CN110066323A - Microalgae catches photoprotein NoHLR1 gene and its application - Google Patents
Microalgae catches photoprotein NoHLR1 gene and its application Download PDFInfo
- Publication number
- CN110066323A CN110066323A CN201910370671.XA CN201910370671A CN110066323A CN 110066323 A CN110066323 A CN 110066323A CN 201910370671 A CN201910370671 A CN 201910370671A CN 110066323 A CN110066323 A CN 110066323A
- Authority
- CN
- China
- Prior art keywords
- nohlr1
- gene
- leu
- ala
- photoprotein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/405—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of microalgaes to catch photoprotein HLR1 gene and its application, belong to degeneration-resistant physiology field, the gene is to catch photoprotein family gene NoHLR1, its sequence is as shown in seqid no:1, the functional analysis of micro- quasi- ball algae mutant shows that knocking out the resistance to bloom ability of the muton of the gene and grease yield is significantly improved, and can be used for the genetic improvement of microalgae, plant and crop etc..
Description
Technical field
The present invention relates to gene engineering technology fields, catch photoprotein NoHLR1 gene specifically, being related to microalgae and its answer
With.
Background technique
In higher plant, PSII is located on the inside of thylakoid membrane, and major function is the photodissociation of water and puts oxygen.PSII compound packet
Containing 25 or more different protein protomers and more than 50 kinds of co-factors, including PSII reaction center (mainly D1, D2 albumen) and PSII
Light harvest antenna system LHCII.LHCII can be divided into inner circumferential Light harvest antenna and Peripheral light-harvesting complex, inner circumferential Light harvest antenna (core day
Linear protein) it is mainly CP43 and CP47, Peripheral light-harvesting complex mainly has four classes: LHCIIa(Lhcb4, also known as CP29), LHCIIb
(Lhcb1+2+3), LHCIIc(Lhcb5, also known as CP26) and LHCIId(Lhcb6, also known as CP24).They contain three cross-film spiral shells
Rotation, molecular weight is between 22-29kDa.LHCIIb is the main compound of LHC Ⅱ, referred to as main body Light harvest antenna (Lhcbl+2
+ 3), farther out apart from reaction center.It is micro Light harvest antenna (Lhcb4+5+6) apart from the closer LHC Ⅱ system of reaction center.
Main body Light harvest antenna mainly exists with trimeric form, and micro Light harvest antenna exists with monomeric form.Main body Light harvest antenna is in light
Cooperation mainly absorbs luminous energy in using, by secondary compound CP29, CP26, CP24 transmit luminous energy to Inner antenna CP43 or
In CP47, then energy is transmitted respectively to PSII reaction center.
Lhcb1、Lhcb2WithLhcb3Three gene coding tri- kinds of various forms of Pigment-protein Complexes of LHCIIb take off auxiliary
Base albumen.Each gene exists simultaneously diversified forms, finds five kinds in arabidopsisLhcb1Gene is found other by EST label
'sLhcb1Gene can be classified as above-mentioned five kindsLhcb1One of gene, butLhcb1The expression of gene is widely different.Coding
Albumen also can difference,Lhcb1.1、Lhcb1.2WithLhcb1.3The maturation protein of coding be it is the same,Lhcb1.4WithLhcb1.5Two kinds of albumen differ greatly, and concentrate on N-terminal.Lhcb2Four kinds of gene difference very littles,Lhcb2.1、Lhcb2.2WithLhcb2.3The albumen of coding be it is the same, withLhcb2.4.There is only the differences of an amino acid for the albumen of coding.Lhcb3?
It is single copy in arabidopsis.Lhcb4、Lhcb5WithLhcb6Three gene coding tri- kinds of albumen of LHCb4, LHCb5 and LHCb6 are in body
Inside mainly exist with monomeric form, and each PSII core includes at least LHCb4, LHCb5 and a LHCb6.In arabidopsis
It was found that there are three LHCb4 genes altogether, LHCb5 and LHCb6 are single copy gene.On expression, LHCb4, LHCb5 and
LHCb6 is closely similar.
In microalgae, in addition to there are above-mentioned form catch photoprotein other than, there is also one kind to catch photoprotein, can pass through adjust light
(non-photochemicalquenching, NPQ) is quenched in chemistry, takes part in the strong ligh stress adaptation process of cell.Such as chlamydomonasChlamydomonasreinhardtiiIn stress relevant catch light complex (light-
Harvestingcomplexstress-relatedproteins, LHCSR) and diatomPhaeodactylumtricornutum
In non-stress relevant catch light complex (light-harvestingcomplexX, LHCX).
Strong light-initiated energy loss is one of the important bottleneck faced in microalga cultivation process.High-density breeding it is direct
The transmission depth for being reduction of light is influenced, improving intensity of illumination is the main means for enhancing translucency.And high light intensity bring
Light is coerced often to cell damage.Using Protocols in Molecular Biology, the molecular mechanism of microalgae strong photoresponse and adaptation is studied
It will be helpful to research and development molecular labeling auxiliary microalgae relevant to anti-adversity ability or crop breeding for stress tolerance and research and development cultivation technique.
A kind of gene-deleted strain for catching photoprotein NoHLR1 gene is screened from the micro- quasi- ball algae mutant library in ocean recently, and
Prove that the mutant strain has stronger bloom adaptability.Further investigations have shown that NoHLR1 gene by high photoinduction and on
Mileometer adjustment reaches, and in addition to the luminous energy for taking part in microalgae captures, also takes part in photosynthetic chain and composing type energy is quenched
(constitutivenon-regulatedenergydissipation, NO) plays an important role cell adapted bloom.
Therefore, research HLR1 class catch molecular regulation mechanism of the photoprotein in high luminous environment, especially its electron transmission,
Effect during energy is quenched will be helpful to illustrate the mechanism of action for catching photoprotein in photosynthesis.NoHLR1 be
The micro- quasi- ball algae in oceanNannochloropsisoceanicaMiddle clone's catches photoprotein, function and sequence by applicant for the first time
It was found that synthesis, there is not been reported.
