min, uniformly mixing 20 mu L of centrifuged supernatant with 5 mu L of 5 Xprotein loading buffer solution, boiling at 95 ℃ for 5min, and carrying out SDS-PAGE. SDS-PAGE gels were prepared using SDS-PAGE gel formulation kits (purchased from Shanghai assist in san Francisco);

cutting filter paper and PVDF membrane completely matched with gel size, and balancing in transfer buffer solution for 15 min;

after the gel electrophoresis is finished, disassembling a gel interlayer, removing concentrated gel, and balancing the gel in a proper amount of transfer buffer at room temperature for 10 min;

the transfer buffer solution is used for wetting the ink plate, the transfer interlayer is assembled, and air bubbles need to be discharged timely. Transferring protein at constant pressure for 40min at 20V;

after the membrane is transferred, taking out the membrane, putting the membrane into a hybridization box, adding 10mL of 5% PBST-BSA blocking solution for blocking, and blocking for 2h at 37 ℃ or overnight at 4 ℃;

pouring off the blocking solution, adding diluted flag tag antibody (primary antibody, purchased from Sigma and diluted in a volume ratio of 1: 1000), and slowly shaking at 37 ℃ for 2 h;

PBST was washed 3 times for 3min each, and diluted Alkaline Phosphatase (AP) -labeled goat anti-mouse IgG antibody (secondary antibody, purchased from Biyuntian corporation, diluted at a volume ratio of 1: 800) was added to the hybridization chamber and slowly shaken at 37 ℃ for 1 h;

the secondary antibody was decanted and washed 3 times for 3min in PBST. 10mL of NBT/BCIP chromogenic substrate was added and the bands developed within 5-10 min. The immunoblot results are shown in FIG. 2, indicating that Pdcd6ip was overexpressed following transfection.

(9) Indirect Immunofluorescence (IF)

Washing cells with PBS for 2 times, 3min each time, adding 300 μ L of 4% paraformaldehyde into each well, and fixing at room temperature for 30 min;

removing the fixative by aspiration, washing the cells with PBS 3 times, adding 300 μ L PBS containing 0.2% Triton X-100 per well, and permeabilizing for 15 min;

washing with PBS for 3 times, adding blocking solution containing 4% BSA, and blocking at 37 deg.C for 2 hr;

removing the blocking solution by suction, adding a primary antibody (prepared in the laboratory, rabbit anti-SVCV M protein antibody is diluted in a volume ratio of 1: 1000) diluted by the blocking solution, and incubating for 2h at 37 ℃;

removing primary antibody by suction, washing with PBS 3 times for 3min each time, adding fluorescent secondary antibody (Alexa Fluor 488-labeled donkey anti-rabbit purchased from Invitrogen corporation, diluted at a volume ratio of 1:2000), and incubating at 37 deg.C for 1 h;

absorbing secondary antibody, washing with PBS for 3 times (3 min each time), adding DAPI (1:2000) staining solution diluted with PBS for staining at room temperature for 10min, and washing with PBS for 3 times (3 min each time);

add 500. mu.L PBS to each well, place under a fluorescent inverted microscope for observation and photographing. As a result, as shown in FIG. 4, expression of Pdcd6ip inhibited infection by SVCV.

(10) Effect of overexpression of Pdcd6ip on SVCV proliferation

After transfecting the recombinant expression plasmid pCI-Pdcd6ip and the empty vector pCI-neo to EPC cells for 24h, inoculating Spring Viremia of Carp Virus (SVCV) with MOI of 0.5, and collecting supernatants of an experimental group and a control group 12h, 24h and 36h after infection respectively to perform SVCV virus titer determination. The specific operation steps are as follows:

the recombinant expression plasmid pCI-Pdcd6ip and the empty vector pCI-neo transfect EPC cells;

after 24h of transfection, the cells were washed twice with serum-free M199, and Spring Viremia of Carp Virus (SVCV) was inoculated at MOI of 0.5, adsorbed at 20 ℃ for 1 hour, and changed to M199 containing 2% FBS;

supernatants of the experimental group and the control group were collected at 12h, 24h and 36h after infection, and viral RNA was extracted using a viral RNA extraction kit (purchased from Qiagen);

reverse transcription was performed using a reverse transcription kit (purchased from Invitrogen) to synthesize cDNA;

and (3) performing virus titer determination by using a fluorescent quantitative PCR method.

