CN110117593A - Specificity reduces the application of the nucleic acid, recombinant vector and recombinant slow virus of FAM84B gene expression - Google Patents
Specificity reduces the application of the nucleic acid, recombinant vector and recombinant slow virus of FAM84B gene expression Download PDFInfo
- Publication number
- CN110117593A CN110117593A CN201910229012.4A CN201910229012A CN110117593A CN 110117593 A CN110117593 A CN 110117593A CN 201910229012 A CN201910229012 A CN 201910229012A CN 110117593 A CN110117593 A CN 110117593A
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleotide sequence
- fam84b
- group
- gene expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention belongs to molecular biology and gene engineering technology field, it is related at least one of nucleic acid, recombinant vector and recombinant slow virus of specific reduction FAM84B gene expression and inhibits the drug of breast cancer cell growth and/or proliferation, or preparation to treat and/or prevent the application in the drug of breast cancer in preparation.
Description
Technical field
The invention belongs to molecular biology and gene engineering technology field, reduce FAM84B more particularly, to specificity
The application of the nucleic acid, recombinant vector and recombinant slow virus of gene expression.
Background technique
Breast cancer is one of the malignant tumour that women is common in world wide, and new hair rate and the death rate occupy all kinds of cancers
It is the first.Although China's breast cancer incidence is relatively low, large population base, overall incidence number is more, and disease incidence has on year by year
The trend risen, and age of onset is in rejuvenation trend.Breast cancer is in origin of cell, Histological Study, disease classification, clinical table
Existing, therapeutic response and metastatic potential etc. all show great complexity and heterogeneity, limit existing breast cancer and control
The validity and popularity for the treatment of method.Clinically still lack the target spot of breast cancer treatment.
Thioesterase superfamily member 6 (Thioesterase Superfamily Member 6, FAM84B) encoding histone base
Cause also known as C8orf55, are positioned at 8q24.3, have 3 exons.FAM84B albumen wide expression is in groups such as kidney, stomach, lungs
It knits, is conventionally positioned in extracellular, cytoplasm and nucleus.So far for FAM84B gene breast cancer related fields biology
Function is learned not study.
Summary of the invention
The object of the present invention is to provide nucleic acid, recombinant vector and recombinant slow virus that specificity reduces FAM84B gene expression
Application.
To achieve the goals above, the present invention provide specificity reduce the nucleic acid of FAM84B gene expression, recombinant vector and
At least one of recombinant slow virus inhibits the drug of breast cancer cell growth and/or proliferation in preparation, or preparation treatment and/or
Prevent the application in the drug of breast cancer.
A kind of preferred embodiment according to the present invention, the nucleic acid that the specificity reduces FAM84B gene expression is siRNA,
The siRNA usually has the nucleotide sequence of 19~27bp.Of the invention focuses on providing new breast cancer treatment target,
And it is not limited to specific siRNA sequence, the siRNA for being directed to the target can be designed according to the various methods of this field routine.
Specifically, the nucleotide sequence of the siRNA includes at least following set of nucleotide sequence:
(1) first group of nucleotide sequence
As shown in SEQ ID NO:1 and SEQ ID NO:2, the SEQ ID NO:1 is first group of nucleotide sequence
5'-CAACGAUCUGUACCGCUACAA-3', the SEQ ID NO:2 are 5'-UUGUAGCGGUACAGAUCGUUG-3'；
(2) second groups of nucleotide sequences
As shown in SEQ ID NO:3 and SEQ ID NO:4, the SEQ ID NO:3 is second group of nucleotide sequence
5'-AGUCUAGAGGACCUGAUCAUG-3', the SEQ ID NO:4 are 5'-CAUGAUCAGGUCCUCUAGACU-3'；
(3) third group nucleotide sequence
As shown in SEQ ID NO:5 and SEQ ID NO:6, the SEQ ID NO:5 is the third group nucleotide sequence
5'-GGUGGAAUGCUCCGUGUUCUA-3', the SEQ ID NO:6 are 5'-UAGAACACGGAGCAUUCCACC-3'.
