Summary of the invention
The object of the present invention is to provide for the siRNA for reducing OSBPL2 gene expression, the corresponding shRNA of the siRNA,
The DNA for encoding the shRNA, the recombinant vector including the DNA, the recombinant slow virus including the recombinant vector, including it is described
SiRNA, shRNA, the DNA for encoding shRNA, the host cell of recombinant vector and recombinant slow virus and their application.
To achieve the goals above, the first aspect of the present invention provides a kind of siRNA, and the siRNA is specifically reduced
OSBPL2 gene expression.
Of the invention focuses on providing new breast cancer treatment target, and is not limited to specific siRNA sequence, Ke Yigen
The siRNA of the target is directed to according to the various methods design of this field routine.The siRNA usually has the nucleotide of 19~27bp
Sequence.
Specifically, the nucleotide sequence of the siRNA includes at least following set of nucleotide sequence:
(1) first group of nucleotide sequence
As shown in SEQ ID NO:1 and SEQ ID NO:2, the SEQ ID NO:1 is first group of nucleotide sequence
5'-GAGCUGCUCAAACAUAAUGAA-3', the SEQ ID NO:2 are 5'-UUCAUUAUGUUUGAGCAGCUC-3';
(2) second groups of nucleotide sequences
As shown in SEQ ID NO:3 and SEQ ID NO:4, the SEQ ID NO:3 is second group of nucleotide sequence
5'-CACUUUAAACCGUGUGGAUUA-3', the SEQ ID NO:4 are 5'-UAAUCCACACGGUUUAAAGUG-3';
(3) third group nucleotide sequence
As shown in SEQ ID NO:5 and SEQ ID NO:6, the SEQ ID NO:5 is the third group nucleotide sequence
5'-GGGCAAAAGCGUGGAGGCGGA-3', the SEQ ID NO:6 are 5'-UCCGCCUCCACGCUUUUGCCC-3'.
Second aspect of the present invention provides a kind of shRNA, is the single stranded RNA with loop-stem structure, the nucleosides of the shRNA
Acid sequence includes at least following set of nucleotide sequence:
(1) the 5th group of nucleotide sequence
As shown in SEQ ID NO:9 and SEQ ID NO:10, the SEQ ID NO:9 is the 5th group of nucleotide sequence
5'-CCGGGAGCUGCUCAAACAUAAUGAACUCGAGUUCAUUAUGUUUGAGCAGCUCU UUUUG-3', the SEQ ID
NO:10 is 5'-AAUUCAAAAAGAGCUGCUCAAACAUAAUGAACUCGAGUUCAUUAUGUUUGAGC AGCUC-3';
(2) the 6th groups of nucleotide sequences
The 6th group of nucleotide sequence is as shown in SEQ ID NO:11 and SEQ ID NO:12, the SEQ ID NO:11
For 5'-CCGGCACUUUAAACCGUGUGGAUUACUCGAGUAAUCCACACGGUUUAAAGUGU UUUUG-3', the SEQ ID
NO:12 is 5'-AAUUCAAAAACACUUUAAACCGUGUGGAUUACUCGAGUAAUCCACACGGUUUA AAGUG-3';
(3) the 7th groups of nucleotide sequences
The 7th group of nucleotide sequence is as shown in SEQ ID NO:13 and SEQ ID NO:14, the SEQ ID NO:13
For 5'-CCGGGGGCAAAAGCGUGGAGGCGGACUCGAGUCCGCCUCCACGCUUUUGCCCU UUUUG-3', the SEQ ID
NO:14 is 5'-AAUUCAAAAAGGGCAAAAGCGUGGAGGCGGACUCGAGUCCGCCUCCACGCUUU UGCCC-3'.