The fluorescent quantitative PCR primer sequence is as follows:

a forward primer: N-TF 1: ATCAGGCCGATTATCCTTCCA, respectively;

reverse primer: N-TR 1: AGATAAGCATTCACATGCTGTAT, respectively;

sequentially adding 10 mu L of 2 XSSYBR Premix Ex Taq (TAKARA company) into a 200 mu L fluorescent PCR reaction tube, adding 0.4 mu L of each of a forward primer and a reverse primer with the concentration of 10 mu mol/L, 0.4 mu L of ROX reference dye II and 100 ng/mu L of cDNA 2 mu L of a sample to be detected, supplementing double distilled water to 20 mu L, and placing the mixture in a 7500Fast fluorescent quantitative PCR instrument for reaction under the reaction condition of 95 ℃ for 30 s; then 40 cycles of 95 ℃ for 5s, 60 ℃ for 30s and 72 ℃ for 30s are carried out, after the completion, the melting curve analysis is immediately carried out by an instrument, and finally the Tm value of the amplification product is calculated by ABI 75002.0.6 software; the virus titer of cells transfected with the empty vector pCI-neo in 24 hours is set to be 1, and as shown in FIG. 5, the over-expression of Pcdd 6ip can obviously inhibit the proliferation of the virus, which indicates that Pcdd 6ip has obvious antiviral function.

In the embodiment, the antiviral protein Pcdd 6ip gene separated from the carp by using a gene cloning technology can be combined with a PPXY structure domain existing in SVCV virus matrix protein M, and a series of tests prove that the expression of the cloned Pcdd 6ip protein gene has excellent antiviral property, reduces SVCV infectivity, inhibits SVCV virus replication function, influences the proliferation of the SVCV virus, and plays an important role in the process of resisting SVCV infection by cells. Moreover, the effect of the overexpression of Pdcd6ip on the cell activity of normal cells is extremely low. The Pdcd6ip protein and the gene thereof provide a new target for preparing an anti-SVCV medicament.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Sequence listing

<110> research institute for aquatic products in Shanghai City

<120> isolated carp antiviral protein Pdcd6ip and antiviral activity

<130> 20190417

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 2610

<212> DNA

<213> carp (Cyprinus carpio)

