CN114480434B

CN114480434B - Plasmid vector and application thereof in construction of transgenic microalgae

Info

Publication number: CN114480434B
Application number: CN202111542989.5A
Authority: CN
Inventors: 路延笃; 邓颖; 顾新萍
Original assignee: Hainan University
Current assignee: Hainan University
Priority date: 2021-12-16
Filing date: 2021-12-16
Publication date: 2023-10-10
Anticipated expiration: 2041-12-16
Also published as: CN114480434A

Abstract

The invention relates to the technical field of genetic engineering, in particular to a plasmid vector and application thereof in construction of transgenic microalgae. The invention provides application of any one of 4 fragments of a nucleic acid sequence shown in SEQ ID NO. 1-4 in preparing a transgenic plasmid vector of microalgae, and provides a plasmid vector suitable for constructing the transgenic microalgae. The plasmid vector provided by the invention takes homologous fragments of microalgae as promoters or terminators, and takes microalgae-sensitive bleomycin as a resistance screening marker. The plasmid vector can smoothly introduce exogenous genes into microalgae, so that the method becomes an effective transgenic modification method of the microalgae.

Description

Plasmid vector and application thereof in construction of transgenic microalgae

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a plasmid vector and application thereof in construction of transgenic microalgae.

Background

Chlorella belongs to Chlorophyceae (Chlorophyta) Chlorophyceae (Chlorophyceae) Chlorophyceae (Chlorococcus) Chlorophyceae (Oocystaceae) Chlorella, and is a single-cell Chlorella. The chlorella cells are spherical or oval, the diameter of the chlorella cells is 3-12 mu m, the variety of the chlorella is rich, and the ecological types are various. Common chlorella, chlorella ellipsoidea and chlorella pyrenoidosa are common in China. Chlorella appears on the earth about 20 hundred million years ago, is widely distributed in nature, is mainly various in fresh water areas, has high propagation rate, is easy to survive, can grow in lakes, ditches, oceans and moist soil, has strong environmental tolerance, and can not only resist the high temperature of 39 ℃ but also resist the low temperature of minus 2 ℃. The chlorella is propagated through asexual division, and the division period is 10-20 hours. The number of known chlorella in the world is 15, and the number of varieties of the chlorella is hundreds, so that the distribution range is wide, and the ecological habits are various.

Chlorella was first discovered by beijerinck (m.w. beijerinck) in 1890. Up to now, there has been a history of research for up to half a century. During the second war period, due to the lack of grains, many countries have very important views on the study of chlorella. Not only the nutritive value of the food is researched, but also the food is directly eaten as food. Chlorella is one of a few species of algae that can be cultivated on a large scale. It is easy to culture and has fast growth rate, and can propagate by means of photoautotrophic organisms. And contains rich nutrients such as protein, polysaccharide, vitamins, carotenoid, DHA, EPA, astaxanthin and the like, and has high application value. Development and utilization of chlorella are an important direction for resource exploration of algae.

Compared with the large algae, the single-cell eukaryotic algae has the following characteristics: firstly, the culture condition is simple, and the production cost is low; secondly, the breeding is rapid and the regeneration is rapid; thirdly, the volume is relatively small, the structure is simple, and the extraction of gene expression products is convenient.

In recent years, with the development of molecular genetics of algae, exogenous genes can be introduced into algae and expressed with high efficiency. Algae is used as a novel bioreactor to produce valuable medicines, health products and fine chemical products, and the protein content of the algae is improved by a genetic engineering method, so that the improvement of the nutrition quality of the algae is one of the main trends of the development of the algae biotechnology in recent years.

However, in the past, the emphasis of the chlorella transgenic technology genetic engineering is that of freshwater chlorella, and the application of the chlorella as a bioreactor in practice is severely restricted by the limitations of low efficiency and poor stability. However, no successful report about the construction of a transgenic engineering system of the chlorella seawater exists at present.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide a plasmid vector suitable for chlorella and its application in constructing transgenic microalgae.

The invention provides application of any one of 4 fragments of a nucleic acid sequence shown in SEQ ID NO. 1-4 in preparation of a transgenic plasmid vector of microalgae.

Wherein the nucleic acid sequence shown in SEQ ID NO. 1-4 is a homologous sequence from chlorella. Wherein:

the upstream sequence shown in SEQ ID NO. 1 is designated as P3843 upstream sequence, or 3843up.

The upstream sequence shown in SEQ ID NO. 2 is designated as P8657 upstream sequence, or 8657up.

The downstream sequence shown in SEQ ID NO. 3 is designated as the T8657 downstream sequence, or 8657Down.

The downstream sequence shown in SEQ ID NO. 4 is designated as P8655 downstream sequence, or 8655Down.

The plasmid vector provided by the invention comprises: an upstream segment and a downstream segment;

the nucleic acid sequence of the upstream fragment is shown as SEQ ID NO. 1 or as SEQ ID NO. 2;

the nucleic acid sequence of the downstream fragment is shown as SEQ ID NO. 3 or SEQ ID NO. 4.

In the embodiment of the invention, the plasmid vector of the invention sequentially comprises: an upstream fragment shown as SEQ ID NO. 1, a target gene insertion site, and a downstream fragment shown as SEQ ID NO. 3.

In the embodiment of the invention, the plasmid vector of the invention sequentially comprises: an upstream fragment shown as SEQ ID NO. 2, a target gene insertion site, and a downstream fragment shown as SEQ ID NO. 4.

In the embodiment of the invention, the plasmid vector of the invention sequentially comprises: an upstream fragment shown as SEQ ID NO. 1, a target gene insertion site, and a downstream fragment shown as SEQ ID NO. 4.