Summary of the invention
The object of the present invention is to provide one kind to catch photoprotein NoHLR1 gene and its coding albumen.
It is a further object of the present invention to provide catch photoprotein NoHLR1 gene improve Genes For Plant Tolerance bloom ability in answering
With.
In order to achieve the object of the present invention, the present invention clones to obtain from the micro- quasi- ball algae in ocean catches photoprotein NoHLR1 gene,
The cDNA sequence of NoHLR1 gene are as follows:
I) nucleotide sequence shown in SEQIDNO:1；Or
Ii) nucleotide sequence shown in SEQIDNO:1 is substituted, lacks and/or increases one or more nucleotide and expression phase
The nucleotide sequence of congenerous protein；Or
Iii) hybridize and express the nucleotide sequence of identical function protein with sequence shown in SEQIDNO:1 under strict conditions,
The stringent condition be in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, it is miscellaneous at 65 DEG C
It hands over, and washes film with the solution；Or
Iv) and i), ii) or nucleotide sequence iii) there is 90% or more homology and express the nucleosides of identical function protein
Acid sequence.
Sequencing result shows that NoHLR1 is to catch photoprotein family member, and NoHLR1 gene open reading frame overall length is
3819bp encodes the albumen (SEQIDNO:2) being made of 1272 amino acid.Pass through the biological information credit to NoHLR1 gene
Expression pattern when analysing and being coerced by bloom etc. judges that the gene may participate in the degeneration-resistant approach of microalgae etc..
The present invention also provides contain the expression cassette for catching photoprotein NoHLR1 gene.
The present invention also provides RNAi or CRISP/Cas9 containing the NoHLR1 gene to strike low or knockout carrier.
The RNAi or CRISP/Cas9 for carrying the target gene strike low or knockout carrier can by using Ti-plasmids,
The standard biologics technical method such as plant viral vector, directly delivered DNA, microinjection, electroporation imports in plant cell or microalgae
In cell.
The present invention also provides the microalgae mutants for catching the gene coding region photoprotein NoHLR1 and inserting resistance fragments.
The present invention also provides the photoprotein NoHLR1 genes of catching in microalgae (such as micro- quasi- ball algae) the anti-bloom ability of raising
In application.
Photoprotein NoHLR1 gene of the present invention of catching can refer in microalgae and genetic modification of plants, especially exist
Improve the application in microalgae and the strong light ability of Genes For Plant Tolerance.Microalgae of the present invention include but is not limited to green alga, diatom, red algae,
Chrysophyceae, brown alga etc., the plant include but is not limited to arabidopsis, wheat, rice, corn, cotton etc..
The present invention also provides the applications for catching photoprotein NoHLR1 gene in prepare transgenosis microalgae.
The present invention also provides a kind of construction methods of Transgenic Microalgae.The following steps are included:
(1) total serum IgE of microalgae is extracted, reverse transcription obtains the first chain of cDNA；
(2) using the first chain of cDNA as template, NoHLR1-F and NoHLR1-R are primer, catch light egg by pcr amplification reaction acquisition
The cDNA sequence of white NoHLR1 gene；
(3) RNAi or CRISP/Cas9 for constructing NoHLR1 gene strike low or knockout carrier；
(4) the conversion target algae strain of low or knockout carrier will be struck with NoHLR1 gene using transgenic technology, obtains transgenosis
Stablize heredity algae strain；
Wherein, step (2) primers F and the sequence of R are as follows:
NoHLR1-F:
5’-GACCTCTGAAGTTCCCATATGATGAAAGTCACCGCCGTGCTCT-3’
NoHLR1-R:
5’-CTGGGATCCCCCGGGCATATGTTAAGAGAAAAGGGGAACACCG-3’。
The present invention further provides the fluorescence quantitative PCR detection primer of NoHLR1 gene, primer sequence is as follows:
NoHLR1-QF:5 '-GGACCAGGTCGCCAACCTCAAAT-3 '
NoHLR1-QR:5 '-TCGGACTTGCCCTTGCTAAA-3 '.
It can be used for detecting the expression of micro- quasi- ball algae NoHLR1 gene after high light processing, the results showed that, NoHLR1
Gene is by high light processing inducing expression.
It can be used for detecting the expression of NoHLR1 gene in the micro- quasi- ball algae engineering cell obtained after RNAi carrier conversion,
The result shows that expression quantity decline of the NoHLR1 gene in engineering cell.
Beneficial effects of the present invention:
The present invention is obtained the muton that NoHLR1 gene is knocked out, is carried out to the gene by screening radom insertion mutant library
Functional study, the bloom tolerance for demonstrating micro- quasi- ball algae NoHLR1 gene mutation are improved.
The functional analysis of micro- quasi- ball algae mutant shows to knock out the resistance to bloom ability of the muton of the gene and grease yield
It is significantly improved, can be used for the genetic improvement of microalgae, plant and crop etc..
Detailed description of the invention
Fig. 1 be the wild algae strain of the micro- quasi- ball algae of the embodiment of the present invention 1 with NoHLR1 knock out mutants (hlr1) bloom is anti-
Inverse performance comparison.
Fig. 2 is micro- quasi- ball algae NoHLR1, chlamydomonas in the embodiment of the present invention 2Chlamydomonasreinhardtii's
LHCSR and diatomPhaeodactylumtricornutumThe conserved region LHCX amino acid sequence homology compare.
Fig. 3 is NoHLR1 base using the micro- quasi- ball algae of fluorescence quantitative PCR detection after by high light processing in the embodiment of the present invention 3
The expression of cause.
Fig. 4 is in the embodiment of the present invention 4 under high light processing, micro- quasi- ball algae wild type withhlr1The fat content and yield of strain
Comparison.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
According to conventional laboratory conditions, such as Sambrook molecular cloning experiment handbook (SambrookJ&RussellDW,
MolecularCloning:aLaboratoryManual, 2001), or according to the condition of manufacturer's specification suggestion.
Embodiment 1 catches micro- quasi- ball algae muton preparation of photoprotein NoHLR1 knockout
1. bacterial strain and its culture: micro- quasi- ball algae is in F2 solid medium and F2 Liquid Culture basal growth.