<400> 1

atggcgacgt ttatttctgt cccgttgaaa aagtcctcag aggtggactt agcgaaaccg 60

ttgttgaaat ttgtaactgc cacgtatcct cccggtgagg agcaggcgga gtatgtccgt 120

gccgtggaag agctcaacaa gctccgcaaa agtgctctgg ggaggccgct ggacaaacac 180

gagagctcgc tggaaatcct gcttcgatat tatgatcagc tctgtgcaat cgaacccaaa 240

tttccttttc cagagttgtg tctgacattc acttggaaag atgcttttga taaaggatca 300

ctttttggag gatcagtaaa gcttgcattg gcaagtgtgg gctatgagaa gacgtgcgtg 360

ttgtttaatg tcggtgcgct ggcgggtcag cttgcttctg agcagaatct cgacaatgac 420

gaaggactta agactgccgc caagttctac cagctggcga gtggtgcatt tgctcatata 480

aaggacactg tgctgtctgc actgaatcga gagcccacca tggacatctc ccccgagacg 540

gtgggcacgc tcagtcagat catgctcagc caggcacagg aggtcttcgt tctcaaggcc 600

actgctgata agatgaagga cgccattgtc gctaaactcg ccaaccaggc agcagattac 660

tacggcgacg cttttaagca atgtcaatac aaagagaatc tgcccaagga agcgcttcca 720

gtcctggccg ccaagcactg tatgatgcag gccaccgccg agctgcacca gtcagccttg 780

gccaatcaga agaaaaagtt cggagaggag attgctcggc tgcagcacgc cacagagctg 840

gtgaagactg cggcttccag atacgatgag tacgttaacg taaaggatct gtcagataag 900

atcagtcgtg cgctcacggc tgcaaagaag gacaacgatt tcatttacca tgatcgtgtg 960

cccggagtca aagacctgga gcacattggc aaagcatctc tggtcaaagc aactgcagtg 1020

cagattccac tcagccagaa gttcacagat ctgtttgaga agatggtgcc gatggcagta 1080

cagcagtcag tgagcgcagc caattccagg aaggctgaca cagtcaacag attgattggc 1140

agcatgagag aagcaacaaa tctctgcaat ggggtgttgg cgtctttgaa tctgccggct 1200

gcactagaag atctgtcagg agacgctgtg cctcagtcca tcctggataa gagtcgtgca 1260

gttattcagc acggaggcct gcagaacatc gaacagctga ttcgagatct ccctgaactt 1320

ctgcagagga accgtgagat cctggatgag tccttgaaga tattagatga agaggaaacg 1380

acagacaatg aactcagagc taaattcaat cagcgctgga acagaactcc ctctggagat 1440

ctgtataaat cactcagagc agagggaaat aatttttgca atatactgga caaggcagtg 1500

caggctgatc aggtgatgaa agggcgttac aatgaacatt gtgggatgat tgctttgctc 1560

tgcaagccag agaatgagat cagtgccgcc ataccgtctg ccaaccctgc caagactctg 1620

cagggcagtg aggtggtgaa cgtgctgaga gctcagctgg cacagctgga tgaggtgaag 1680

agggaacggg aagttctgga gggagaggtg aaggcggtga cctttgacct gacgacaaag 1740

ttccttaccg cactcgctca agatggtgcc attaacgagg aggccatgac caccaatgag 1800

ctggacactc gctacggctc tcacacacaa cgtgttcagc agaacttgcg ccgacaggag 1860

gaactgctgt cacagataca ggtgtctcac caggagttct cagcactgaa gcaatccaac 1920

tctgaggcta atagcagaga ggaggtgtta aagaagcttg ctgcggccca tgatagctac 1980

atcgagatca gctccaatac caaagagggc actaaattct acaatgatct gacagaaatc 2040

ctgctgaagt ttcaaaataa gtgcagcgac attgtcttcg ctcgcaaaac tgagagggat 2100

gaactgctta aggagctgca gcagagcatc gctcgtgagc cgagcgctcc ttcattcaat 2160

gtcccatcat accagtccaa cacccctgct cctgtcccag gaggcccaac ccctgcaccc 2220

aggactgtgt ttaacgcgca gcggcctcag gctaagcccc agcccccagc gagaccacca 2280

cccccgagca tcactcctca ggctgccagt gcttcagctc cagtcagttc ttcgatgggt 2340

cccggaagca ctaatcctcc acctgttgca cccactggac cctcacaggc tcaaggacca 2400

ccctatccct cttatcaagg ctacccaggg tatccaggtt accagatgcc aatggcctat 2460

aacccctatg catacgggca gtttaatatg ccctacatgc cctatcaagc ccaggggcag 2520

gctgggtacc ctggagcccc tcctacacag cagccctacc cttaccccca acaaccccca 2580

cagcagcagc cctactaccc ccaacagtag 2610

<210> 2

<211> 869

<212> PRT

<213> carp (Cyprinus carpio)