In the embodiment of the invention, the plasmid vector of the invention sequentially comprises: an upstream fragment shown as SEQ ID NO. 2, a target gene insertion site, and a downstream fragment shown as SEQ ID NO. 3.

In some embodiments, the plasmid vector of the present invention comprises, in order: an upstream fragment shown as SEQ ID NO. 1, a screening marker, a target gene insertion site I, a downstream fragment shown as SEQ ID NO. 3, an upstream fragment shown as SEQ ID NO. 2, a target gene insertion site II and a downstream fragment shown as SEQ ID NO. 4.

In the invention, the screening marker comprises at least one of a resistance marker or a fluorescent reporter gene; the resistance marker comprises a gene for bleomycin resistance; the fluorescent protein comprises at least one of a green fluorescent reporter gene or a red fluorescent reporter gene.

In the invention, the target gene insertion site I and the target gene insertion site II are used as insertion sites in the plasmid vector, and comprise one or more enzyme cutting sites. During the insertion of the foreign gene, the two insertion sites are independently inserted into the target gene fragment. The sequence or number of gene segments into which they are inserted may be the same or different. The number of the target genes inserted into each site is one or more, and the target genes can be independent gene fragments or fused gene fragments, and the invention is not limited to the single target gene fragments.

In an embodiment of the present invention, the plasmid vector sequentially includes: an upstream fragment shown as SEQ ID NO. 1, an anti-bleomycin gene, an MSI99 gene fragment, a target gene insertion site I, a downstream fragment shown as SEQ ID NO. 3, an upstream fragment shown as SEQ ID NO. 2, a 3xFLAG fragment, a target gene insertion site II and a downstream fragment shown as SEQ ID NO. 4.

In some embodiments, the plasmid vector further comprises: fi ori element, amp resistance fragment, rep ori element, T7 promoter, lac promoter and p3 promoter.

The plasmid vector provided by the invention contains homologous fragments from microalgae, and can play roles of promoters and terminators in microalgae. And according to the property of the microalgae sensitive to bleomycin, introducing a gene for resisting bleomycin as a resistance screening marker.

The plasmid vector disclosed by the invention is applied to construction of transgenic microalgae.

The invention also provides a construction method of the transgenic microalgae, which comprises the following steps: after the target gene is inserted into the plasmid vector, the target gene is transformed into microalgae.

In the embodiment of the invention, the microalgae is chlorella.

In an embodiment of the invention, the conversion is an electrical conversion, the voltage of which is 500V.

The invention also provides microalgae obtained by the construction method.

The invention uses microalgae as host cells of genetic engineering, and the construction method of the invention is utilized to prepare and obtain a transgenic host.

The invention provides application of any one of 4 fragments of a nucleic acid sequence shown in SEQ ID NO. 1-4 in preparing a transgenic plasmid vector of microalgae, and provides a plasmid vector suitable for constructing the transgenic microalgae. The plasmid vector provided by the invention takes homologous fragments of microalgae as promoters or terminators, and takes microalgae-sensitive bleomycin as a resistance screening marker. The plasmid vector can smoothly introduce exogenous genes into microalgae, so that the method becomes an effective transgenic modification method of the microalgae.

Drawings

FIG. 1 shows growth curves of Chlorella seawater at different OD values;

FIG. 2 is a graph showing the sensitivity of the chlorella vulgaris to hygromycin (Hyg-B) provided by the embodiment of the invention;

FIG. 3 is a diagram showing the sensitivity of Chlorella vulgaris to kanamycin (Kan) provided by the embodiment of the invention;

fig. 4 is a graph showing an experiment of sensitivity of chlorella seawater to ampicillin (Amp) provided by the embodiment of the invention;

fig. 5 is a diagram showing a sensitivity experiment of the chlorella sea water provided by the embodiment of the invention to cephalosporin (Cefo);

fig. 6 is a diagram showing a sensitivity experiment of chlorella sea water to neomycin sulfate (NW) provided by the embodiment of the invention;

FIG. 7 is a graph showing the sensitivity of Chlorella vulgaris to streptomycin (Strep) provided by the example of the present invention;

FIG. 8 is a graph showing the sensitivity of Chlorella vulgaris to Qigomycin (spec) provided in the examples of the present invention;

fig. 9 is a sensitivity experimental diagram of chlorella sea water provided by the embodiment of the invention to gentamicin (Gent);

FIG. 10 is a diagram showing the sensitivity of Chlorella vulgaris to bleomycin (Zeocin) provided by the example of the present invention;

FIG. 11 is a diagram showing the sensitivity of Chlorella vulgaris to geneticin (G418) according to the example of the present invention;

FIG. 12a shows the pMEM-CP1 vector map, FIG. 12b shows the pMEM08-MSI99 vector map;

FIG. 13 shows the E.coli transformant clone PCR detection results of pMEM-CP 1: m is Marker;1: a negative control; 2-10: positive cloning of pMEM-CP 1;

FIG. 14 Boletycin resistant plate transgenic Chlorella vulgaris clone selection;

FIG. 15 PCR detection electrophoresis of transgenic Chlorella seawater strain. M: a Marker;1: positive control, pMEM-CP1 plasmid; 2: negative control, wild chlorella genome amplification result; 3-5: amplification results of transformed algae strains;

FIG. 16 shows the validation of ebl-mCherry; lane 4 is the validated band, lane 7 is the positive control, lanes 9 and 10 are the negative bands;

FIG. 17 shows the verification of 8657 up-eGFP; lanes 1, 3, 4 and 6 are lanes 7 and 8 are positive controls and lanes 11 and 12 are negative lanes.