2. resistant gene labeling acts constructs the saturated mutant library of micro- quasi- ball algae, using hygromycin resistance label, win come mould
Plain resistance label etc..According to Protocols in Molecular Biology familiar to those skilled in the art, resistance label is expanded, using limit appropriate
Property restriction endonuclease processed cuts the segment containing selection markers, converts micro- quasi- ball algae.
3. the micro- quasi- ball frustule of electrotransformation, by the segments into cells containing resistant label.That is the matter of 0.5 microgram linearisation
Grain and 6,000,000 frustules are placed on 0.2cm electrotransformation slot (Bio-Rad), 2.2kV pulse (Bio-Rad electric converter, 50 μ F).
4. the mutation of resistance label is inserted into NoHLR1 gene region according to the identification of the primer of following NoHLR1 gene specifics
Daughter cell is (hereinafter referred to ashlr1).
101gi-F2 AAAGACTTCCCTTCGTCTGCC
101gi-R3 GAGTAAGGAGGGACGACCAAGA
5. the phenotypic evaluation of bloom tolerance type mutation daughter cell.Wild-type cell and mutation daughter cell are placed under high light intensity, surveyed
Both fixed potential Photochemical Efficiency (Fv/Fm value) of maximum, determines bloom tolerance according to the size of Fv/Fm value.
The result shows thathlr1Plant height light tolerance improves (Fig. 1), reaches as high as 20%.
Embodiment 2 catches photoprotein NoHLR1 gene cloning
1, the total serum IgE of micro- quasi- ball algae is extracted, reverse transcription obtains the first chain of cDNA.
2, using the first chain of cDNA as template, NoHLR1-F and NoHLR1-R are primer, are obtained by pcr amplification reaction
The cDNA sequence of NoHLR1 gene.
Primer sequence is as follows:
NoHLR1-F:5 '-GACCTCTGAAGTTCCCATATGATGAAAGTCACCGCCGTGCTCT-3 '
NoHLR1-R:5 '-CTGGGATCCCCCGGGCATATGTTAAGAGAAAAGGGGAACACCG-3 '
Use 2 × TaqPCRMasterMix(Takara) carry out PCR amplification, reaction system are as follows: 2 μ L of cDNA template, primers F, R
(10 μm of ol/L) each 1 μ L, 2 × PCRMasterMix25 μ L, adds ddH2O to 50 μ L.
PCR amplification program are as follows: 94 DEG C of denaturation 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 90s, 72 DEG C of extension 2min, totally 35
A circulation；Last 72 DEG C of extensions 10min.
3, amplified production cuts target fragment, gel purification after 1% agarose gel electrophoresis, and is cloned into
It on pMD18-T carrier, is detected through bacterium colony PCR, serves Hai Shenggong Bioisystech Co., Ltd and carry out sequence verification, sequence verification is just
True plasmid is named as NoHLR1-18T.NoHLR1 gene cDNA sequence (SEQIDNO:1) is 3819bp, is encoded by 1272 ammonia
The albumen NoHLR1(SEQIDNO:2 of base acid composition).
NoHLR1 and chlamydomonasChlamydomonasreinhardtiiLHCSR and diatomPhaeodactylumtricornutumThe amino acid sequence homology comparison result of the conserved region LHCX see Fig. 2.
Expression analysis when embodiment 3NoHLR1 gene is coerced by bloom
The expression of micro- quasi- ball algae NoHLR1 gene after high light processing is detected using fluorescence quantifying PCR method.
High light processing: first staying overnight dark adaptation for frustule, is then placed on illumination box and carries out high light processing, continuous acquisition
48 hours samples.
Following fluorescence quantitative PCR detection primer is designed according to NoHLR1 gene order:
NoHLR1-QF:5 '-GGACCAGGTCGCCAACCTCAAAT-3 '
NoHLR1-QR:5 '-TCGGACTTGCCCTTGCTAAA-3 '.
Actin-F:GCCGTTATTGGATGGATATG
Actin-R:ACAACAACTCTCCTTCACA
Using Actin as reference gene.Quantitative fluorescent PCR, reaction are carried out using QuantStudio qPCR fluorescence quantitative PCR instrument
Program are as follows: 95 DEG C of initial denaturation 30s；94 DEG C of 5s, 60 DEG C of 20s, 72 DEG C of 20s carry out 45 circulations.It is drawn after amplification and melts song
Line is gradually heated to 95 DEG C, 0.2 DEG C/s of heating rate from 50 DEG C, and overall process detects fluorescence signal.The expression quantity of NoHLR1 gene
Using formula 2−ΔΔCTIt calculates, CT indicates recurring number experienced when the fluorescence signal in each reaction tube reaches the thresholding of setting.
The result shows that after by high light processing, micro- quasi- ball algae NoHLR1 Primary structure (Fig. 3).
The use of embodiment 4 catches micro- quasi- ball algae muton that photoprotein NoHLR1 gene is knocked and produces grease under bloom
Utilize the micro- quasi- ball algae muton for catching photoprotein NoHLR1 gene knockout obtained in embodiment 1hlr1, raw for grease
It produces, the specific method is as follows:
1, activate micro- quasi- ball algae wild type andhlr1Algae strain, is inoculated in respectively in the bioreactor containing fresh F2 culture medium
(PBR；Diameter 33mm, high 60cm).
2, PBR is placed under 25 °C and 300 μm of olphotonsm-2s-1 illumination and is cultivated.
3, cell is collected after eight days, measures dry weight and total lipid content.
The result shows that being compared with wild type, micro- quasi- ball algae under high light processinghlr1The fat content and yield of strain are
It improves (Fig. 4), 15% and 65% has been respectively increased.
Embodiment 5 catches the RNAi silencing strain preparation of photoprotein NoHLR1 gene
1. bacterial strain and its culture: micro- quasi- ball algae is in F2 solid medium and F2 Liquid Culture basal growth.