<400> 2

Met Ala Thr Phe Ile Ser Val Pro Leu Lys Lys Ser Ser Glu Val Asp

1 5 10 15

Leu Ala Lys Pro Leu Leu Lys Phe Val Thr Ala Thr Tyr Pro Pro Gly

20 25 30

Glu Glu Gln Ala Glu Tyr Val Arg Ala Val Glu Glu Leu Asn Lys Leu

35 40 45

Arg Lys Ser Ala Leu Gly Arg Pro Leu Asp Lys His Glu Ser Ser Leu

50 55 60

Glu Ile Leu Leu Arg Tyr Tyr Asp Gln Leu Cys Ala Ile Glu Pro Lys

65 70 75 80

Phe Pro Phe Pro Glu Leu Cys Leu Thr Phe Thr Trp Lys Asp Ala Phe

85 90 95

Asp Lys Gly Ser Leu Phe Gly Gly Ser Val Lys Leu Ala Leu Ala Ser

100 105 110

Val Gly Tyr Glu Lys Thr Cys Val Leu Phe Asn Val Gly Ala Leu Ala

115 120 125

Gly Gln Leu Ala Ser Glu Gln Asn Leu Asp Asn Asp Glu Gly Leu Lys

130 135 140

Thr Ala Ala Lys Phe Tyr Gln Leu Ala Ser Gly Ala Phe Ala His Ile

145 150 155 160

Lys Asp Thr Val Leu Ser Ala Leu Asn Arg Glu Pro Thr Met Asp Ile

165 170 175

Ser Pro Glu Thr Val Gly Thr Leu Ser Gln Ile Met Leu Ser Gln Ala

180 185 190

Gln Glu Val Phe Val Leu Lys Ala Thr Ala Asp Lys Met Lys Asp Ala

195 200 205

Ile Val Ala Lys Leu Ala Asn Gln Ala Ala Asp Tyr Tyr Gly Asp Ala

210 215 220

Phe Lys Gln Cys Gln Tyr Lys Glu Asn Leu Pro Lys Glu Ala Leu Pro

225 230 235 240

Val Leu Ala Ala Lys His Cys Met Met Gln Ala Thr Ala Glu Leu His

245 250 255

Gln Ser Ala Leu Ala Asn Gln Lys Lys Lys Phe Gly Glu Glu Ile Ala

260 265 270

Arg Leu Gln His Ala Thr Glu Leu Val Lys Thr Ala Ala Ser Arg Tyr

275 280 285

Asp Glu Tyr Val Asn Val Lys Asp Leu Ser Asp Lys Ile Ser Arg Ala

290 295 300

Leu Thr Ala Ala Lys Lys Asp Asn Asp Phe Ile Tyr His Asp Arg Val

305 310 315 320

Pro Gly Val Lys Asp Leu Glu His Ile Gly Lys Ala Ser Leu Val Lys

325 330 335

Ala Thr Ala Val Gln Ile Pro Leu Ser Gln Lys Phe Thr Asp Leu Phe

340 345 350

Glu Lys Met Val Pro Met Ala Val Gln Gln Ser Val Ser Ala Ala Asn

355 360 365

Ser Arg Lys Ala Asp Thr Val Asn Arg Leu Ile Gly Ser Met Arg Glu

370 375 380

Ala Thr Asn Leu Cys Asn Gly Val Leu Ala Ser Leu Asn Leu Pro Ala

385 390 395 400

Ala Leu Glu Asp Leu Ser Gly Asp Ala Val Pro Gln Ser Ile Leu Asp

405 410 415

Lys Ser Arg Ala Val Ile Gln His Gly Gly Leu Gln Asn Ile Glu Gln

420 425 430

Leu Ile Arg Asp Leu Pro Glu Leu Leu Gln Arg Asn Arg Glu Ile Leu

435 440 445

Asp Glu Ser Leu Lys Ile Leu Asp Glu Glu Glu Thr Thr Asp Asn Glu

450 455 460

Leu Arg Ala Lys Phe Asn Gln Arg Trp Asn Arg Thr Pro Ser Gly Asp

465 470 475 480

Leu Tyr Lys Ser Leu Arg Ala Glu Gly Asn Asn Phe Cys Asn Ile Leu

485 490 495

Asp Lys Ala Val Gln Ala Asp Gln Val Met Lys Gly Arg Tyr Asn Glu

500 505 510

His Cys Gly Met Ile Ala Leu Leu Cys Lys Pro Glu Asn Glu Ile Ser

515 520 525

Ala Ala Ile Pro Ser Ala Asn Pro Ala Lys Thr Leu Gln Gly Ser Glu

530 535 540

Val Val Asn Val Leu Arg Ala Gln Leu Ala Gln Leu Asp Glu Val Lys

545 550 555 560

Arg Glu Arg Glu Val Leu Glu Gly Glu Val Lys Ala Val Thr Phe Asp

565 570 575

Leu Thr Thr Lys Phe Leu Thr Ala Leu Ala Gln Asp Gly Ala Ile Asn

580 585 590

Glu Glu Ala Met Thr Thr Asn Glu Leu Asp Thr Arg Tyr Gly Ser His

595 600 605

Thr Gln Arg Val Gln Gln Asn Leu Arg Arg Gln Glu Glu Leu Leu Ser

610 615 620

Gln Ile Gln Val Ser His Gln Glu Phe Ser Ala Leu Lys Gln Ser Asn

625 630 635 640

Ser Glu Ala Asn Ser Arg Glu Glu Val Leu Lys Lys Leu Ala Ala Ala

645 650 655

His Asp Ser Tyr Ile Glu Ile Ser Ser Asn Thr Lys Glu Gly Thr Lys

660 665 670

Phe Tyr Asn Asp Leu Thr Glu Ile Leu Leu Lys Phe Gln Asn Lys Cys

675 680 685