According to the present invention, it is corresponding with the siRNA that the specificity, which reduces the nucleic acid of FAM84B gene expression,
ShRNA, the shRNA have the single stranded RNA of loop-stem structure, and the nucleotide sequence of the shRNA includes at least following set of core
Nucleotide sequence:
(1) the 5th group of nucleotide sequence
As shown in SEQ ID NO:9 and SEQ ID NO:10, the SEQ ID NO:9 is the 5th group of nucleotide sequence
5'-CCGGCAACGAUCUGUACCGCUACAACUCGAGUUGUAGCGGUACAGAUCGUUGU UUUUG-3', the SEQ ID
NO:10 is 5'-AAUUCAAAAACAACGAUCUGUACCGCUACAACUCGAGUUGUAGCGGUACAGAU CGUUG-3'；
(2) the 6th groups of nucleotide sequences
The 6th group of nucleotide sequence is as shown in SEQ ID NO:11 and SEQ ID NO:12, the SEQ ID NO:11
For 5'-CCGGAGUCUAGAGGACCUGAUCAUGCUCGAGCAUGAUCAGGUCCUCUAGACUU UUUUG-3', the SEQ ID
NO:12 is 5'-AAUUCAAAAAAGUCUAGAGGACCUGAUCAUGCUCGAGCAUGAUCAGGUCCUCU AGACU-3'；
(3) the 7th groups of nucleotide sequences
The 7th group of nucleotide sequence is as shown in SEQ ID NO:13 and SEQ ID NO:14, the SEQ ID NO:13
For 5'-CCGGGGUGGAAUGCUCCGUGUUCUACUCGAGUAGAACACGGAGCAUUCCACCU UUUUG-3', the SEQ ID
NO:14 is 5'-AAUUCAAAAAGGUGGAAUGCUCCGUGUUCUACUCGAGUAGAACACGGAGCAUU CCACC-3'.
According to the present invention, it is the DNA for encoding above-mentioned shRNA, institute that the specificity, which reduces the nucleic acid of FAM84B gene expression,
The nucleotide sequence for encoding the DNA of the shRNA is stated including at least following set of nucleotide sequence:
(1) the 9th group of nucleotide sequence
The 9th group of nucleotide sequence is as shown in SEQ ID NO:17 and SEQ ID NO:18, the SEQ ID NO:17
For 5'-CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGT TTTTG-3', the SEQ ID
NO:18 is 5'-AATTCAAAAACAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGAT CGTTG-3'；
(2) the tenth groups of nucleotide sequences
Described ten group of nucleotide sequence is as shown in SEQ ID NO:19 and SEQ ID NO:20, the SEQ ID NO:19
For 5'-CCGGAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCTAGACTT TTTTG-3', the SEQ ID
NO:20 is 5'-AATTCAAAAAAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCT AGACT-3'；
(3) the 11st groups of nucleotide sequences
The 11st group of nucleotide sequence is as shown in SEQ ID NO:21 and SEQ ID NO:22, the SEQ ID NO:
21 be 5'-CCGGGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATTCCACCT TTTTG-3', the SEQ
ID NO:22 is 5'-AATTCAAAAAGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATT CCACC-3'.
According to the present invention, it is described specificity reduce FAM84B gene expression recombinant vector preferably GV493 plasmid (can
Purchased from Shanghai Ji Kai Gene Tech. Company Limited) multiple cloning sites AgeI and EcoRI be inserted into the above-mentioned shRNA's of the coding
The recombinant vector that DNA is obtained.
According to the present invention, the specificity reduces the recombinant slow virus of FAM84B gene expression preferably by above-mentioned recombinant vector
With virus packaging 1.0 carrier of helper plasmid pHelper and virus packaging 2.0 carrier cotransfection lactation of helper plasmid pHelper
Zooblast obtains.
SiRNA provided by the invention can specifically reduce FAM84B gene expression, so that the siRNA can press down in preparation
The drug of breast cancer cell growth processed and/or proliferation, or preparation treat and/or prevent to apply in the drug of breast cancer.
ShRNA provided by the invention can specifically reduce FAM84B gene expression, so that the shRNA can press down in preparation
The drug of breast cancer cell growth processed and/or proliferation, or preparation treat and/or prevent to apply in the drug of breast cancer.
The DNA of coding shRNA provided by the invention can specifically reduce FAM84B gene expression, so that the coding
The DNA of shRNA can inhibit the drug of breast cancer cell growth and/or proliferation in preparation, or prepare treatment and/or prevention breast cancer
Drug in apply.
Recombinant vector provided by the invention can specifically reduce FAM84B gene expression, so that the recombinant vector can be
Preparation inhibits the drug of breast cancer cell growth and/or proliferation, or preparation to treat and/or prevent to apply in the drug of breast cancer.
Recombinant slow virus provided by the invention can specifically reduce FAM84B gene expression, so that the recombinant slow virus
It can inhibit the drug of breast cancer cell growth and/or proliferation in preparation, or prepare and answered in the drug for treating and/or preventing breast cancer
With.
Other features and advantages of the present invention will then part of the detailed description can be specified.
Detailed description of the invention
Exemplary embodiment of the invention is described in more detail in conjunction with the accompanying drawings, it is of the invention above-mentioned and its
Its purpose, feature and advantage will be apparent.