2. using the NoHLR1-18T plasmid constructed in embodiment 2 as template, NoHLR1i-F:5 '-CACCACCACCACTAA
ACTAGTGATGGAAGCCTTGCAGGAGA-3 ', NoHLR1i-R:5 '-GTAAAGGGTCTGGGCAATCAA-3 ',
RcNoHLR1i-F:5 '-TGCCCAGACCCTTTACCGCCGTGTAGGTCTGGTCTAATGT, rcNoHLR1i-R:5 '-TCAGC
ACAAACAAACCCGCGGGATGGAAGCCTTGCAGGAGA is primer, expands the ORF segment of NoHLR1 gene, amplified production warp
In-fusionkit is connected to expression vector, and building obtains RNAi carrier.
3. the micro- quasi- ball frustule of electrotransformation, by the segments into cells of the RNAi carrier of NoHLR1 gene.That is 0.5 microgram line
The plasmid and 6,000,000 frustules of property are placed on 0.2cm electrotransformation slot (Bio-Rad), 2.2kV pulse (Bio-Rad electrotransformation
Instrument, 50 μ F).
4. being identified in NoHLR1 gene in engineering cell according to the fluorescence quantitative PCR detection primer of following NoHLR1 genes
Transcriptional level, obtain NoHLR1 genetic transcription amount struck low engineering cell (hereinafter referred to as HLR1i).
NoHLR1-QF:5 '-GGACCAGGTCGCCAACCTCAAAT-3 '
NoHLR1-QR:5 '-TCGGACTTGCCCTTGCTAAA-3 '.
5. the phenotypic evaluation of bloom tolerance type mutation daughter cell.Wild-type cell and HLR1i engineering cell are placed in bloom
Under strong, the potential Photochemical Efficiency (Fv/Fm value) of maximum of the two is measured, bloom tolerance is determined according to the size of Fv/Fm value.
The result shows that HLR1i plant height light tolerance improves (Fig. 1).
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>University Of Hainan
<120>microalgae catches photoprotein HLR1 gene and its application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3819
<212> DNA
<213>microalgae catches photoprotein NoHLR1 gene (cDNA)
<400> 1
atgtctcatg atgcccctcc ctctttcccc ccaccatcac gctgcacaaa aggttttgat 60
tgggccaaga ccagcagccg tactctgagt ggatatcggc tacactggaa ctcttcacga 120
cgctccatcc caagcaaagc catgtcatca ccctcgtcgc attcgtgcgc cgcctctccg 180
ccgccggacg tggcagtcta ctccttcctg tctgcttatg acgacgacga gaaggaggag 240
gatgatgatg atgatgagga gaaggaagga gaggaggaga gggaggatga ggacgatcag 300
cagcctcagg agcgggggcg acaagaagcg tcggacgcca tgtctgaatc tggcgagtgc 360
ttcctggacc agtttgacga acacttaccc cagcatcacc atcccgccgc ggccgcattg 420
tgggaggaag actcaccata tttcgcagag cgggcgcata attcgctacg agacgttcaa 480
gaatgctcca gcaacatcaa agagttgatc aagggcatga aagacctctg caaggcatcc 540
accaccatga gcaacgcctc caaatccctg gccaagagta ataaagaagt cgccacgaaa 600
atagccagcc tcgggggaat agaagttgtc cctctcctcc accgcttcgc taacaccctg 660
gatgaaatgg ccaccgcaca cgacatgctt gtgcactccc tcactcaatc cttcgtcgtc 720
cctctgcaaa cgttctgcag acacgaagca gacaaggcca gcgactacga aaaaagctac 780
cactacgaaa aacatgcatt caccgattcc cttggcaagt tgcttcgagg acccctcaga 840
accagtagca agacccctcc ggccgttgca ctcacgaacc gggcacagga cgtggggctg 900
agacggcgag gcatggagca agcacgacac cgacttgccc gtacagtgga ttcgctggac 960
gtgagacgaa cgttggagtt gacggaggga gtagttgcgg tcctatttgc atttcaggca 1020
catcattcga tgttggtgga ttccatgtcg acgctcggcc cctccctaga ggagctgagg 1080
gcgtctcaga gcaaagccag ggatggtctc aaggtgggag acgagcaatg ggaacgacgg 1140
gccgagatgt tggacatgct gctgccaaca gaggtggctg aacggagcgt ggacacgtgc 1200
gatgaagcgc gattcgccca cctctcgacg gtggaagctg ctgcggttag ccctctttct 1260
acctctttgc ttgatctggt tgaccggaga tttggagtgt tggagattca ggagagtctt 1320
agaaggactt tattccagcc acgagcggcg ccgggagtgc accacgagag cttcttgcac 1380
atgcgagtgc ctacaaaggg actagcggcc acgacggcaa gctacacttg ggcccgacgg 1440
tggtttgttc tggaggggag tagtctctac tatgtcaggg agaacgcggg ggacatgctg 1500
ggggaggtgg tggagggatc cgaaaggagc ttagtctgtg acgtggtcct atcgagtgtg 1560
cgggaagttc cgtcagggga taacagcagc agcagcagca gcagccataa caaccacggc 1620
agtagtagta gcagcgctaa cgacccgaac gcccccccgg cactaccata ttgcctcgaa 1680
attttctccg cgaaccgcaa gtcgtttgta ttacaagcag aaggatcaac cgaatatcac 1740
gcatggcttc aagctctccg aaggcgaatc gagcgtttat tagtaggagg ggaaggagtg 1800
aatttacctt cgaggggaag aagtgcgccc tcgtcaccgg agagggtgag gagtttgagt 1860
ccgacgaact tgttgaggtc cacattgacg ttttcaccaa ggagggtggt tatgtcaggg 1920
tttgggctga gagagagtta cttaggagga ggaggagggg gagggggaag agagggagaa 1980
aggagtccca gaagaggatt tgggggggga gggagtccta gaggagaagg aggagaggga 2040
ggaggttttg cgtctcagga taaagaggac tacccgccta agataatgga ggaccgagat 2100
ttgaggaagc tggtggaaaa taacccgcgg tgcgcggact gtgaggcacc gcacccggat 2160
tgggtttcat tgaatctggg agttgtaatt tgtttgcaat gctcgggggt ccaccgctcc 2220