Ser Asp Ile Val Phe Ala Arg Lys Thr Glu Arg Asp Glu Leu Leu Lys

690 695 700

Glu Leu Gln Gln Ser Ile Ala Arg Glu Pro Ser Ala Pro Ser Phe Asn

705 710 715 720

Val Pro Ser Tyr Gln Ser Asn Thr Pro Ala Pro Val Pro Gly Gly Pro

725 730 735

Thr Pro Ala Pro Arg Thr Val Phe Asn Ala Gln Arg Pro Gln Ala Lys

740 745 750

Pro Gln Pro Pro Ala Arg Pro Pro Pro Pro Ser Ile Thr Pro Gln Ala

755 760 765

Ala Ser Ala Ser Ala Pro Val Ser Ser Ser Met Gly Pro Gly Ser Thr

770 775 780

Asn Pro Pro Pro Val Ala Pro Thr Gly Pro Ser Gln Ala Gln Gly Pro

785 790 795 800

Pro Tyr Pro Ser Tyr Gln Gly Tyr Pro Gly Tyr Pro Gly Tyr Gln Met

805 810 815

Pro Met Ala Tyr Asn Pro Tyr Ala Tyr Gly Gln Phe Asn Met Pro Tyr

820 825 830

Met Pro Tyr Gln Ala Gln Gly Gln Ala Gly Tyr Pro Gly Ala Pro Pro

835 840 845

Thr Gln Gln Pro Tyr Pro Tyr Pro Gln Gln Pro Pro Gln Gln Gln Pro

850 855 860

Tyr Tyr Pro Gln Gln

865

<210> 3

<211> 34

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

ttagctagcc accatggcga cgtttatttc tgtc 34

<210> 4

<211> 31

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

cggaattcct actgttgggg gtagtagggc t 31

<210> 5

<211> 37

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

ttagctagcc accatggatt acaaggatga cgacgat 37

<210> 6

<211> 37

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ggatgacgac gataagatgg cgacgtttat ttctgtc 37

Claims (9)

1. A separated carp antiviral protein Pdcd6ip gene, wherein the nucleotide sequence of the Pdcd6ip gene is SEQ ID NO: 1, 1-2610 bp.

2. An isolated antiviral protein Pcdd 6ip for carp, wherein the amino acid sequence of the protein Pcdd 6ip is SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

3. A recombinant expression plasmid comprising the nucleotide sequence of the Pdcd6ip gene of claim 1.

4. A method of making the recombinant expression plasmid of claim 3, comprising the steps of:

step one, extracting RNA of a carp, and performing reverse transcription on the RNA to obtain total cDNA of the carp;

designing a forward primer and a reverse primer of the Pdcd6ip gene, and amplifying by taking the total cDNA of the carp obtained in the step one as a template to obtain an amplification product;

and step three, performing molecular cloning on the amplification product obtained in the step two to obtain a recombinant expression plasmid.

5. The method for preparing the recombinant expression plasmid according to claim 4, wherein the second step further comprises introducing Nhe I and EcoR I cleavage sites into the upstream and downstream of the total Cyprinus carpio cDNA, respectively, before amplification.

6. The method for preparing the recombinant expression plasmid of claim 4, wherein the forward primer and the reverse primer are pCI-Pdcd6ip-F and pCI-Pdcd6ip-R, respectively, and the DNA sequence of the pCI-Pdcd6ip-F is TTAGCTAGCCACCATGGCGACGTTTATTTCTGTC, the DNA sequence of the pCI-Pdcd6ip-R is CGGAATTCCTACTGTTGGGGGTAGTAGGGCT。

7. The method of claim 4, wherein the amplification product is a 2610bp DNA fragment.

8. An application of the antiviral protein Pdcd6ip gene of carp as claimed in claim 1 in preparation of a pharmaceutical composition for resisting spring viraemia of carp virus.

9. An application of the antiviral protein Pdcd6ip of carp in claim 2 in preparation of a pharmaceutical composition for resisting spring viraemia of carp virus.

Images