Detailed Description

The invention provides a plasmid vector and application thereof in constructing transgenic microalgae, and a person skilled in the art can refer to the content of the plasmid vector and the application in constructing transgenic microalgae, so as to properly improve the technological parameters. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.

In the invention, SEQ ID NO. 1-4 are homologous sequences from Chlorella seawater, and specifically:

the upstream sequence shown in SEQ ID NO. 1 is designated as P3843 upstream sequence, or 3843up, which is the sequence: cactcagcaaggagtggtcacaagaagcatgtatggcagtttcacaaggggctatgcagctccgaattacagaactggtcacatatttgtactcttactgctattctcataaataccgtgtctttgtgcaaatttgaacatatcatgccagttaggagccaagagttagtggggttacctcatggccagccttgcctccacgtaaaaaaagtggactgggacagcactgatacgaagcagggaaagaacagctcctcatagtaaactaccaggtgacaatcatgtgactcagcttcttgaaacggaaatacagtaacgttcatgagcgtccccagcacttgcttgtcagggaattgatttgcgcttctaataaacaataaataaaaaaaatagtacgtcgctccatgaccaggggccttcgggtggagttttcagcaaggcgaccactcggagcagccgctgtgccgcaatacggccgccggtggaaacccgtctgttaacgtggagcccaaagattaacgagcaaagaggcaggaactaactaacctgatggcgtaatgttccgggcattgcagtttgaaacgcgtaatcaactgccaaggctgcacaagcgaaccgtggtggtcatatagaacatgttaacagcgggcaccttagttgtgccgacgacgctgtcccaaacaaattcgattactggggattcgaagcgtgtcgtcagtatcacagcgcacaaaagagtcgcagaatcttttcagaaacagatatggatgagggatagagatgtccagcgcgcctgtcatccttcgaacaggatcgctgtggcgggagttacgattttggatagatgcagattcgattgaccgaaagctcttaaacccaatcgtattcatttgtgcgtagtgcagtcgcttgcgtattctctctctcctctttcggatcgtcaagatggttgcactcgct.

The upstream sequence shown in SEQ ID NO. 2 is designated as P8657 upstream sequence, or 8657up, which is the sequence: aggaaaatttggactcggtgacggctgccttgaggaccaggtttcactgaaagcatcggctggtacaccaaacttggaattttttaggaacagaacaaaaaaagaccccacaatctcatgtcctacagggcttcaccagttccccgagtggaggtttttgatttgcaagctgtctcaggacgccaaactcaagcgacacaccgtgaataaacaatgtttgagaaattgaaaagcaagtaatcaaagcgattgtataattgattaataagcaagggaggcgctcgccaagatgaacgcgcgtcagacttagactccgtgagtacaccctgtacaccgcctagcggagagtgcggcgcgagcagacggtctgcattccacacatgcagggatcacatctcagctcacatcgcaatgcgtcgagcggtctctgagagcttccataacagaatcgtagctgagctggatagggctcgtgttccgctgtcgctgctgggttaaatccagcgggaacccattatctttctctgatcctagattttggcggggacagattcgcccaggcacacttaagcacgctgatcgcaatctatcgtcactcttcacttgcttgcatttgcccaacttacacacaaacatagcc.

The downstream sequence shown in SEQ ID NO. 3 is designated as the T8657 downstream sequence, or 8657Down, which sequence is: taagcagcttgcagcttgtgcttcaatatgctgtagcatggcagtttcttggcatgctgacacatcgttggcgggccatgacattgtcccattcgcccgcttcccttagctgtttttgctgttgcccaacaagctgaagcaaggattgcataaacacatgagaagaaaagcccgagaagagttttcctctttgcttgtatatttttgctgaacacttgttgtgtatttgatggctgcaagcaacccttggtggtgctggtggcttcagtgtaacgttccatctaatttgtggcaggtgaaatgtataaaacacatgtgatgttacaaatctgttgaagcaagaaatacgagccacatgaaacacaaaatgcactgagcttctcaatatgctcaagtactaggcaaaaatactatgacaaaattcgcattggttttcagaataatgccactagtttcgaaagcctaaacaactaaacagtcggccatcttactcgcaatccacacattgtttagtgtgaatatacaacttgtcatttatataccacctatcatttatgcaacacttcctacaaaaacaactgcccttgtctactaaccatacactgacatatgagtaaacattcacgtgacatggtcggatagggcgggacaacacactgttcgaatcctgcacagtaaaacaggcaacgcgaacagcaagagtgctctcagcaaaactttttcagctctgctgtcttgcacaccgggcacactgcatccgttt.

The downstream sequence shown in SEQ ID NO. 4 is designated as P8655 downstream sequence, or 8655Down, which has the sequence tgaaagggagcacttgcggggcacaggggacattccccaggtgatggcaggctggggagttgcttcagggcggaggaagaaagcaggaacacgctcaatagatgctgggcacagcaccagggaggatgcctggcatgccatggctctgtgggtcctccattggtggctgccgatcaacacacccatgtgtgcggcttgcagcaaagtgccttcagcccccaaagtgcactttgtacgttcttgctgtgcgtccaaagcttttggtaggttttacgggggcaaaacaagaacatcaaagaataatccggtgggcagcagccgtgtactgcgccttacttggtcgctctgaatggcacgagaggtaacgaggtaacaacagaacaaagctttctgggttcatcagtgtgcagaccgagcacgaccaagttgatgcatatcatgaaaaaaccatttttcctattgtttaaattatcgttctttcatctgttgcaagacgctgtccaaggtgctcacaggtcactcgctgtacagtttacaagcacaccgtaacacggacgtcaactgttacaagttacgcttacggcttctcgaacaaccttgttgcacaaaccagaatatttgttcaatcaaccccgcaattttgtgtccgtcaccaccaagcctaagtgacgtgctacctaaatcaccataacgagaatactaataatttgcacaatatcattactgatagaaatactttttatcctttttatgtcaggagagcacctggtgctcattcgcgcgcgaagaaagtttgcgggggcgcgcgggaagggcccgctttgatcagacctgccacgtctga.