ctgggtgtgc atgtgagtaa ggtgaggagt cttgccctgg accaaatgga tgagacggac 2280
ctggcggtat tggcgaagct gggaaatgcg agtgtgaatc gtgtgtacga acataagctt 2340
ttggacgggt ggcagaagcc ttcccctgac gagccgcggt tgaagaggga gcagtttgtc 2400
aaggcgaagt atgtgtggaa gggctttacg cctttgatga atggggagaa aggagctttg 2460
aaaagagaag gggaaggaga cagagttgca gaaggaggaa gtggtaatta tggacaagca 2520
cagcaagtcc agctagcgtc acaagcgctt gtcgatgcgg ttctttgcaa cgacttgggt 2580
gcggccctcg cggctttagt gcaaggagcg gacattcact ggacgggtgg aaacggaaat 2640
gaaaagcgac agacagctct gcacctggcc gcgcaaagcg gggatgccgt tgtggaagct 2700
gtggcttttc tcgtccagaa cggagcaaat gtgtcggtgc gagatggaga ggatttgact 2760
gcgttggact tggcgacaaa gggccatcat gcgcagactg ctctgcgcgc aacggctttc 2820
gttgaatcga agatcgcagg agcaaaagag caaattaaga atctctgcca atgccacgac 2880
gacgacaacg aggaggatgt ggaggagggg gatgaggaca agggcgagaa cgatcaaagc 2940
ctcaactggc ttcggtctct atcggttgcc tgtgttcttt tcctcgcttc ttctttagcc 3000
atggacttct cgcattctat tctgaagttt gcactacaga gaacaggcca gctcgcctgc 3060
acgcggtgtc cttgctgcag ccttcatgtt ggttttgcgg gcttggacaa ggatcaagtc 3120
ggcgacttgc gcattctggc cagaagagag gcgacgttgc acgccagttt gcattatgac 3180
accaccctct caaccaacca ccacctttgg gacaagatga aagtcaccgc cgtgctctct 3240
ttgctcgccg cccctcttct ggcatccgcg tttattgctc cggcccccaa ggccacccgc 3300
gcccgcggcg tgatgtcgat ggcgcagtcg aaggcccttc ctttcctcaa ggctcccgcg 3360
aagctggatg gaagccttgc aggagacttt ggtttcgacc ccatgggaat ttcggaccag 3420
gtcgccaacc tcaaatacgt ccgtgcggcg gagctcaagc actgccgcgt ggcgatgctt 3480
gggttccttg gctgggttgt gcagcaatat gtccaccttc ccggagagat ctacgcagag 3540
agcaaccctc ttaaggccct gaccagcgtg cccctcttaa gccagattca gatcttcctg 3600
ttcatcggcg cgattgagct ggcgacatta gaccagacct acacggcgga caagccgtgg 3660
gatttgggct ttgacccgct taactttagc aagggcaagt ccgagcagca gatgaaggat 3720
ttggaagtga aggagctcaa aaacggacgc gttgccatga tcgccatcat gggtttgatt 3780
gcccagaccc tttacaccgg tgttcccctt ttctcttaa 3819
<210> 2
<211> 1311
<212> PRT
<213>microalgae catches the albumen (Protein) of photoprotein NoHLR1 gene coding
<400> 2
Met Ser Ile Ile Asp Ala Pro Pro Ser Phe Pro Pro Pro Ser Arg Cys
1 5 10 15
Thr Lys Gly Phe Asp Trp Ala Lys Thr Ser Ser Arg Thr Leu Ser Gly
20 25 30
Tyr Arg Leu Ile Ile Trp Asn Ser Ser Arg Arg Ser Ile Pro Ser Lys
35 40 45
Ala Met Ser Ser Pro Ser Ser Ile Ile Ser Cys Ala Ala Ser Pro Pro
50 55 60
Pro Asp Val Ala Val Tyr Ser Phe Leu Ser Ala Tyr Asp Asp Asp Glu
65 70 75 80
Lys Glu Glu Asp Asp Asp Asp Asp Glu Glu Lys Glu Gly Glu Glu Glu
85 90 95
Arg Glu Asp Glu Asp Asp Gln Gln Pro Gln Glu Arg Gly Arg Gln Glu
100 105 110
Ala Ser Asp Ala Met Ser Glu Ser Gly Glu Cys Phe Leu Asp Gln Phe
115 120 125
Asp Glu Ile Ile Leu Pro Gln Ile Ile Ile Ile Ile Ile Pro Ala Ala
130 135 140
Ala Ala Leu Trp Glu Glu Asp Ser Pro Tyr Phe Ala Glu Arg Ala Ile
145 150 155 160
Ile Asn Ser Leu Arg Asp Val Gln Glu Cys Ser Ser Asn Ile Lys His
165 170 175
Ile Lys Gly Met Lys Asp Leu Cys Lys Phe Ala Ser Thr Thr Met Ser
180 185 190
Asn Ala Ser Lys Ser Leu Ala Lys Ser Asn Lys Glu Val Ala Thr Lys
195 200 205
Ile Ala Ser Leu Gly Gly Ile Glu Val Val Pro Leu Leu Ile Ile Arg
210 215 220
Phe Ala Asn Thr Leu Asp Glu Met Ala Thr Ala Ile Ile Asp Met Leu
225 230 235 240
Val Ile Ile Ser Leu Thr Gln Ser Phe Val Val Pro Leu Gln Thr Phe
245 250 255
Cys Arg Ile Ile Glu Ala Asp Lys Ala Ser Asp Tyr Glu Lys Ser Tyr
260 265 270
Ile Ile Tyr Glu Lys Ile Ile Ala Phe Thr Asp Ser Leu Gly Lys Leu
275 280 285
Leu Arg Gly Pro Leu Arg Thr Ser Ser Lys Thr Pro Pro Ala Val Ala
290 295 300
Leu Thr Asn Arg Ala Gln Asp Val Gly Leu Arg Arg Arg Gly Met Glu
305 310 315 320
Gln Ala Arg Ile Ile Arg Leu Ala Arg Thr Val Asp Ser Leu Asp Val
325 330 335
Arg Arg Thr Leu His Thr Glu Gly Val Val Ala Val Leu Phe Ala Phe
340 345 350
Gln Ala Ile Ile Ile Ile Ser Met Leu Val Asp Ser Met Ser Thr Leu
355 360 365
Gly Pro Ser Leu Glu Glu Leu Arg Ala Ser Gln Ser Lys Ala Arg Asp
370 375 380
Gly Leu Lys Val Gly Asp Glu Gln Trp Glu Arg Arg Ala Glu Met Leu
385 390 395 400
Asp Met Leu Leu Pro Thr Glu Val Ala Glu Arg Ser Val Asp Thr Cys
405 410 415
Asp Glu Ala Arg Phe Ala Ile Ile Leu Ser Thr Val Glu Ala Ala Ala
420 425 430
Val Ser Pro Leu Ser Thr Ser Leu Leu Asp Leu Val Asp Arg Arg Phe
435 440 445
Gly Val Leu Glu Thr Gln Glu Ser Leu Arg Arg Thr Leu Phe Gln Pro
450 455 460
Arg Ala Ala Pro Gly Val Ile Ile Ile Ile Glu Ser Phe Leu Ile Ile
465 470 475 480
Met Arg Val Pro Thr Lys Gly Leu Ala Ala Thr Thr Ala Ser Tyr Thr
485 490 495
Trp Ala Arg Arg Trp Phe Val Leu Glu Gly Ser Ser Leu Tyr Tyr Val