The third aspect of the present invention provides the DNA of the coding shRNA that the second aspect of the present invention provides, the core of the DNA
Nucleotide sequence includes at least following set of nucleotide sequence:
(1) the 9th group of nucleotide sequence
The 9th group of nucleotide sequence is as shown in SEQ ID NO:17 and SEQ ID NO:18, the SEQ ID NO:17
For 5'-CCGGGAGCTGCTCAAACATAATGAACTCGAGTTCATTATGTTTGAGCAGCTCT TTTTG-3', the SEQ ID
NO:18 is 5'-AATTCAAAAAGAGCTGCTCAAACATAATGAACTCGAGTTCATTATGTTTGAGC AGCTC-3';
(2) the tenth groups of nucleotide sequences
Described ten group of nucleotide sequence is as shown in SEQ ID NO:19 and SEQ ID NO:20, the SEQ ID NO:19
For 5'-CCGGCACTTTAAACCGTGTGGATTACTCGAGTAATCCACACGGTTTAAAGTGT TTTTG-3', the SEQ ID
NO:20 is 5'-AATTCAAAAACACTTTAAACCGTGTGGATTACTCGAGTAATCCACACGGTTTA AAGTG-3';
(3) the 11st groups of nucleotide sequences
The 11st group of nucleotide sequence is as shown in SEQ ID NO:21 and SEQ ID NO:22, the SEQ ID NO:
21 be 5'-CCGGGGGCAAAAGCGTGGAGGCGGACTCGAGTCCGCCTCCACGCTTTTGCCCT TTTTG-3', the SEQ
ID NO:22 is 5'-AATTCAAAAAGGGCAAAAGCGTGGAGGCGGACTCGAGTCCGCCTCCACGCTTT TGCCC-3'.
The fourth aspect of the present invention provides a kind of recombinant vector, and the recombinant vector is (to be purchased from Shanghai in GV493 plasmid
Ji Kai Gene Tech. Company Limited) multiple cloning sites AgeI and EcoRI insertion as coding third aspect present invention provide volume
The recombinant vector that the DNA of code shRNA is obtained.
The fifth aspect of the present invention provides a kind of recombinant slow virus, and the recombinant slow virus is mentioned by the fourth aspect of the present invention
The recombinant vector and virus packaging 1.0 carrier of helper plasmid pHelper and virus packaging helper plasmid pHelper 2.0 of confession carry
Body cotransfection mammalian cell obtains.
The sixth aspect of the present invention provides a kind of host cell, siRNA, this hair provided including the first aspect of the present invention
The DNA of the coding shRNA of shRNA, the third aspect of the present invention offer that bright second aspect provides, the fourth aspect of the present invention
At least one of the recombinant slow virus that the recombinant vector and the fifth aspect of the present invention of offer provide.The present invention is to the host
The specific type of cell is not particularly limited, for example, 293T cell.
The seventh aspect of the present invention provides the siRNA of the first aspect of the present invention offer, the second aspect of the present invention provides
ShRNA, the recombinant vector that provides of the coding DNA of shRNA that provides of the third aspect of the present invention, the fourth aspect of the present invention and
At least one of recombinant slow virus that the fifth aspect of the present invention provides is in the preparation that preparation inhibits OSBPL2 gene expression
Application.
The eighth aspect of the present invention provides the siRNA of the first aspect of the present invention offer, the second aspect of the present invention provides
ShRNA, the recombinant vector that provides of the coding DNA of shRNA that provides of the third aspect of the present invention, the fourth aspect of the present invention and
At least one of recombinant slow virus that the fifth aspect of the present invention provides inhibits breast cancer cell growth and/or proliferation in preparation
Drug in application.
The ninth aspect of the present invention provides the siRNA of the first aspect of the present invention offer, the second aspect of the present invention provides
ShRNA, the recombinant vector that provides of the coding DNA of shRNA that provides of the third aspect of the present invention, the fourth aspect of the present invention and
At least one of recombinant slow virus that the fifth aspect of the present invention provides is in the drug of preparation treatment and/or prevention breast cancer
Application.
SiRNA provided by the invention can specifically reduce OSBPL2 gene expression, so that the siRNA can be applied to make
The standby drug treated and/or prevent breast cancer.