Fig. 1 shows differential expression of the FAM84B in normal cell and breast cancer cell.Wherein, MCF-10A (is abbreviated as
It 10A) is normal cell, MCF7, T-47D and BT-474 are breast cancer cell.
Fig. 2 shows strike influence of the low FAM84B to Cells Proliferation of Human Breast Cancer.Wherein, shCtrl is control group,
ShFAM84B is experimental group, and the curve of top is control group, and the curve of lower section is experimental group.
Fig. 3 shows the influence for striking low FAM84B to tumor-bearing mice growth of breast cancers.Wherein, NC is control group,
ShFAM84B is experimental group.
Specific embodiment
The preferred embodiment of the present invention is described in more detail below.Although the following describe preferred implementations of the invention
Mode, however, it is to be appreciated that may be realized in various forms the present invention without that should be limited by the embodiments set forth herein.It is real
The person that is not specified actual conditions in example is applied, is all carried out according to conventional conditions or manufacturer's recommended conditions.Agents useful for same or instrument are not
Production firm person is indicated, is the conventional products that can be obtained by commercially available purchase.
The number of source of people FAM84B involved in following embodiments is Gene ID:157638.
In following embodiments, statistical analysis is carried out using 6.0 software of GraphPad Prism.All experiment in vitro counterpoises
Again more than three times.Data are indicated with means standard deviation (SD).P < 0.05 is considered to have statistical significance.
Embodiment 1
The present embodiment is for illustrating that FAM84B high is expressed in breast cancer cell line.
The extraction of RNA and reverse transcription quantitative PCR (RT-qPCR).
1, Total RNAs extraction: the present embodiment carries out at low temperature.Cell culture carries out in 6 orifice plates, removes culture medium, PBS
1000 μ l of Trizol, shaking table 10min is added in rinsing 3 times, every hole；It is collected into 1.5ml centrifuge tube, 200 μ l chlorine are added in every pipe
It is imitative, 30sec is acutely mixed, 15min is stood, 4 DEG C of 12000rpm are centrifuged 15min；400 μ l of gentle aspiration supernatant liquid is to another new
In centrifuge tube, isometric isopropanol is added, is gently mixed by inversion, 4 DEG C of 12000rpm are centrifuged 10min；Supernatant is abandoned, 1ml is added
75% ethanol wash sediment, 4 DEG C of 12000rpm are centrifuged 10min；Supernatant is discarded as far as possible, dries 10min at room temperature, and every pipe adds
Enter 10 μ l without RNase water, dissolves, spectrophotometer is quantitative.
2, reverse transcription: every 25 μ l reverse transcription system includes 100pmol random primer, 2 μ g total serum IgEs, 1 μ of M-MLV reverse transcriptase
0.625 1.25 μ l, 5 × M-MLV buffer of μ l, dNTPs (10mM) of l, RNase inhibitor, 5 μ l, remaining uses ddH2O polishing is to 25 μ
l.Reaction condition are as follows: 37 DEG C of 1h, 95 DEG C of 5min.
3, quantitative PCR: every 20 μ l reaction system includes 2 × PCR Mix (ABI) 10 μ l, each 0.4 μ l of upstream and downstream primer,
CDNA 1 μ l, ddH2O 8.2μl.Reaction condition are as follows: 94 DEG C of 2min, 94 DEG C of 15s, 60 DEG C of 40s, 40 circulations.It is used in experiment
Primer sequence be shown in Table 1.
1 fluorescence quantitative RT-PCR primer sequence of table
Fig. 1 shows differential expression of the FAM84B in normal cell and breast cancer cell.Wherein, MCF-10A (is abbreviated as
It 10A) is normal cell, MCF7, T-47D and BT-474 are breast cancer cell.As shown in Figure 1, RT-qPCR is as the result is shown:
In MCF7, T-47D and BT-474 breast cancer cell, FAM84B gene expression is significantly increased relative to control group MCF-10A cell
(P < 0.001, P < 0.001, P < 0.001).
Embodiment 2
The present embodiment is for illustrating that striking low FAM84B gene expression can inhibit breast cancer to be proliferated and/or grow.
One, the preparation of RNAi slow virus clone
1, shot design
3 RNAi target sequences, FAM84B base are designed according to RNAi sequence design principle for FAM84B gene order
The nucleotide sequence of 3 kinds of siRNA of cause and the nucleotide sequence of negative control (NC).3 kinds of siRNA and negative control pair
The title answered is respectively FAM84B-si-1a, FAM84B-si-1b, FAM84B-si-2a, FAM84B-si-2b, FAM84B-si-
3a, FAM84B-si-3b, NC-si-a and NC-si-b are the sequence designed for negative control group.See Table 2 for details.
The nucleotide sequence of table 23 RNA disturbance target points (siRNA) and negative control
Table 3 shows the nucleotide sequence of 3 kinds of shRNA used in embodiment, and shRNA used in embodiment is FAM84B-sh-
The nucleotides sequence of 1a, FAM84B-sh-1b, FAM84B-sh-2a, FAM84B-sh-2b, FAM84B-sh-3a, FAM84B-sh-3b
Column, NC-sh-a and NC-sh-b are the nucleotide sequence of control group.See Table 3 for details.
The nucleotide sequence of table 33 kinds of shRNA and negative control
Table 4 shows the nucleotide sequence of the DNA of code used 3 kinds of shRNA.The DNA of the code used shRNA of embodiment is
The nucleosides of FAM84B-d-1a, FAM84B-d-1b, FAM84B-d-2a, FAM84B-d-2b, FAM84B-d-3a, FAM84B-d-3b
Acid sequence, NC-d-a and NC-d-b are the nucleotide sequence of control group.See Table 4 for details.
The DNA of 43 kinds of shRNA of table and the nucleotide sequence of negative control
2, carrier digestion
50 μ l digestion systems are prepared according to table 5.Various reagents are sequentially added by tab sequential, are gently blown and beaten with pipettor mixed
Even, brief centrifugation is placed in 37 DEG C of reaction 3h.Agarose gel electrophoresis is carried out to carrier digestion products, recycles purpose band.
5 carrier digestion system of table
3, the DNA of shRNA anneals to form double-stranded DNA
The DNA dry powder of pairs of shRNA is dissolved in annealing buffer after synthesis, and 90 DEG C of water-bath 15min are naturally cooled to
Room temperature.
4, carrier connects
The carrier that double digestion linearizes is connected with annealing double-stranded DNA by T4 DNA ligase (T4DNA ligase),
16 DEG C of connection 1-3h.
6 carrier linked system of table
| Reagent | Volume (μ l) |
| Linearized vector (100ng/ μ l) | 1 |
| Double-stranded DNA (100ng/ μ l) | 1 |
| 10 × T4 DNA ligase buffer | 2 |
| T4 DNA ligase | 1 |
| Distilled water (ddH2O) | Complement to 20 |
5, it converts
10 μ L connection reaction products are added in 100 μ L competent cells, flicks and is mixed under tube wall number, placed on ice
30min；42 DEG C of heat shock 90s, ice bath are incubated for 2min；500 μ L LB culture mediums are added, are placed in 37 DEG C of shaking table shaken cultivation 1h；It takes suitable
Amount bacterium solution is uniformly coated on the plate containing corresponding antibiotic, and culture 12-16h is inverted in constant incubator.
6, sequencing identification
The positive colony transformant identified is inoculated in the LB liquid medium containing corresponding antibiotic in right amount, 37 DEG C of trainings
12-16h is supported, appropriate bacterium solution is taken to be sequenced, identified.
7, plasmid transfection and slow virus harvest
Virus packaging is related to three plasmids altogether: carrying the tool carrier plasmid GV493 carrier of target sequence (purchased from Shang Haiji
Triumphant Gene Tech. Company Limited), virus packaging 1.0 carrier of helper plasmid Helper is (purchased from the lucky triumphant limited public affairs of Gene science in Shanghai
Department) and virus packaging 2.0 carrier of helper plasmid Helper (being purchased from Shanghai Ji Kai Gene Tech. Company Limited).Using above-mentioned three
Plasmid co-transfection 293T cell.
Before transfection for 24 hours, it with the 293T cell of trypsin digestion logarithmic growth phase, is adjusted with the culture medium containing 10% serum
Cell density about 5 × 106/ 15ml is reinoculated on 10cm Tissue Culture Dish, 37 DEG C, 5%CO2Culture in incubator；For 24 hours to thin
It can be used to transfect when born of the same parents' density is up to 70%~80%；2h is changed to serum free medium before transfecting；Sterile centrifugation tube is taken, is added
Each DNA solution (20 μ g of GV493 plasmid, 1.0 pHelper vector plasmid, 15 μ g, 2.0 pHelper vector plasmid, 10 μ g), with phase
The triumphant transfection reagent of Ji of volume is answered to be uniformly mixed, adjustment total volume is 1ml, incubates 15min at room temperature；Mixed liquor is slowly added dropwise
Into 293T cell culture fluid, mix, in 37 DEG C, 5%CO2It is cultivated in cell incubator；It is discarded after culture 6h mixed containing transfection
With the culture medium of object, the PBS cleaning that 10ml is added is primary, falls after the soft transfection mixture for shaking culture dish to wash remnants
It abandons；
It is slowly added to the cell culture medium 20ml containing 10% serum, in 37 DEG C, 5%CO2Continue to cultivate 48- in incubator
72h。
8, slow virus concentration and purifying and quality inspection
According to cell state, the 293T cell supernatant of 48h (transfection can be calculated as 0h) after transfection is collected；In 4 DEG C,
4000g is centrifuged 10min, removes cell fragment；With 0.45 μm of filter filtering supernatant in 40ml ultracentrifugation pipe；Trim respectively
Ultracentrifugation pipe with vial supernatant is put into Beckman ultracentrifuge, 4 DEG C, 25000rpm by sample one by one,
It is centrifuged 2h；It after centrifugation, discards supernatant, removal as far as possible remains in the liquid on tube wall, and virus is added and saves liquid, gently repeatedly
Piping and druming is resuspended；Through after completely dissolution, after high speed centrifugation 10000rpm, 5min, supernatant being taken to dispense as required；
The key Quality Control of slow virus includes physical state detection, Sterility testing and virus titer detection.
Two, slow-virus transfection
To guarantee that gene jamming effectiveness, the present embodiment design 3 kinds of RNA disturbance target points (siRNA) for FAM84B gene, and
3 plasmid equal proportions for carrying different target spots are mixed and carry out slow virus packaging, so that it is guaranteed that purpose base after virus infected cell
Cause strikes reduction rate.
Cell secondary culture is into 6 orifice plates after 12-16 hours: virus liquid 0.15ml and fresh cell medium mixed,
Ratio is that 0.5ml fresh medium and 0.65 μ l polybrene (final concentration 4ng/ml) are added in 0.15ml vial supernatant；
Pre- mixed virus infection liquid is added in aim cell culture dish, and cell density is no more than 50% at this time.After being incubated overnight
It is replaced with fresh medium.
After infection 3 days, logarithmic growth phase cell carries out cell proliferation experiment.
Three, cell proliferation experiment
Above-mentioned control group and the cell in logarithmic growth phase for striking low FAM84B expression are subjected to pancreatin digestion, are made thin
Born of the same parents' suspension；Cell suspension (cell number is about 3000) is inoculated in 96 orifice plates, is counted respectively at the 1st day, 2 days, 3 days, 4 days, 5 days
Cell quantity is calculated, growth curve is drawn.
Fig. 2 shows strike influence of the low FAM84B to Cells Proliferation of Human Breast Cancer.Wherein, shCtrl is control group,
ShFAM84B is experimental group, and the curve of top is control group, and the curve of lower section is experimental group.As shown in Fig. 2, cell proliferation experiment
The results show that strike the expression of low FAM84B gene, on day 4 with significantly inhibit within the 5th day breast cancer cell MCF7 proliferation (P <
0.001, P < 0.001).
Four, human breast cancer in nude mice lotus knurl is tested
Cell suspension is respectively prepared in control group and the MCF7 breast cancer cell line for striking low FAM84B, carries out nude mice fat pad
Plantation.Every group of 6 mouse, every mouse inoculation 100 μ l, 5 × 106A cell.After 1.5 months, tumor size and volume are detected,
Carry out statistical analysis.
Fig. 3 shows the influence for striking low FAM84B to tumor-bearing mice growth of breast cancers.Wherein, NC is control group,
ShFAM84B is experimental group.As shown in figure 3, mouse-borne tumor experimental result is shown, FAM84B low expression group Breast Cancer tumor volume
Substantially less than control group (P < 0.01).As it can be seen that breast cancer cell growth can be significantly inhibited by reducing the expression of FAM84B gene.
Various embodiments of the present invention are described above, above description is exemplary, and non-exclusive, and
It is not limited to disclosed each embodiment.Without departing from the scope and spirit of illustrated each embodiment, for this skill
Many modifications and changes are obvious for the those of ordinary skill in art field.
Sequence table
<110>Jiangsu medical profession institute
<120>specificity reduces the application of the nucleic acid, recombinant vector and recombinant slow virus of FAM84B gene expression
<160> 28
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 1
caacgaucug uaccgcuaca a 21
<210> 2
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 2
uuguagcggu acagaucguu g 21
<210> 3
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 3
agucuagagg accugaucau g 21
<210> 4
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 4
caugaucagg uccucuagac u 21
<210> 5
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 5
gguggaaugc uccguguucu a 21
<210> 6
<211> 21
<212> RNA
<213> Artificial Sequence
<400> 6
uagaacacgg agcauuccac c 21
<210> 7
<211> 19
<212> RNA
<213> Artificial Sequence
<400> 7
uucuccgaac gugucacgu 19
<210> 8
<211> 19
<212> RNA
<213> Artificial Sequence
<400> 8
acgugacacg uucggagaa 19
<210> 9
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 9
ccggcaacga ucuguaccgc uacaacucga guuguagcgg uacagaucgu uguuuuug 58
<210> 10
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 10
aauucaaaaa caacgaucug uaccgcuaca acucgaguug uagcgguaca gaucguug 58
<210> 11
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 11
ccggagucua gaggaccuga ucaugcucga gcaugaucag guccucuaga cuuuuuug 58
<210> 12
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 12
aauucaaaaa agucuagagg accugaucau gcucgagcau gaucaggucc ucuagacu 58
<210> 13
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 13
ccggggugga augcuccgug uucuacucga guagaacacg gagcauucca ccuuuuug 58
<210> 14
<211> 58
<212> RNA
<213> Artificial Sequence
<400> 14
aauucaaaaa gguggaaugc uccguguucu acucgaguag aacacggagc auuccacc 58
<210> 15
<211> 57
<212> RNA
<213> Artificial Sequence
<400> 15
ccgguucucc gaacguguca cguuucaaga gaacgugaca cguucggaga auuuuug 57
<210> 16
<211> 57
<212> RNA
<213> Artificial Sequence
<400> 16
aauucaaaaa uucuccgaac gugucacguu cucuugaaac gugacacguu cggagaa 57
<210> 17
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 17
ccggcaacga tctgtaccgc tacaactcga gttgtagcgg tacagatcgt tgtttttg 58
<210> 18
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 18
aattcaaaaa caacgatctg taccgctaca actcgagttg tagcggtaca gatcgttg 58
<210> 19
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 19
ccggagtcta gaggacctga tcatgctcga gcatgatcag gtcctctaga cttttttg 58
<210> 20
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 20
aattcaaaaa agtctagagg acctgatcat gctcgagcat gatcaggtcc tctagact 58
<210> 21
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 21
ccggggtgga atgctccgtg ttctactcga gtagaacacg gagcattcca cctttttg 58
<210> 22
<211> 58
<212> DNA
<213> Artificial Sequence
<400> 22
aattcaaaaa ggtggaatgc tccgtgttct actcgagtag aacacggagc attccacc 58
<210> 23
<211> 57
<212> DNA
<213> Artificial Sequence
<400> 23
ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga atttttg 57
<210> 24
<211> 57
<212> DNA
<213> Artificial Sequence
<400> 24
aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 25
cgatctggtg gagttcgtgt 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 26
tggagcttag cggcttgtag 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 27
ggcacccagc acaatgaaga 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 28
actcctgctt gctgatccac 20
Claims (6)
- Press down 1. specificity reduces at least one of nucleic acid, recombinant vector and recombinant slow virus of FAM84B gene expression in preparation The application in the drug of breast cancer is treated and/or is prevented in the drug of breast cancer cell growth processed and/or proliferation, or preparation.
- 2. application according to claim 1, which is characterized in that it is described specificity reduce FAM84B gene expression nucleic acid be The nucleotide sequence of siRNA, the siRNA include at least following set of nucleotide sequence:(1) first group of nucleotide sequenceFor first group of nucleotide sequence as shown in SEQ ID NO:1 and SEQ ID NO:2, the SEQ ID NO:1 is 5'- CAACGAUCUGUACCGCUACAA-3', the SEQ ID NO:2 are 5'-UUGUAGCGGUACAGAUCGUUG-3'；(2) second groups of nucleotide sequencesFor second group of nucleotide sequence as shown in SEQ ID NO:3 and SEQ ID NO:4, the SEQ ID NO:3 is 5'- AGUCUAGAGGACCUGAUCAUG-3', the SEQ ID NO:4 are 5'-CAUGAUCAGGUCCUCUAGACU-3'；(3) third group nucleotide sequenceFor the third group nucleotide sequence as shown in SEQ ID NO:5 and SEQ ID NO:6, the SEQ ID NO:5 is 5'- GGUGGAAUGCUCCGUGUUCUA-3', the SEQ ID NO:6 are 5'-UAGAACACGGAGCAUUCCACC-3'.
- 3. application according to claim 2, which is characterized in that it is described specificity reduce FAM84B gene expression nucleic acid be The nucleotide sequence of shRNA corresponding with the siRNA, the shRNA include at least following set of nucleotide sequence:(1) the 5th group of nucleotide sequenceFor the 5th group of nucleotide sequence as shown in SEQ ID NO:9 and SEQ ID NO:10, the SEQ ID NO:9 is 5'- CCGGCAACGAUCUGUACCGCUACAACUCGAGUUGUAGCGGUACAGAUCGUUGUUUU UG-3', the SEQ ID NO: 10 be 5'-AAUUCAAAAACAACGAUCUGUACCGCUACAACUCGAGUUGUAGCGGUACAGAU CGUUG-3'；(2) the 6th groups of nucleotide sequencesAs shown in SEQ ID NO:11 and SEQ ID NO:12, the SEQ ID NO:11 is the 6th group of nucleotide sequence 5'-CCGGAGUCUAGAGGACCUGAUCAUGCUCGAGCAUGAUCAGGUCCUCUAGACUU UUUUG-3', the SEQ ID NO:12 is 5'-AAUUCAAAAAAGUCUAGAGGACCUGAUCAUGCUCGAGCAUGAUCAGGUCCUCU AGACU-3'；(3) the 7th groups of nucleotide sequencesAs shown in SEQ ID NO:13 and SEQ ID NO:14, the SEQ ID NO:13 is the 7th group of nucleotide sequence 5'-CCGGGGUGGAAUGCUCCGUGUUCUACUCGAGUAGAACACGGAGCAUUCCACCU UUUUG-3', the SEQ ID NO:14 is 5'-AAUUCAAAAAGGUGGAAUGCUCCGUGUUCUACUCGAGUAGAACACGGAGCAUU CCACC-3'.
- 4. application according to claim 3, which is characterized in that it is described specificity reduce FAM84B gene expression nucleic acid be The DNA of the shRNA is encoded, the nucleotide sequence of the DNA of the coding shRNA includes at least following set of nucleotides sequence Column:(1) the 9th group of nucleotide sequenceAs shown in SEQ ID NO:17 and SEQ ID NO:18, the SEQ ID NO:17 is the 9th group of nucleotide sequence 5'-CCGGCAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGATCGTTGT TTTTG-3', the SEQ ID NO:18 is 5'-AATTCAAAAACAACGATCTGTACCGCTACAACTCGAGTTGTAGCGGTACAGAT CGTTG-3'；(2) the tenth groups of nucleotide sequencesAs shown in SEQ ID NO:19 and SEQ ID NO:20, the SEQ ID NO:19 is described ten group of nucleotide sequence 5'-CCGGAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCTAGACTT TTTTG-3', the SEQ ID NO:20 is 5'-AATTCAAAAAAGTCTAGAGGACCTGATCATGCTCGAGCATGATCAGGTCCTCT AGACT-3'；(3) the 11st groups of nucleotide sequencesAs shown in SEQ ID NO:21 and SEQ ID NO:22, the SEQ ID NO:21 is the 11st group of nucleotide sequence 5'-CCGGGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATTCCACCT TTTTG-3', the SEQ ID NO:22 is 5'-AATTCAAAAAGGTGGAATGCTCCGTGTTCTACTCGAGTAGAACACGGAGCATT CCACC-3'.
- 5. application according to claim 4, which is characterized in that the recombination that the specificity reduces FAM84B gene expression carries Body is that the recombination that the DNA for being inserted into the coding shRNA in the multiple cloning sites AgeI and EcoRI of GV493 plasmid is obtained carries Body.
- 6. application according to claim 5, which is characterized in that the specificity reduces the recombinant lentiviral of FAM84B gene expression Virus is by the recombinant vector and virus packaging 1.0 carrier of helper plasmid pHelper and virus packaging helper plasmid pHelper 2.0 carrier cotransfection mammalian cells obtain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910229012.4A CN110117593B (en) | 2019-03-25 | 2019-03-25 | Application of nucleic acid, recombinant vector and recombinant lentivirus for specifically reducing FAM84B gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910229012.4A CN110117593B (en) | 2019-03-25 | 2019-03-25 | Application of nucleic acid, recombinant vector and recombinant lentivirus for specifically reducing FAM84B gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110117593A true CN110117593A (en) | 2019-08-13 |
| CN110117593B CN110117593B (en) | 2020-07-28 |
Family
ID=67520614
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910229012.4A Active CN110117593B (en) | 2019-03-25 | 2019-03-25 | Application of nucleic acid, recombinant vector and recombinant lentivirus for specifically reducing FAM84B gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110117593B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090136945A1 (en) * | 2007-10-10 | 2009-05-28 | The Regents Of The University Of Michigan | Compositions and methods for assessing disorders |
| US20150079078A1 (en) * | 2012-04-13 | 2015-03-19 | Erasmus University Medical Center Rotterdam | Biomarkers for triple negative breast cancer |
| WO2016085944A1 (en) * | 2014-11-24 | 2016-06-02 | Case Western Reserve University | Diagnostic and therapeutic targeting of dnmt-1 associated rna in human cancer |
-
2019
- 2019-03-25 CN CN201910229012.4A patent/CN110117593B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090136945A1 (en) * | 2007-10-10 | 2009-05-28 | The Regents Of The University Of Michigan | Compositions and methods for assessing disorders |
| US20150079078A1 (en) * | 2012-04-13 | 2015-03-19 | Erasmus University Medical Center Rotterdam | Biomarkers for triple negative breast cancer |
| WO2016085944A1 (en) * | 2014-11-24 | 2016-06-02 | Case Western Reserve University | Diagnostic and therapeutic targeting of dnmt-1 associated rna in human cancer |
| US20170268008A1 (en) * | 2014-11-24 | 2017-09-21 | Case Western Reserve University | Diagnostic and therapeutic targeting of dnmt-1 associated rna in human cancer |
Non-Patent Citations (5)
| Title |
|---|
| COLLIN HOMER-BOUTHIETTE ET AL.: "eletion of the murine ortholog of the 8q24 gene desert has anti-cancer effects intransgenic mammary cancer models", 《BMC CANCER》 * |
| FENG-MING HSU ET AL.: "Circulating mRNA profiling in esophageal squamous cell carcinoma identifies FAM84B as a biomarker in predicting pathological response to neoadjuvant chemoradiation", 《SCIENTIFIC REPORTS》 * |
| WONG N ET AL.: "Upregulation of FAM84B during prostate cancer progression", 《ONCOTARGET》 * |
| 刘林林: "《恶性肿瘤生物治疗学》", 30 November 2013, 人民军医出版社 * |
| 刘静: "《分子生物学实验指导》", 31 December 2015, 中南大学出版社 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110117593B (en) | 2020-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105524924B (en) | Cyclic RNA circ-ZKSCAN1 use | |
| WO2018024034A1 (en) | Circular rna circ-nfatc3 and application thereof | |
| CN107663539A (en) | Circular rna circ PTGR1 purposes | |
| CN110123828A (en) | Application of the inhibitor of PRALR in the drug that resistance to taxol oophoroma is treated in preparation | |
| CN104611449B (en) | Application of the WWP1 genes in osteosarcoma diagnostic products and medicine is prepared | |
| CN111378753A (en) | Application of human PNO1 gene in lung cancer and related product | |
| CN107893115B (en) | ALKBH1 gene and application of expression product thereof in preparation of kit for diagnosing tumors and drugs for treating tumors | |
| CN110917357B (en) | Application of human GSDMB gene and related product | |
| CN104774966B (en) | Adenocarcinoma of lung miRNA labels | |
| CN110117593A (en) | Specificity reduces the application of the nucleic acid, recombinant vector and recombinant slow virus of FAM84B gene expression | |
| CN110055249A (en) | Reduce siRNA, recombinant vector and its application of THEM6 gene expression | |
| CN109988764A (en) | Reduce siRNA, recombinant vector and its application of NKIRAS2 gene expression | |
| CN110042101A (en) | Reduce siRNA, recombinant vector and its application of ROGDI gene expression | |
| CN110079527A (en) | Reduce siRNA, recombinant vector and its application of OSBPL2 gene expression | |
| CN109988762A (en) | Reduce siRNA, recombinant vector and its application of PSMD12 gene expression | |
| CN110129321A (en) | siRNA for reducing LSG1 gene expression, recombinant vector and application thereof | |
| CN110144348A (en) | SiRNA, recombinant vector and its application expressed for striking low DEAH box unwindase 16 | |
| CN102056631B (en) | Apoptosis inducer | |
| CN116716302B (en) | Nucleic acid molecule for reducing NEK2 gene expression in esophageal cancer cells | |
| CN104774928B (en) | The application of people's RRS1 genes and inhibitor | |
| CN116803424B (en) | SLC17A5 gene inhibitor and application thereof | |
| CN108441496A (en) | It is a kind of inhibit chicken SOX5 gene expressions shRNA sequences and its application | |
| CN114181936B (en) | shRNA for inhibiting chicken CA13 gene expression and application thereof | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| WO2022052909A1 (en) | Methods for editing bcl11a gene in hematopoietic stem/progenitor cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200909 Address after: No.9, Weidi Road, Xianlin University Town, Xianlin street, Qixia District, Nanjing, Jiangsu Province, 210028 Patentee after: NANJING CARVENDISH BIO-ENGINEERING TECHNOLOGY Co.,Ltd. Address before: No. 283, Jiefang Road, Yancheng City, Jiangsu Province Patentee before: JIANGSU VOCATIONAL College OF MEDICINE |
|
| TR01 | Transfer of patent right |