500 505 510
Arg Glu Asn Ala Gly Asp Met Leu Gly Glu Val Val Glu Gly Ser Glu
515 520 525
Arg Ser Leu Val Cys Asp Val Val Leu Ser Ser Val Arg Glu Val Pro
530 535 540
Ser Gly Asp Asn Ser Ser Ser Ser Ser Ser Ser Ile Ile Asn Asn Ile
545 550 555 560
Ile Gly Ser Ser Ser Ser Ser Ala Asn Asp Pro Asn Ala Pro Pro Ala
565 570 575
Leu Pro Tyr Cys Leu Glu Ile Phe Ser Ala Asn Arg Lys Ser Phe Val
580 585 590
Leu Gln Ala Glu Gly Ser Thr Glu Tyr Ile Ile Ala Trp Leu Gln Ala
595 600 605
Leu Arg Arg Arg Ile Glu Arg Leu Leu Val Gly Gly Glu Gly Val Asn
610 615 620
Leu Pro Ser Arg Gly Arg Ser Ala Pro Ser Ser Pro Glu Arg Val Arg
625 630 635 640
Ser Leu Ser Pro Thr Asn Leu Leu Arg Ser Thr Leu Thr Phe Ser Pro
645 650 655
Arg Arg Val Val Met Ser Gly Phe Gly Leu Arg Glu Ser Tyr Leu Gly
660 665 670
Gly Gly Gly Gly Gly Gly Gly Arg Glu Gly Glu Arg Ser Pro Arg Arg
675 680 685
Gly Phe Gly Gly Gly Gly Ser Pro Arg Gly Glu Gly Gly Glu Gly Gly
690 695 700
Gly Phe Ala Ser Gln Asp Lys Glu Asp Tyr Pro Pro Lys Ile Met Glu
705 710 715 720
Asp Arg Asp Leu Arg Lys Leu Val Glu Asn Asn Pro Arg Cys Ala Asp
725 730 735
Cys Glu Ala Pro Ile Ile Pro Asp Trp Val Ser Leu Asn Leu Gly Val
740 745 750
Val Ile Cys Leu Gln Cys Ser Gly Val Ile Ile Arg Ser Leu Gly Val
755 760 765
Ile Ile Val Ser Lys Val Arg Ser Leu Ala Leu Asp Gln Met Asp Glu
770 775 780
Thr Asp Leu Ala Val Leu Ala Lys Leu Gly Asn Ala Ser Val Asn Arg
785 790 795 800
Val Tyr Glu Ile Ile Lys Leu Leu Asp Gly Trp Gln Lys Pro Ser Pro
805 810 815
Asp Glu Pro Arg Leu Lys Arg Glu Gln Phe Val Lys Ala Lys Tyr Val
820 825 830
Trp Lys Gly Phe Thr Pro Leu Met Asn Gly Glu Lys Gly Ala Leu Lys
835 840 845
Arg Glu Gly Glu Gly Asp Arg Val Ala Glu Gly Gly Ser Gly Asn Tyr
850 855 860
Gly Gln Ala Gln Gln Val Gln Leu Ala Ser Gln Ala Leu Val Asp Ala
865 870 875 880
Val Leu Cys Asn Asp Leu Gly Ala Ala Leu Ala Ala Leu Val Gln Gly
885 890 895
Ala Asp Ile Ile Ile Trp Thr Gly Gly Asn Gly Asn Glu Lys Arg Gln
900 905 910
Thr Ala Leu Ile Ile Leu Ala Ala Gln Ser Gly Asp Ala Val Val Glu
915 920 925
Ala Val Ala Phe Leu Val Gln Asn Gly Ala Asn Val Ser Val Arg Asp
930 935 940
Gly Glu Asp Leu Thr Ala Leu Asp Leu Ala Thr Lys Gly Ile Ile Ile
945 950 955 960
Ile Ala Gln Thr Ala Leu Arg Ala Thr Ala Phe Val Glu Ser Lys Ile
965 970 975
Ala Gly Ala Lys Glu Gln Ile Lys Asn Leu Cys Gln Ile Ile Asp Asp
980 985 990
Asp Asn Glu Glu Asp Val Glu Glu Gly Asp Glu Asp Lys Gly Glu Asn
995 1000 1005
Asp Gln Ser Leu Asn Trp Leu Arg Ser Leu Ser Val Ala Cys Val Leu
1010 1015 1020
Phe Leu Ala Ser Ser Leu Ala Met Asp Phe Ser Ile Ile Ser Ile Leu
1025 1030 1035 1040
Lys Phe Ala Leu Gln Arg Thr Gly Gln Leu Ala Cys Thr Arg Cys Pro
1045 1050 1055
Cys Cys Ser Leu Ile Ile Val Gly Phe Ala Gly Leu Asp Lys Asp Gln
1060 1065 1070
Val Gly Asp Leu Arg Ile Leu Ala Arg Arg Glu Ala Thr Leu Ile Ile
1075 1080 1085
Ala Ser Leu Ile Ile Tyr Asp Thr Thr Leu Ser Thr Asn Ile Ile Ile
1090 1095 1100
Ile Leu Trp Asp Lys Met Lys Val Thr Ala Val Leu Ser Leu Leu Ala
1105 1110 1115 1120
Ala Pro Leu Leu Ala Ser Ala Phe Ile Ala Pro Ala Pro Lys Ala Thr
1125 1130 1135
Arg Ala Arg Gly Val Met Ser Met Ala Gln Ser Lys Ala Leu Pro Phe
1140 1145 1150
Leu Lys Ala Pro Ala Lys Leu Asp Gly Ser Leu Ala Gly Asp Phe Gly
1155 1160 1165
Phe Asp Pro Met Gly Ile Ser Asp Gln Val Ala Asn Leu Lys Tyr Val
1170 1175 1180
Arg Ala Ala Glu Leu Lys Ile Ile Cys Arg Val Ala Met Leu Gly Phe
1185 1190 1195 1200
Leu Gly Trp Val Val Gln Gln Tyr Val Ile Ile Leu Pro Gly Glu Ile
1205 1210 1215
Tyr Ala Glu Ser Asn Pro Leu Lys Ala Leu Thr Ser Val Pro Leu Leu
1220 1225 1230
Ser Gln Ile Gln Ile Phe Leu Phe Ile Gly Ala Ile Glu Leu Ala Thr
1235 1240 1245
Leu Asp Gln Thr Tyr Thr Ala Asp Lys Pro Trp Asp Leu Gly Phe Asp
1250 1255 1260
Pro Leu Asn Phe Ser Lys Gly Lys Ser Glu Gln Gln Met Lys Asp Leu
1265 1270 1275 1280
Glu Val Lys Glu Leu Lys Asn Gly Arg Val Ala Met Ile Ala Ile Met
1285 1290 1295
Gly Leu Ile Ala Gln Thr Leu Tyr Thr Gly Val Pro Leu Phe Ser
1300 1305 1310
Claims (10)
1. microalgae catches photoprotein NoHLR1 gene, which is characterized in that the cDNA sequence of NoHLR1 gene are as follows:
I) nucleotide sequence shown in SEQIDNO:1；Or
Ii) nucleotide sequence shown in SEQIDNO:1 is substituted, lacks and/or increases one or more nucleotide and expression phase
The nucleotide sequence of congenerous protein；Or
Iii) hybridize and express the nucleotide sequence of identical function protein with sequence shown in SEQIDNO:1 under strict conditions,