In the embodiment of the invention, the sequence of the fusion nucleic acid fragment related to 3XFlag-EGFP is as follows: atggactacaaggatcacgacggggactacaaggatcacgacatcgactacaaggatgacgatgacaaggaattcgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag (SEQ ID NO: 5).

The sequence of the fusion nucleic acid fragment of eBle-mCheery is: atggccaagttgaccagcgccgtgcctgtgttgaccgcgagggacgtggccggagcggtggagttctggaccgacaggttggggttctccagggacttcgtggaggacgacttcgccggagtggtgagggacgacgtgaccttgttcatcagcgcggtgcaggaccaggtggtgcctgacaacaccttggcctgggtgtgggtgaggggattggacgagttgtacgccgagtggtccgaggtggtgtccacgaacttcagggacgcctccgggcctgccatgaccgagatcggagagcagccttgggggagggagttcgccttgagggaccctgccggaaactgcgtgcacttcgtggccgaggagcaggacgcgccggtgaaacagactttgaattttgacttgcttaaactggccggggacgtggagtcaaatcccggacccactagtggcattggcaagttcctcaaaagcgcgaagaagtttggcaaggcctttgtgaagatactgaatagcgcgccggtgaaacagactttgaattttgacttgcttaaactggccggggacgtggagtcaaatcccggacccactagtctgcaggtttcgaaaggggaagaggataacatggcgatcatcaaggagttcatgcgcttcaaggtgcacatggagggatccgtaaacgggcacgagttcgagatcgagggagaaggagaaggtagaccttacgagggaactcaaactgcaaagctcaaggtaacgaagggtggacctttgcctttcgcatgggatatcctttccccacagttcatgtacggatcgaaggcttacgtcaagcaccctgctgatattccagactacctgaagctgagctttcccgagggttttaagtgggagcgtgtcatgaactttgaagacggcggagttgtgacagtgacccaggattccagcttgcaagatggggagtttatctacaaggtgaaactccggggtaccaactttcccagcgatgggccggtcatgcaaaagaaaaccatgggctgggaagcaagttctgagaggatgtaccccgaagacggggccctcaaaggggagataaaacagcgacttaaattgaaggacggcggccattatgacgccgaagtgaaaacaacgtacaaggcgaaaaaacccgtgcagttgccgggcgcgtataatgtgaatattaagctggacattacctctcataatgaggactatacgattgtcgagcagtatgagcgggccgaggggaggcattcaacgggcgggatggacgaactctataag (SEQ ID NO: 6).

Besides the two fusion fragments, the target genes which can be inserted into the plasmid vector also comprise other genes which can be efficiently expressed in the chlorella sea water. For example, a key enzyme gene promoting accumulation of secondary metabolites (sterols, terpenoids, long chain hydrocarbons, long chain fatty alcohol compounds, pigments, volatile substances, etc.), a gene encoding a biological agent (auxin, interferon, serum proteins, insulin, etc.), or a gene encoding an antigen in a vaccine (cholera, rabies, anthrax, tetanus, amoeba, etc.), etc.

The transgenic engineering microalgae constructed by the invention can endow more excellent large-scale culture characteristics, such as insect resistance, disease resistance, salt resistance, drought resistance, herbicide resistance and the like. Can be used for designing and constructing a reaction facility with low cost and high light efficiency aiming at specific engineering microalgae, and reduces the scale culture cost. The invention can be used for transplanting and constructing biological elements and modules for producing terpenoid, long-chain hydrocarbon and long-chain fatty alcohol compounds, and establishing a cell factory for producing high-energy-density hydrocarbon fuels such as long-chain hydrocarbon, long-chain fatty alcohol, pigment, protein and the like. The novel photosynthetic production cell factory with improved light energy utilization and carbon fixation efficiency and optimized and controllable product path is obtained. The seawater chlorella accumulates high added value substrates (plant sterols, long unsaturated fatty acids, essential amino acids and terpenoid), and the content of the high added value substrates can be further improved by the constructed transgenic engineering microalgae. The seawater chlorella has the characteristics of high photosynthetic efficiency, rapid propagation and strong environmental adaptability, and the photosynthetic efficiency of the constructed transgenic engineering microalgae can be further improved by virtue of the transgenic engineering microalgae, so that the carbon dioxide can be effectively fixed, and the concentration of the carbon dioxide in the atmosphere is reduced.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

example 1

Picking single algae from plate for storing algae, inoculating into small triangular flask containing 20mLF/2 liquid culture medium, and culturing at incubator temperature of (25+ -1deg.C and illumination intensity of 50μmol.m ^-2 ·s ^-1 The chlorella is subjected to static culture for 2-3 times per day by a light-dark period of 16/8 hours. When the chlorella algae liquid grows to OD ₇₅₀ When the algae liquid is 2.0-2.5, the algae liquid is inoculated into 100mL of F/2 liquid culture medium for aeration culture, and the algae liquid can be used as a material for the next experiment when the algae liquid grows to the logarithmic phase.

The activated algae seeds are inoculated into a sterilized 50mL triangular flask (containing F/2 liquid culture medium not exceeding 1/3 of the volume of the triangular flask) for culture, three groups of parallel experiments are designed, so that the initial concentration of each algae liquid is kept consistent, sampling is carried out every 24 hours, absorbance values of chlorella are respectively measured at OD values of 550nm, 600nm, 650nm, 700nm and 750nm, and when data are processed, the average value of the results of the three groups of parallel experiments is used for drawing a growth curve graph (figure 1).

Example 2 determination of sensitivity of Chlorella to antibiotics

1. Sensitivity determination of Chlorella vulgaris hygromycin (Hyg-B)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, hygromycin was added to the medium to the set respective final concentrations, three replicates were set at each concentration, and the non-antibiotic-added algae solution was set as a control group to eliminate errors, and absorbance values of each sample were measured at 750nm every 48 hours (fig. 2).

2. Determination of sensitivity of Chlorella vulgaris to kanamycin (Kan)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, kanamycin was added to the medium to set respective final concentrations, three replicates were set for each concentration, and the non-antibiotic-added algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 3).

3. Determination of sensitivity of Chlorella vulgaris to ampicillin (Amp)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, and ampicillin was added to the medium to the set respective final concentrations, three replicates were set for each concentration, and an antibiotic-free algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 4).

4. Determination of sensitivity of Chlorella vulgaris to Cefomycin (Cefo)

Taking the growth to logarithmic phaseChlorella algae liquid according to initial inoculation value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, and then cephalosporin was added to the medium to the set respective final concentrations, three replicates were set for each concentration, and an antibiotic-free algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 5).

5. Determination of sensitivity of Chlorella vulgaris to neomycin sulfate (NW)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, neomycin sulfate was added to the medium to the set respective final concentrations, three replicates were set for each concentration, and the non-antibiotic-added algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 6).

6. Determination of sensitivity of Chlorella vulgaris to streptomycin (Strep)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, streptomycin was added to the medium to the set respective final concentrations, three replicates were set at each concentration, and the non-antibiotic-added algae solution was set as a control group to eliminate errors, and absorbance values of each sample were measured at 750nm every 48 hours (fig. 7).

7. Determination of sensitivity of Chlorella seawater to Qigomycin (Spect)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, and then, to the medium, azithromycin was added to the set respective final concentrations, three replicates were set for each concentration, and an antibiotic-free algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 8).

8. Determination of sensitivity of Chlorella seawater to gentamicin (Gent)

Taking small pieces grown to logarithmic phaseChlorella liquid according to initial inoculation value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, gentamicin was added to the medium to the set respective final concentrations, three replicates were set for each concentration, and an antibiotic-free algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 9).

9. Determination of sensitivity of Chlorella vulgaris to bleomycin (Zeocin)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, bleomycin was added to the medium to the set respective final concentrations, three replicates were set at each concentration, and the non-antibiotic-added algae solution was set as a control group to eliminate errors, and absorbance values of each sample were measured at 750nm every 48 hours (fig. 10).

10. Determination of sensitivity of Chlorella vulgaris to geneticin (G418)

Taking Chlorella liquid grown to logarithmic phase, and inoculating according to initial value OD ₇₅₀ Inoculum size of =0.1 was inoculated into F/2 liquid medium, and geneticin was added to the medium to the set respective final concentrations, three replicates were set for each concentration, and an antibiotic-free algae solution was set as a control group to eliminate errors, and absorbance values of the respective samples were measured at 750nm every 48 hours (fig. 11).

The result shows that the seawater chlorella is most sensitive to bleomycin and is suitable for being used as a target gene or a resistance screening marker in the process of modifying the chlorella genes.

Example 3 construction of transgenic algae strains Using Green and Red fluorescent reporter genes

In this example, P3843-eBle-mCheery-T8657-P8657-3XF lag-EGFP-T8655 is a fragment introduced into Chlorella, wherein the P3843 upstream sequence (3843 up), the T8657 downstream sequence (8657 down), the P8657 upstream sequence (8657 up) and the T8655 downstream sequence (8655 down) are each a promoter sequence, and the downstream sequences (8657 down, 8655 down) are each a terminator sequence.

In this example, the expression of the ebl-mCherry fragment was driven by the promoter in P3843, and the expression of the ebl-mCherry fragment was terminated by the terminator in T8657. The promoter in P8657 was used to drive expression of EGFP fragment and the terminator in T8655 was used to terminate EGFP expression.

Wherein ebe is the bleomycin resistance gene obtained in the early sensitivity experiment and mCherry is the red fluorescence reporter gene. ebl and mCherry are fusion expressed and are noted as ebl-mCherry fragments. GFP is a green fluorescent reporter.

1. Materials: the pBluescriptII SK (-) vector (abbreviated pKS II), the pMEM08-MSI99 plasmid (FIG. 12 b), and the pEGFP-N2 plasmid were all from university of Hainan.

2. Plasmid recombination process

The pKS II-eGFP recombinant plasmid was obtained first, and then the pMEM-CP1 plasmid was finally obtained (FIG. 12 a).

2.1 obtaining of inserts:

the ebl-mCherry fragment is in pMEM08-MSI99 plasmid, the GFP fragment is in pEGFP-N2 plasmid, and the chlorella homologous sequence is obtained by extracting chlorella genome and using specific primer PCR amplification.

Primers for each fragment:

2.2PCR procedure was optimized as follows:

8657up, eGFP, 8655down fragments: pre-denaturation (95 ℃,5 min); denaturation (95 ℃,15 sec), annealing (60 ℃,15 sec), extension (72 ℃,1 min) for a total of 35 cycles; final extension (72 ℃,5 min).

3843up, eBle-mCherry, 8657Down fragment: pre-denaturation (95 ℃,5 min); denaturation (95 ℃,15 sec), annealing (60 ℃,15 sec), extension (72 ℃,1min, 30 sec) for a total of 35 cycles; final extension (72 ℃,5 min).

2.3 restriction linearization of the pKS II vector

Enzyme cutting at 37deg.C for 2hr. The amount of endonuclease used was 1. Mu.l of SacII. After the enzyme digestion is completed, the enzyme digestion product is heated for 20min at 65 ℃ to inactivate the endonuclease.

Component (A)	20 mu L System
		10╳Quick buffer	2μL
pSK (-) circular plasmid	17μL
		Sac Ⅱ	1μL

Recovery of linearized vectors using a kit gel

2.4 preparation of connection reaction System

The calculation of the amount of DNA required for the recombination reaction was performed according to the formula:

the optimal amount of DNA used in the MultiS recombination reaction system is 0.03pmol per fragment (including linearized cloning vector). The mass of DNA corresponding to the number of moles can be roughly calculated from the following formula:

optimal amount per fragment= [0.02×fragment base pair number ] ng (0.03 pmol) of pSK II (-) linearized cloning vector: optimum amount of PCR product of 0.02X1971 (2961 bp) ≡59ng 3XFlag eGFP insert: optimum amount of 0.02X198 (798 bp) ≡ 16ng 8657upstream insert PCR product: optimal use of 0.02X1710 (710 bp) ≡ 14ng 8655downstream insert PCR product: 0.02X189 (889 bp) ≡18ng

2.5 ligation reaction

To facilitate accurate pipetting when formulating the system, pSK II (-) cleavage products were diluted to 59 ng/. Mu.l with ddH 2O; the amplified products were diluted with ddH2O to: 3XFlag eGFP insert 16 ng/. Mu.l, 8657up stream insert 14 ng/. Mu.l, 8655down stream insert 18 ng/. Mu.l. The following reaction system was prepared in an ice-water bath:

the reaction system: 20 mu L	Recombination reactions
		ddH ₂ O	10μL
pSK II (-) cleavage product (. Apprxeq.59 ng/. Mu.L)	1μL
		3XFlag eGFP insert amplification product (. Apprxeq.15 ng/. Mu.L)	1μL
8657up stream insert amplification product (. Apprxeq.13 ng/. Mu.L)	1μL
		6723Down stream insert amplification product (. Apprxeq.15 ng/. Mu.L)	1μL
5×CE MultiS Buffer	4μL
		ExnaseMultiS	2μL

Direct transformation to obtain pKS II-eGFP recombinant plasmid

2.6 obtaining of recombinant plasmid of pMEM-CP1 plasmid

1> restriction linearization pKS II vector

Component (A)	20 mu L System
		10╳Quick buffer	2μL
pSK-eGFP circular plasmid	16μL
		Xho I	1μL
Sba I	1μL

Reagent kit glue recovery linearization carrier

2> preparation of connection reaction System

Optimum usage of pSK II-eGFP linearization cloning vector: optimal use of 0.02X186 (5186 bp) ≡104ng eBle-mCherry insert PCR product: optimum amount of 0.02X11362 (1362 bp) ≡ 27ng 3843upstream insert PCR product: optimal use of 0.02×1009 (1009 bp) ≡ 20ng 8657downstream insert PCR product: 0.02X100 (800 bp) ≡16ng

3> ligation reaction

The pMEM-CP1 plasmid was finally obtained, and the recombinant product was identified using specific primer 3843up F1, 8655down T6, and the results are shown in FIG. 13.

EXAMPLE 4 electroporation of plasmid pMEM-CP1 into Chlorella seawater

Taking the concentration of about 1-3×10 ⁷ centrifuging 6000g of Chlorella vulgaris solution in logarithmic growth phase of cells/mL for 5min, discarding supernatant, rinsing with sorbitol for 2 times, and adjusting cell concentration to 2×10 with sorbitol ⁸ cells/mL. The concentrated algae bodies were aliquoted, and each fraction was added with linearized vector pMEM-CP1 and 1. Mu.l denatured salmon sperm DNA (15. Mu.g/mL) and mixed well. The mixture was transferred into a 2mm cuvette, shocked at 50. Mu.F, and immediately after shocking the algae were transferred into 5mL fresh F/2 medium. And recovering from weak light at 25 ℃.

Recovering cultured algae cells, diluting with F/2 to 10 ⁴ Each mL was plated on an F/2 agar resistant plate containing 30. Mu.g/mL zeocin, and the plate was placed in an illumination incubator and cultured for one month, and the growth of the strain on the plate was as shown in FIG. 14. Wild chlorella does not have monoclonal growth on the zeocin-containing resistance plate, chlorella shocked by 400V, 500V, 600V and 700V has monoclonal growth on the zeocin-containing resistance plate, and the chlorella shocked by 500V has the largest monoclonal growth on the chlorella plate and the best growth state, which indicates that 500V is the optimal voltage condition during electric conversion.

Selecting a monoclonal algae strain in a liquid culture medium, culturing to a logarithmic growth phase, extracting genome of the transformed algae strain, and carrying out PCR identification by using SEQ1-F and SEQ2-R as primers:

SEQ1-F:5’-CACTCAGCAAGGAGTGGTCACAA-3’

SEQ2-R:5’-AAACGGATGCAGTGTGCCC-3’

the theoretical size of the product is 5353bp. After the amplification, the amplified product was subjected to agarose gel electrophoresis, and the result of the electrophoresis is shown in FIG. 15. Lanes 3-5 are the amplification results of transformed algae strains, and each lane has one band, and the size of the band is consistent with the theoretical size. In conclusion, it was demonstrated that the eble gene was integrated in the chlorella genome. The expected results were also met by the test strip of ebl-mCherry (1305 bp) and the test strip of 8657up-eGFP (1499 bp).

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Hainan

<120> plasmid vector and application thereof in construction of transgenic microalgae

<130> MP21013686

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 960

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

cactcagcaa ggagtggtca caagaagcat gtatggcagt ttcacaaggg gctatgcagc 60

tccgaattac agaactggtc acatatttgt actcttactg ctattctcat aaataccgtg 120

tctttgtgca aatttgaaca tatcatgcca gttaggagcc aagagttagt ggggttacct 180

catggccagc cttgcctcca cgtaaaaaaa gtggactggg acagcactga tacgaagcag 240

ggaaagaaca gctcctcata gtaaactacc aggtgacaat catgtgactc agcttcttga 300

aacggaaata cagtaacgtt catgagcgtc cccagcactt gcttgtcagg gaattgattt 360

gcgcttctaa taaacaataa ataaaaaaaa tagtacgtcg ctccatgacc aggggccttc 420

gggtggagtt ttcagcaagg cgaccactcg gagcagccgc tgtgccgcaa tacggccgcc 480

ggtggaaacc cgtctgttaa cgtggagccc aaagattaac gagcaaagag gcaggaacta 540

actaacctga tggcgtaatg ttccgggcat tgcagtttga aacgcgtaat caactgccaa 600

ggctgcacaa gcgaaccgtg gtggtcatat agaacatgtt aacagcgggc accttagttg 660

tgccgacgac gctgtcccaa acaaattcga ttactgggga ttcgaagcgt gtcgtcagta 720

tcacagcgca caaaagagtc gcagaatctt ttcagaaaca gatatggatg agggatagag 780

atgtccagcg cgcctgtcat ccttcgaaca ggatcgctgt ggcgggagtt acgattttgg 840

atagatgcag attcgattga ccgaaagctc ttaaacccaa tcgtattcat ttgtgcgtag 900

tgcagtcgct tgcgtattct ctctctcctc tttcggatcg tcaagatggt tgcactcgct 960

<210> 2

<211> 640

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

aggaaaattt ggactcggtg acggctgcct tgaggaccag gtttcactga aagcatcggc 60

tggtacacca aacttggaat tttttaggaa cagaacaaaa aaagacccca caatctcatg 120

tcctacaggg cttcaccagt tccccgagtg gaggtttttg atttgcaagc tgtctcagga 180

cgccaaactc aagcgacaca ccgtgaataa acaatgtttg agaaattgaa aagcaagtaa 240

tcaaagcgat tgtataattg attaataagc aagggaggcg ctcgccaaga tgaacgcgcg 300

tcagacttag actccgtgag tacaccctgt acaccgccta gcggagagtg cggcgcgagc 360

agacggtctg cattccacac atgcagggat cacatctcag ctcacatcgc aatgcgtcga 420

gcggtctctg agagcttcca taacagaatc gtagctgagc tggatagggc tcgtgttccg 480

ctgtcgctgc tgggttaaat ccagcgggaa cccattatct ttctctgatc ctagattttg 540

gcggggacag attcgcccag gcacacttaa gcacgctgat cgcaatctat cgtcactctt 600

cacttgcttg catttgccca acttacacac aaacatagcc 640

<210> 3

<211> 763

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

taagcagctt gcagcttgtg cttcaatatg ctgtagcatg gcagtttctt ggcatgctga 60

cacatcgttg gcgggccatg acattgtccc attcgcccgc ttcccttagc tgtttttgct 120

gttgcccaac aagctgaagc aaggattgca taaacacatg agaagaaaag cccgagaaga 180

gttttcctct ttgcttgtat atttttgctg aacacttgtt gtgtatttga tggctgcaag 240

caacccttgg tggtgctggt ggcttcagtg taacgttcca tctaatttgt ggcaggtgaa 300

atgtataaaa cacatgtgat gttacaaatc tgttgaagca agaaatacga gccacatgaa 360

acacaaaatg cactgagctt ctcaatatgc tcaagtacta ggcaaaaata ctatgacaaa 420

attcgcattg gttttcagaa taatgccact agtttcgaaa gcctaaacaa ctaaacagtc 480

ggccatctta ctcgcaatcc acacattgtt tagtgtgaat atacaacttg tcatttatat 540

accacctatc atttatgcaa cacttcctac aaaaacaact gcccttgtct actaaccata 600

cactgacata tgagtaaaca ttcacgtgac atggtcggat agggcgggac aacacactgt 660

tcgaatcctg cacagtaaaa caggcaacgc gaacagcaag agtgctctca gcaaaacttt 720

ttcagctctg ctgtcttgca caccgggcac actgcatccg ttt 763

<210> 4

<211> 844

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

tgaaagggag cacttgcggg gcacagggga cattccccag gtgatggcag gctggggagt 60

tgcttcaggg cggaggaaga aagcaggaac acgctcaata gatgctgggc acagcaccag 120

ggaggatgcc tggcatgcca tggctctgtg ggtcctccat tggtggctgc cgatcaacac 180

acccatgtgt gcggcttgca gcaaagtgcc ttcagccccc aaagtgcact ttgtacgttc 240

ttgctgtgcg tccaaagctt ttggtaggtt ttacgggggc aaaacaagaa catcaaagaa 300

taatccggtg ggcagcagcc gtgtactgcg ccttacttgg tcgctctgaa tggcacgaga 360

ggtaacgagg taacaacaga acaaagcttt ctgggttcat cagtgtgcag accgagcacg 420

accaagttga tgcatatcat gaaaaaacca tttttcctat tgtttaaatt atcgttcttt 480

catctgttgc aagacgctgt ccaaggtgct cacaggtcac tcgctgtaca gtttacaagc 540

acaccgtaac acggacgtca actgttacaa gttacgctta cggcttctcg aacaaccttg 600

ttgcacaaac cagaatattt gttcaatcaa ccccgcaatt ttgtgtccgt caccaccaag 660

cctaagtgac gtgctaccta aatcaccata acgagaatac taataatttg cacaatatca 720

ttactgatag aaatactttt tatccttttt atgtcaggag agcacctggt gctcattcgc 780

gcgcgaagaa agtttgcggg ggcgcgcggg aagggcccgc tttgatcaga cctgccacgt 840

ctga 844

<210> 5

<211> 789

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atggactaca aggatcacga cggggactac aaggatcacg acatcgacta caaggatgac 60

gatgacaagg aattcgtgag caagggcgag gagctgttca ccggggtggt gcccatcctg 120

gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc 180

gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg 240

ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag ccgctacccc 300

gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag 360

cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag 420

ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac 480

atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat catggccgac 540

aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc 600

gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg 660

cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc 720

gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag 780

ctgtacaag 789

<210> 6

<211> 1305

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atggccaagt tgaccagcgc cgtgcctgtg ttgaccgcga gggacgtggc cggagcggtg 60

gagttctgga ccgacaggtt ggggttctcc agggacttcg tggaggacga cttcgccgga 120

gtggtgaggg acgacgtgac cttgttcatc agcgcggtgc aggaccaggt ggtgcctgac 180

aacaccttgg cctgggtgtg ggtgagggga ttggacgagt tgtacgccga gtggtccgag 240

gtggtgtcca cgaacttcag ggacgcctcc gggcctgcca tgaccgagat cggagagcag 300

ccttggggga gggagttcgc cttgagggac cctgccggaa actgcgtgca cttcgtggcc 360

gaggagcagg acgcgccggt gaaacagact ttgaattttg acttgcttaa actggccggg 420

gacgtggagt caaatcccgg acccactagt ggcattggca agttcctcaa aagcgcgaag 480

aagtttggca aggcctttgt gaagatactg aatagcgcgc cggtgaaaca gactttgaat 540

tttgacttgc ttaaactggc cggggacgtg gagtcaaatc ccggacccac tagtctgcag 600

gtttcgaaag gggaagagga taacatggcg atcatcaagg agttcatgcg cttcaaggtg 660

cacatggagg gatccgtaaa cgggcacgag ttcgagatcg agggagaagg agaaggtaga 720

ccttacgagg gaactcaaac tgcaaagctc aaggtaacga agggtggacc tttgcctttc 780

gcatgggata tcctttcccc acagttcatg tacggatcga aggcttacgt caagcaccct 840

gctgatattc cagactacct gaagctgagc tttcccgagg gttttaagtg ggagcgtgtc 900

atgaactttg aagacggcgg agttgtgaca gtgacccagg attccagctt gcaagatggg 960

gagtttatct acaaggtgaa actccggggt accaactttc ccagcgatgg gccggtcatg 1020

caaaagaaaa ccatgggctg ggaagcaagt tctgagagga tgtaccccga agacggggcc 1080

ctcaaagggg agataaaaca gcgacttaaa ttgaaggacg gcggccatta tgacgccgaa 1140

gtgaaaacaa cgtacaaggc gaaaaaaccc gtgcagttgc cgggcgcgta taatgtgaat 1200

attaagctgg acattacctc tcataatgag gactatacga ttgtcgagca gtatgagcgg 1260

gccgagggga ggcattcaac gggcgggatg gacgaactct ataag 1305

Claims

1. A plasmid vector comprising, in order: an upstream fragment shown as SEQ ID NO. 1, a screening marker, a target gene insertion site I, a downstream fragment shown as SEQ ID NO. 3, an upstream fragment shown as SEQ ID NO. 2, a target gene insertion site II and a downstream fragment shown as SEQ ID NO. 4; the screening markers comprise a resistance marker and a fluorescent reporter gene; the resistance marker is a bleomycin resistance gene; the fluorescent reporter gene is a green fluorescent protein reporter gene or a red fluorescent protein reporter gene.

2. The plasmid vector of claim 1, comprising, in order: an upstream fragment shown as SEQ ID NO. 1, an anti-bleomycin gene, an MSI99 gene fragment, a target gene insertion site I, a downstream fragment shown as SEQ ID NO. 3, an upstream fragment shown as SEQ ID NO. 2, a 3xFLAG fragment, a target gene insertion site II and a downstream fragment shown as SEQ ID NO. 4.

3. The plasmid vector of claim 2, further comprising: fi ori element, amp resistance fragment, rep ori element, T7 promoter, lac promoter and p3 promoter.

4. Use of the plasmid vector according to any one of claims 1 to 3 for constructing transgenic chlorella.

5. The construction method of the transgenic microalgae is characterized by comprising the following steps: after inserting a target gene into the plasmid vector according to any one of claims 1 to 3, transforming the target gene into microalgae;

the microalgae is chlorella; the conversion was an electrical conversion with a voltage of 500V.