Other features and advantages of the present invention will then part of the detailed description can be specified.
Embodiment 1
The present embodiment is for illustrating that OSBPL2 high is expressed in breast cancer cell line.
The extraction of RNA and reverse transcription quantitative PCR (RT-qPCR).
1, Total RNAs extraction: the present embodiment carries out at low temperature.Cell culture carries out in 6 orifice plates, removes culture medium, PBS
1000 μ l of Trizol, shaking table 10min is added in rinsing 3 times, every hole;It is collected into 1.5ml centrifuge tube, 200 μ l chlorine are added in every pipe
It is imitative, 30sec is acutely mixed, 15min is stood, 4 DEG C of 12000rpm are centrifuged 15min;400 μ l of gentle aspiration supernatant liquid is to another new
In centrifuge tube, isometric isopropanol is added, is gently mixed by inversion, 4 DEG C of 12000rpm are centrifuged 10min;Supernatant is abandoned, 1ml is added
75% ethanol wash sediment, 4 DEG C of 12000rpm are centrifuged 10min;Supernatant is discarded as far as possible, dries 10min at room temperature, and every pipe adds
Enter 10 μ l without RNase water, dissolves, spectrophotometer is quantitative.
2, reverse transcription: every 25 μ l reverse transcription system includes 100pmol random primer, 2 μ g total serum IgEs, 1 μ of M-MLV reverse transcriptase
0.625 1.25 μ l, 5 × M-MLV buffer of μ l, dNTPs (10mM) of l, RNase inhibitor, 5 μ l, remaining uses ddH2O polishing is to 25 μ
l.Reaction condition are as follows: 37 DEG C of 1h, 95 DEG C of 5min.
3, quantitative PCR: every 20 μ l reaction system includes 2 × PCR Mix (ABI) 10 μ l, each 0.4 μ l of upstream and downstream primer,
CDNA 1 μ l, ddH2O 8.2μl.Reaction condition are as follows: 94 DEG C of 2min, 94 DEG C of 15s, 60 DEG C of 40s, 40 circulations.It is used in experiment
Primer sequence be shown in Table 1.
1 fluorescence quantitative RT-PCR primer sequence of table
Fig. 1 shows differential expression of the OSBPL2 in normal cell and breast cancer cell.Wherein, MCF-10A (is abbreviated as
It 10A) is normal cell, MCF7, MDA-MB-231 (being abbreviated as 231), T-47D and SK-BR-3 are breast cancer cell.Such as Fig. 1 institute
Show, RT-qPCR as the result is shown: in MCF7, MDA-MB-231, T-47D, SK-BR-3 breast cancer cell, OSBPL2 gene expression
Significantly (P < 0.01, P < 0.01, P < 0.01, P < 0.01) is increased relative in control group MCF-10A cell.
Embodiment 2
The present embodiment is for illustrating that striking low OSBPL2 gene expression can inhibit breast cancer to be proliferated and/or grow.
One, the preparation of RNAi slow virus clone
1, shot design
3 RNAi target sequences, OSBPL2 base are designed according to RNAi sequence design principle for OSBPL2 gene order
The nucleotide sequence of 3 kinds of siRNA of cause and the nucleotide sequence of negative control (NC).3 kinds of siRNA and negative control pair
The title answered is respectively OSBPL2-si-1a, OSBPL2-si-1b, OSBPL2-si-2a, OSBPL2-si-2b, OSBPL2-si-
3a, OSBPL2-si-3b, NC-si-a and NC-si-b are the sequence designed for negative control group.See Table 2 for details.
The nucleotide sequence of table 23 RNA disturbance target points (siRNA) and negative control
Table 3 shows the nucleotide sequence of 3 kinds of shRNA used in embodiment, and shRNA used in embodiment is OSBPL2-sh-
The nucleotides sequence of 1a, OSBPL2-sh-1b, OSBPL2-sh-2a, OSBPL2-sh-2b, OSBPL2-sh-3a, OSBPL2-sh-3b
Column, NC-sh-a and NC-sh-b are the nucleotide sequence of control group.See Table 3 for details.
The nucleotide sequence of table 33 kinds of shRNA and negative control
Table 4 shows the nucleotide sequence of the DNA of code used 3 kinds of shRNA.The DNA of the code used shRNA of embodiment is
The nucleosides of OSBPL2-d-1a, OSBPL2-d-1b, OSBPL2-d-2a, OSBPL2-d-2b, OSBPL2-d-3a, OSBPL2-d-3b
Acid sequence, NC-d-a and NC-d-b are the nucleotide sequence of control group.See Table 4 for details.
The DNA of 43 kinds of shRNA of table and the nucleotide sequence of negative control
2, carrier digestion
50 μ l digestion systems are prepared according to table 5.Various reagents are sequentially added by tab sequential, are gently blown and beaten with pipettor mixed
Even, brief centrifugation is placed in 37 DEG C of reaction 3h.Agarose gel electrophoresis is carried out to carrier digestion products, recycles purpose band.
5 carrier digestion system of table
Reagent |
Volume (μ l) |
ddH2O |
41 |
10 × reaction buffer |
5 |
The GV493 Plasmid DNA (1 μ g/ μ L) of purifying |
2 |
AgeI(10U/μl) |
1 |
EcoRI(10U/μl) |
1 |
Total |
50 |
3, the DNA of shRNA anneals to form double-stranded DNA
The DNA dry powder of pairs of shRNA is dissolved in annealing buffer after synthesis, and 90 DEG C of water-bath 15min are naturally cooled to
Room temperature.
4, carrier connects
The carrier that double digestion linearizes is connected with annealing double-stranded DNA by T4DNA ligase (T4DNA ligase), 16
DEG C connection 1-3h.
6 carrier linked system of table
Reagent |
Volume (μ l) |
Linearized vector (100ng/ μ l) |
1 |
Double-stranded DNA (100ng/ μ l) |
1 |
10 × T4DNA ligase buffer solution |
2 |
T4DNA ligase |
1 |
Distilled water (ddH2O) |
Complement to 20 |
5, it converts
10 μ L connection reaction products are added in 100 μ L competent cells, flicks and is mixed under tube wall number, placed on ice
30min;42 DEG C of heat shock 90s, ice bath are incubated for 2min;500 μ L LB culture mediums are added, are placed in 37 DEG C of shaking table shaken cultivation 1h;It takes suitable
Amount bacterium solution is uniformly coated on the plate containing corresponding antibiotic, and culture 12-16h is inverted in constant incubator.
6, sequencing identification
The positive colony transformant identified is inoculated in the LB liquid medium containing corresponding antibiotic in right amount, 37 DEG C of trainings
12-16h is supported, appropriate bacterium solution is taken to be sequenced, identified.
7, plasmid transfection and slow virus harvest
Virus packaging is related to three plasmids altogether: carrying the tool carrier plasmid GV493 carrier of target sequence (purchased from Shang Haiji
Triumphant Gene Tech. Company Limited), virus packaging 1.0 carrier of helper plasmid Helper is (purchased from the lucky triumphant limited public affairs of Gene science in Shanghai
Department) and virus packaging 2.0 carrier of helper plasmid Helper (being purchased from Shanghai Ji Kai Gene Tech. Company Limited).Using above-mentioned three
Plasmid co-transfection 293T cell.
Before transfection for 24 hours, it with the 293T cell of trypsin digestion logarithmic growth phase, is adjusted with the culture medium containing 10% serum
Cell density about 5 × 106/ 15ml is reinoculated on 10cm Tissue Culture Dish, 37 DEG C, 5%CO2Culture in incubator;For 24 hours to thin
It can be used to transfect when born of the same parents' density is up to 70%~80%;2h is changed to serum free medium before transfecting;Sterile centrifugation tube is taken, is added
Each DNA solution (20 μ g of GV493 plasmid, 1.0 pHelper vector plasmid, 15 μ g, 2.0 pHelper vector plasmid, 10 μ g), with phase
The triumphant transfection reagent of Ji of volume is answered to be uniformly mixed, adjustment total volume is 1ml, incubates 15min at room temperature;Mixed liquor is slowly added dropwise
Into 293T cell culture fluid, mix, in 37 DEG C, 5%CO2It is cultivated in cell incubator;It is discarded after culture 6h mixed containing transfection
With the culture medium of object, the PBS cleaning that 10ml is added is primary, falls after the soft transfection mixture for shaking culture dish to wash remnants
It abandons;
It is slowly added to the cell culture medium 20ml containing 10% serum, in 37 DEG C, 5%CO2Continue to cultivate 48- in incubator
72h。
8, slow virus concentration and purifying and quality inspection
According to cell state, the 293T cell supernatant of 48h (transfection can be calculated as 0h) after transfection is collected;In 4 DEG C,
4000g is centrifuged 10min, removes cell fragment;With 0.45 μm of filter filtering supernatant in 40ml ultracentrifugation pipe;Trim respectively
Ultracentrifugation pipe with vial supernatant is put into Beckman ultracentrifuge, 4 DEG C, 25000rpm by sample one by one,
It is centrifuged 2h;It after centrifugation, discards supernatant, removal as far as possible remains in the liquid on tube wall, and virus is added and saves liquid, gently repeatedly
Piping and druming is resuspended;Through after completely dissolution, after high speed centrifugation 10000rpm, 5min, supernatant being taken to dispense as required;
The key Quality Control of slow virus includes physical state detection, Sterility testing and virus titer detection.
Two, slow-virus transfection
To guarantee that gene jamming effectiveness, the present embodiment design 3 kinds of RNA disturbance target points (siRNA) for OSBPL2 gene, and
3 plasmid equal proportions for carrying different target spots are mixed and carry out slow virus packaging, so that it is guaranteed that purpose base after virus infected cell
Cause strikes reduction rate.
Cell secondary culture is into 6 orifice plates after 12-16 hours: virus liquid 0.15ml and fresh cell medium mixed,
Ratio is that 0.5ml fresh medium and 0.65 μ l polybrene (final concentration 4ng/ml) are added in 0.15ml vial supernatant;
Pre- mixed virus infection liquid is added in aim cell culture dish, and cell density is no more than 50% at this time.After being incubated overnight
It is replaced with fresh medium.
After infection 3 days, logarithmic growth phase cell carries out cell proliferation experiment.
Three, cell proliferation experiment
Above-mentioned control group and the cell in logarithmic growth phase for striking low OSBPL2 expression are subjected to pancreatin digestion, are made thin
Born of the same parents' suspension;Cell suspension (cell number is about 3000) is inoculated in 96 orifice plates, is counted respectively at the 1st day, 2 days, 3 days, 4 days, 5 days
Cell quantity is calculated, growth curve is drawn.
Fig. 2 shows strike influence of the low OSBPL2 to Cells Proliferation of Human Breast Cancer.Wherein, shCtrl is control group,
ShOSBPL2 is experimental group, and the curve of top is control group, and the curve of lower section is experimental group.As shown in Fig. 2, cell proliferation experiment
The results show that striking the expression of low OSBPL2 gene, the proliferation (P of breast cancer cell MCF7 was significantly inhibited with the 5th day on day 4
=0.021, P=0.007).
Four, human breast cancer in nude mice lotus knurl is tested
Cell suspension is respectively prepared in control group and the MCF7 breast cancer cell line for striking low OSBPL2, carries out nude mice fat pad
Plantation.Every group of 6 mouse, every mouse inoculation 100 μ l, 5 × 106A cell.After 1.5 months, tumor size and volume are detected,
Carry out statistical analysis.
Fig. 3 shows the influence for striking low OSBPL2 to tumor-bearing mice growth of breast cancers.Wherein, NC is control group,
ShOSBPL2 is experimental group.As shown in figure 3, mouse-borne tumor experimental result is shown, OSBPL2 low expression group Breast Cancer tumor volume
Substantially less than control group (P < 0.05).As it can be seen that breast cancer cell growth can be significantly inhibited by reducing the expression of OSBPL2 gene.
Various embodiments of the present invention are described above, above description is exemplary, and non-exclusive, and
It is not limited to disclosed each embodiment.Without departing from the scope and spirit of illustrated each embodiment, for this skill
Many modifications and changes are obvious for the those of ordinary skill in art field.
Sequence table
<110>Jiangsu medical profession institute
<120>siRNA, recombinant vector and its application of OSBPL2 gene expression are reduced
<160> 28
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 1
gagcugcuca aacauaauga a 21
<210> 2
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 2
uucauuaugu uugagcagcu c 21
<210> 3
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 3
cacuuuaaac cguguggauu a 21
<210> 4
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 4
uaauccacac gguuuaaagu g 21
<210> 5
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 5
gggcaaaagc guggaggcgg a 21
<210> 6
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 6
uccgccucca cgcuuuugcc c 21
<210> 7
<211> 19
<212> RNA
<213> Artificial Sequence
<400> 7
uucuccgaac gugucacgu 19
<210> 8
<211> 19
<212> RNA
<213> Artificial Sequence
<400> 8
acgugacacg uucggagaa 19
<210> 9
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 9
ccgggagcug cucaaacaua augaacucga guucauuaug uuugagcagc ucuuuuug 58
<210> 10
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 10
aauucaaaaa gagcugcuca aacauaauga acucgaguuc auuauguuug agcagcuc 58
<210> 11
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 11
ccggcacuuu aaaccgugug gauuacucga guaauccaca cgguuuaaag uguuuuug 58
<210> 12
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 12
aauucaaaaa cacuuuaaac cguguggauu acucgaguaa uccacacggu uuaaagug 58
<210> 13
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 13
ccgggggcaa aagcguggag gcggacucga guccgccucc acgcuuuugc ccuuuuug 58
<210> 14
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 14
aauucaaaaa gggcaaaagc guggaggcgg acucgagucc gccuccacgc uuuugccc 58
<210> 15
<211> 57
<212> RNA
<213> Artificial Sequence
<400> 15
ccgguucucc gaacguguca cguuucaaga gaacgugaca cguucggaga auuuuug 57
<210> 16
<211> 57
<212> RNA
<213> Artificial Sequence
<400> 16
aauucaaaaa uucuccgaac gugucacguu cucuugaaac gugacacguu cggagaa 57
<210> 17
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 17
ccgggagctg ctcaaacata atgaactcga gttcattatg tttgagcagc tctttttg 58
<210> 18
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 18
aattcaaaaa gagctgctca aacataatga actcgagttc attatgtttg agcagctc 58
<210> 19
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 19
ccggcacttt aaaccgtgtg gattactcga gtaatccaca cggtttaaag tgtttttg 58
<210> 20
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 20
aattcaaaaa cactttaaac cgtgtggatt actcgagtaa tccacacggt ttaaagtg 58
<210> 21
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 21
ccgggggcaa aagcgtggag gcggactcga gtccgcctcc acgcttttgc cctttttg 58
<210> 22
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 22
aattcaaaaa gggcaaaagc gtggaggcgg actcgagtcc gcctccacgc ttttgccc 58
<210> 23
<211> 57
<212> DNA
<213> Artificial Sequence
<400> 23
ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga atttttg 57
<210> 24
<211> 57
<212> DNA
<213> Artificial Sequence
<400> 24
aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 25
tgctctggag gatcaacacc 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 26
gggtagaacc acctcgtctg 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 27
ggcacccagc acaatgaaga 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 28
actcctgctt gctgatccac 20