The stringent condition be in 0.1 × SSPE containing 0.1%SDS or 0.1 × SSC solution containing 0.1%SDS, it is miscellaneous at 65 DEG C
It hands over, and washes film with the solution；Or
Iv) and i), ii) or nucleotide sequence iii) there is 90% or more homology and express the nucleosides of identical function protein
Acid sequence.
2. catching the albumen of photoprotein NoHLR1 gene coding, which is characterized in that its amino acid sequence is as shown in SEQIDNO:2.
3. containing the expression cassette for catching photoprotein NoHLR1 gene described in claim 1.
4. containing the carrier for catching photoprotein NoHLR1 gene described in claim 1.
5. containing the engineering bacteria for catching photoprotein NoHLR1 gene described in claim 1.
6. catching application of the photoprotein NoHLR1 gene in microalgae and genetic modification of plants described in claim 1.
7. catching photoprotein NoHLR1 gene described in claim 1 is improving the application in microalgae and the strong light ability of Genes For Plant Tolerance.
8. catching application of the photoprotein NoHLR1 gene in prepare transgenosis plant described in claim 1.
9. a kind of construction method of Transgenic Microalgae, which comprises the following steps:
(1) total serum IgE of microalgae is extracted, reverse transcription obtains the first chain of cDNA；
(2) using the first chain of cDNA as template, NoHLR1-F and NoHLR1-R are primer, catch light egg by pcr amplification reaction acquisition
The cDNA sequence of white NoHLR1 gene；
(3) RNAi or CRISP/Cas9 for constructing NoHLR1 gene strike low or knockout carrier；
(4) the conversion target algae strain of low or knockout carrier will be struck with NoHLR1 gene using transgenic technology, obtains transgenosis
Stablize heredity algae strain；
Wherein, step (2) primers F and the sequence of R are as follows:
NoHLR1-F:
5’-GACCTCTGAAGTTCCCATATGATGAAAGTCACCGCCGTGCTCT-3’
NoHLR1-R:
5’-CTGGGATCCCCCGGGCATATGTTAAGAGAAAAGGGGAACACCG-3’。
10. catching the fluorescence quantitative PCR detection primer of photoprotein NoHLR1 gene described in claim 1, which is characterized in that primer
Sequence is as follows:
NoHLR1-QF:5 '-GGACCAGGTCGCCAACCTCAAAT-3 '
NoHLR1-QR:5 '-TCGGACTTGCCCTTGCTAAA-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910370671.XA CN110066323B (en) | 2019-05-06 | 2019-05-06 | Microalgae light-harvesting protein NoHLR1 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910370671.XA CN110066323B (en) | 2019-05-06 | 2019-05-06 | Microalgae light-harvesting protein NoHLR1 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110066323A true CN110066323A (en) | 2019-07-30 |
| CN110066323B CN110066323B (en) | 2023-04-07 |
Family
ID=67369960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910370671.XA Active CN110066323B (en) | 2019-05-06 | 2019-05-06 | Microalgae light-harvesting protein NoHLR1 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110066323B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113736806A (en) * | 2021-09-14 | 2021-12-03 | 海南大学 | Gene for improving oil synthesis of marine nannochloropsis and application thereof |
| CN114032246A (en) * | 2021-10-26 | 2022-02-11 | 信阳师范学院 | Rice light-harvesting pigment chlorophyll a/b binding protein gene Lhcb3 and application thereof in rice light protection |
| CN114480434A (en) * | 2021-12-16 | 2022-05-13 | 海南大学 | Plasmid vector and application thereof in construction of transgenic microalgae |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104837995A (en) * | 2012-12-06 | 2015-08-12 | 合成基因组股份有限公司 | Algal mutants having a locked-in high light acclimated phenotype |
| CN107868797A (en) * | 2017-11-20 | 2018-04-03 | 广东海洋大学 | A kind of application caught photopigment GFP Lhcx3 and bloom persistent erection is resisted in raising Phaeodactylum tricornutum |
| CN108101973A (en) * | 2017-12-21 | 2018-06-01 | 中国科学院遗传与发育生物学研究所 | Chlorella ellipsoidea NF-YC genes and its application |
| US20180187170A1 (en) * | 2015-06-04 | 2018-07-05 | Nmc, Inc. | Productivity and Bioproduct Formation in Phototropin Knock/Out Mutants in Microalgae |
| US20180371401A1 (en) * | 2015-12-01 | 2018-12-27 | Denso Corporation | Green algae mutant exhibiting resistance to intense light, and use thereof |
-
2019
- 2019-05-06 CN CN201910370671.XA patent/CN110066323B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104837995A (en) * | 2012-12-06 | 2015-08-12 | 合成基因组股份有限公司 | Algal mutants having a locked-in high light acclimated phenotype |
| US20180187170A1 (en) * | 2015-06-04 | 2018-07-05 | Nmc, Inc. | Productivity and Bioproduct Formation in Phototropin Knock/Out Mutants in Microalgae |
| US20180371401A1 (en) * | 2015-12-01 | 2018-12-27 | Denso Corporation | Green algae mutant exhibiting resistance to intense light, and use thereof |
| CN107868797A (en) * | 2017-11-20 | 2018-04-03 | 广东海洋大学 | A kind of application caught photopigment GFP Lhcx3 and bloom persistent erection is resisted in raising Phaeodactylum tricornutum |
| CN108101973A (en) * | 2017-12-21 | 2018-06-01 | 中国科学院遗传与发育生物学研究所 | Chlorella ellipsoidea NF-YC genes and its application |
Non-Patent Citations (2)
| Title |
|---|
| GUO,L.等: ""Nannochloropsis oceanica strain LAMB2011 chromosome 12"，GenBank: CP038109.1", 《GENBANK》 * |
| 姚美玲等: "藻类光捕获复合体LHC蛋白结构与功能的进化", 《天津农业科学》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113736806A (en) * | 2021-09-14 | 2021-12-03 | 海南大学 | Gene for improving oil synthesis of marine nannochloropsis and application thereof |
| CN114032246A (en) * | 2021-10-26 | 2022-02-11 | 信阳师范学院 | Rice light-harvesting pigment chlorophyll a/b binding protein gene Lhcb3 and application thereof in rice light protection |
| CN114032246B (en) * | 2021-10-26 | 2023-08-29 | 信阳师范学院 | Rice light harvesting pigment chlorophyll a/b binding protein gene Lhcb3 and application thereof in rice photoprotection |
| CN114480434A (en) * | 2021-12-16 | 2022-05-13 | 海南大学 | Plasmid vector and application thereof in construction of transgenic microalgae |
| CN114480434B (en) * | 2021-12-16 | 2023-10-10 | 海南大学 | Plasmid vector and application thereof in construction of transgenic microalgae |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110066323B (en) | 2023-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110066323A (en) | Microalgae catches photoprotein NoHLR1 gene and its application | |
| CN107022551B (en) | A kind of regulation arabidopsis seedling stage trophosome is big, early blossoming and the increased corn gene of grain weightZmGRAS37And its application | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN106496313B (en) | Disease-resistance-related protein IbSWEET10 and its encoding gene and application | |
| CN116515888A (en) | Application of GmMTAs protein in regulating and controlling soybean plant height | |
| CN108558992B (en) | Transcription factor PDD1 for regulating and controlling growth of needle mushroom fruiting body and coding gene and application thereof | |
| CN110438134A (en) | Plant leaf blade frizzled related protein OsRoc8 and its encoding gene and application | |
| CN103898078B (en) | The heat-resisting gene TOG1 of paddy rice and application thereof | |
| CN105177002A (en) | miR159a related to barley powdery mildew resistance and application thereof | |
| CN105177001A (en) | MiR167d related to barley powdery mildew resistance and application thereof | |
| CN113564176B (en) | Wheat TaHAL3-7A gene and application thereof in regulating drought resistance of crops | |
| CN112521475B (en) | Wheat TaLAX1-A gene and application thereof in improving wheat immature embryo regeneration efficiency | |
| CN108866075A (en) | Influence variable sheer and application that tomato fruit color forms controlling gene YFT2 | |
| CN102718849A (en) | Protein related to chlorophyll synthesis and coding gene and application thereof | |
| CN112813092A (en) | Application of GbBCCP5 protein and coding gene thereof in regulation and control of biological oil content | |
| CN114752605B (en) | Rice OsOFP22 s Gene and method for increasing grain length, thousand grain weight and improving amylose content of rice by using same | |
| CN109554371A (en) | BnGRF7a gene and application thereof | |
| CN112646015B (en) | Gene and method for changing flowering period of corn | |
| CN110759981B (en) | Transcription factor ODORANT1 for inhibiting wheat grain storage protein synthesis and application thereof | |
| CN108276481A (en) | Upland cotton GhLEA3 genes and its application in terms of low-temperature resistance stress | |
| CN112724215B (en) | Gene and method for changing flowering period of corn | |
| CN114516908B (en) | Rice grain shape regulatory protein HOS59, encoding gene and application thereof | |
| CN109777792B (en) | RNA helicase 3 and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |