CN110037996B - Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs - Google Patents
Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs Download PDFInfo
- Publication number
- CN110037996B CN110037996B CN201910359269.1A CN201910359269A CN110037996B CN 110037996 B CN110037996 B CN 110037996B CN 201910359269 A CN201910359269 A CN 201910359269A CN 110037996 B CN110037996 B CN 110037996B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- inner membrane
- preparation
- mir
- protoplast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/5005—Wall or coating material
- A61K9/5063—Compounds of unknown constitution, e.g. material from plants or animals
- A61K9/5068—Cell membranes or bacterial membranes enclosing drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Botany (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a preparation method of escherichia coli intimal vesicle of endogenous high-expression nucleic acid antitumor drug, which comprises the steps of adopting a tRNA (transfer ribonucleic acid) bracket method, stably inserting miRNA into a carrier, converting the carrier into escherichia coli to ensure that the carrier endogenously expresses a large amount of miRNA with the function of killing cancer cells, removing the outer cell membrane and periplasm components of the escherichia coli by using lysozyme to obtain an escherichia coli protoplast, filtering the protoplast by using a polycarbonate membrane, smashing the protoplast, and finally purifying and separating the inner membrane vesicle of the protoplast by adopting an ultracentrifugation method to obtain the low-toxicity escherichia coli intimal vesicle of high-expression miRNA. The method provided by the invention is simple to operate, low in production cost, low in toxicity and high in efficiency, and can be used for large-scale fermentation preparation. As a novel drug carrier, the compound can be applied to the preparation of antitumor drugs, can obviously inhibit the growth of non-small cell lung cancer, and has wide application prospect in the field of drug carriers.
Description
Technical Field
The invention relates to biotechnology, in particular to a preparation method of an inner membrane vesicle of endogenous high-expression miRNA low-endotoxin escherichia coli, and also relates to application of the prepared inner membrane vesicle in preparation of antitumor drugs.
Background
The method for carrying the medicine by using the bacterial nano vesicles has gradually attracted attention in recent years due to the characteristics of low mass production cost, easy modification, strong stability, relatively simple surface protein, capability of greatly reducing immunogenicity after modification and the like. Gram-negative bacteria have two membranes, an outer membrane, which contains toxins such as lipopolysaccharide, and an inner membrane, which contains fewer toxins relative to the outer membrane. It has been found that both the outer and inner membranes of gram-negative bacteria can naturally or artificially produce nano-sized vesicles.
Bacterial Outer Membrane Vesicles (OMVs) are spherical, bilayer structures with a particle size of approximately 50-100 nm. OMV contains Lipopolysaccharide (LPS), lipid, water soluble protein, DNA, mRNA, microRNA, etc. OMVs are a physiological structure unique to bacteria, and are produced mainly by gram-negative bacteria, and also by a small number of gram-positive bacteria. Bacteria secrete the nano vesicles on the cell membrane out of the membrane at each stage of the growth stage, but spontaneously generated OMVs often carry various toxins such as lipopolysaccharides and are very easy to cause immune reactions of organisms when being used as drug carriers.
The inner membrane vesicle is also in a spherical and bilayer structure, the particle size of the inner membrane vesicle is about 60-250nm, substances such as DNA, microRNA and the like are contained in the inner membrane vesicle, and compared with the outer membrane vesicle, the inner membrane vesicle is reduced in toxins such as lipopolysaccharide and the like, and the inner membrane vesicle is more suitable for being used as a carrier for loading nucleic acid drugs. However, the escherichia coli inner membrane vesicle (protoplast vesicle) is fragile relative to the outer membrane, so that not only the preparation process is more complicated, but also the obtaining mode is more difficult, and the loading of the drug into the inner membrane vesicle in vitro cannot be realized according to the current drug loading technology level.
Currently, the drug loading method using bacterial membrane vesicles is mainly to carry the drug in OMVs in vitro. The existing methods include an electric shock method, a 37 ℃ warm bath method, an ultrasonic method and the like, but the methods have the defects of low drug loading efficiency, complex operation process, dependence on expensive instruments and facilities and the like. In recent years, new techniques have been developed, such as opening OMV surface channels using saponin OMV inducers, blocking the channels with calcium chloride after the drug has entered the OMV to complete drug loading, etc. Although the new technologies improve the drug delivery efficiency to a certain extent, simplify the operation process and get rid of the dependence of expensive instruments and facilities, the new technologies are still limited to the technical level of extracellular drug-loaded drugs, and the application of using the inner membrane vesicles for drug loading is not seen so far.
Disclosure of Invention
The invention aims to provide a preparation method of low-endotoxin escherichia coli inner membrane vesicles of endogenous high-expression nucleic acid antitumor drugs, which is simple to operate, low in production cost and better in safety compared with the prior art.
In order to achieve the purpose, the invention can adopt the following technical scheme:
the preparation method of the escherichia coli inner membrane vesicle of the endogenous high-expression miRNA comprises the following steps:
firstly, selecting tRNA as a bracket, inserting a miRNA precursor Pre-miRNA into an anticodon ring of the tRNA to form a Pre-miRNA-tRNA with a stable structure, protecting the miRNA from being degraded in escherichia coli, and simultaneously, expressing a large amount of miRNA; then inserting the Pre-miRNA-tRNA with stable structure into a plasmid vector, and transferring the plasmid vector into escherichia coli;
secondly, culturing the escherichia coli obtained in the first step in a triangular flask containing a liquid LB culture medium to ensure that a large amount of endogenous miRNA with the function of killing cancer cells is expressed, and then collecting bacterial liquid;
thirdly, using lysozyme to remove outer membrane and periplasm components of the escherichia coli in the bacterial liquid (simultaneously removing endotoxin such as lipopolysaccharide on the outer membrane) to obtain an escherichia coli protoplast; then filtering the protoplast by using a polycarbonate membrane, and smashing the protoplast to obtain low-toxicity protoplasm inner membrane vesicles;
and fourthly, purifying the protoplast in-vivo membrane vesicles obtained in the third step to obtain escherichia coli inner membrane vesicles with a large amount of expressed miRNA.
The aperture of the polycarbonate membrane adopted for filtering the protoplast in the third step is 12um, 6um and 1.2um in sequence.
And when the protoplast in-vivo membrane vesicles are purified in the fourth step, polycarbonate membranes with the pore diameters of 6um and 1.2um are sequentially arranged on a filter and are filtered by an ultracentrifugation method, the centrifugation rotating speed of the filter is 100000Xg, and the centrifugation time is 70 min.
The escherichia coli intimal vesicle of the endogenous high-expression nucleic acid antitumor drug prepared by the invention is applied to preparation of the antitumor drug.
According to the invention, endogenous high-expression miRNA with cancer cell killing function of escherichia coli is utilized for the first time, and the miRNA is loaded into the vesicle as a medicine, compared with the existing method for loading the medicine in vitro, the method has the advantages of simple operation and low production cost, can be prepared in a large scale by a fermentation technology, and is easy to realize mass production; meanwhile, the escherichia coli protoplasm in-vivo membrane vesicle is used as a drug carrier, compared with the outer membrane vesicle, toxins such as lipopolysaccharide are reduced, the safety is higher, and the escherichia coli protoplasm in-vivo membrane vesicle has larger application potential in practice as a novel drug carrier. The compound is applied to the preparation of antitumor drugs, can obviously inhibit the growth of non-small cell lung cancer, and has wide application prospect in the field of drug carriers.
Drawings
FIG. 1 is an agarose gel electrophoresis picture of a recombinant vector endogenously expressing miR-34a in large quantities.
FIG. 2 is a transmission electron micrograph of E.coli inner membrane vesicles.
FIG. 3 is a drug loading efficiency comparison between the inner membrane vesicles of escherichia coli endogenously expressing miR-34a prepared by the invention and the outer membrane vesicles of escherichia coli exogenously loaded with drugs.
FIG. 4 shows the killing effect of the inner membrane vesicles of the Escherichia coli endogenously expressing miR-34a on non-small cell lung cancer cells in different time periods.
Detailed Description
The present invention is described in more detail below with reference to specific embodiments and the attached drawings so as to facilitate understanding for those skilled in the art.
The main instruments and reagents used in the examples of the present invention include:
PCR instrument (TAKARA BIO INC, D-8707);
electrophoresis apparatus, ultraviolet apparatus (Beijing six instruments factory, model DYY-7C);
an ultramicro nucleic acid protein analyzer (Nanodrop ND-2000);
inverted fluorescence microscope (OLYMPUS microscope CX 31);
HF-3300 field emission transmission electron microscope (Hitachi high New technology Co.)
Constant temperature shaker (Shanghai Zhicheng analytical instruments manufacturing Co., Ltd., ZWY-2012C);
a desk-top high-speed centrifuge (Hunan instruments laboratory development Co., Ltd., H1650-W);
cell membrane green fluorescent probe (shanghai bi yuntian biotechnology institute);
hind III, Sal I, EcoR I, BamH I restriction enzyme, T4 DNA ligase (Beijing NEB Corp.);
DNA marker, PCR high-fidelity enzyme mix, BCA protein, a concentration test kit, BL21 competent cells and K12 Escherichia coli strain (Beijing Solebao company);
a plasmid mini-extraction kit, a PCR product purification kit, an agarose gel DNA recovery kit, an RNA extraction kit, a reverse transcription kit and a fluorescent quantitative PCR kit (Zhengzhou Beibei Biotechnology Co., Ltd.).
Example 1 preparation of endogenous E.coli expressing miRNA in high amounts
Step 1, designing a primer sequence of pET-31b (+) and carrying out PCR amplification on a whole gene sequence of the pET-31b (+)
(1) Design of primer sequence of pET-31b (+) vector
The sequence is as follows:
an upstream primer: 5'-AAGAATTCAAGCTTATCTCCTTCTTAAAGTTAAACAAAATTATT-3', respectively;
a downstream primer: 3 '-TTGGATCCGTCGAC GCAATAACTAGCATAACCCCTTG-5'.
(2) Extracting K12 colibacillus plasmid as template for PCR amplification of pET-31b (+) vector
a. Taking out K12 Escherichia coli strain preserved in 20% glycerol from-80 low temperature refrigerator, thawing, streaking on solid LB plate containing 100mg/ml ampicillin in ultra-clean bench, and culturing at 37 deg.C for 12-16 hr in upside down state;
b. selecting a single clone, and performing shake culture for 12-16 hours at 37 ℃ and 220rmp in 5ml of LB liquid culture medium containing 100mg/ml of ampicillin;
c. plasmid DNA was extracted from 3ml of the bacterial solution using a plasmid kit and stored in a freezer at-20 ℃.
(3) PCR amplification of pET-31b (+) vector
The PCR amplification system is as follows: the total system is 20ul, the template plasmid is 0.2 ul; 1ul of primer; high fidelity enzyme mix 10ul, ddH2O 8.8ul。
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 5min for 32 cycles; extension at 72 ℃ for 7 min.
Step 2, designing a primer sequence of tRNA and amplifying a gene sequence of tRNA by PCR
(1) the sequence of the tRNA is: 5'-TGGCTGGGGTCAATGGATTCGAACCAGGGAATGCCGGTATCAAAAACCGGTGGCCTTACCGCTTGGCGATACCCCA-3'
(2) the primer sequences of the trnas were:
an upstream primer 5'-TTGAATTCTGGCTGGGGTACCTGGATTCGAACCAG-3';
the downstream primer 3 '-AACTTAAGCGGGTCCAGGGTTCAAGTCCCTGTTC-5'.
(3) Extracting human genome DNA as a template of PCR amplified tRNA:
a. gargling for three times by using clear water, and scraping epithelial cells of the oral cavity by using a sterilized toothpick;
b. the toothpick scraped the oral epithelial cells is soaked in SLA lysate for 5 minutes;
c. oral epithelial DNA was extracted using a DNA extraction kit.
(4) PCR amplification tRNA sequence:
the PCR amplification system is as follows: the total system is 20ul, and the oral epithelial DNA is 1 ul; 1ul of primer; high fidelity enzyme mix 10ul, ddH2O 8ul。
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 63 ℃ for 30 s; extension at 72 ℃ for 30s for 32 cycles; extension at 72 ℃ for 7 min.
Step 3, designing a primer sequence of miR-34a and amplifying the gene sequence of miR-34a by PCR
(1) The gene sequence of miR-34a is as follows:
5’-CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAATAATGCGCCGTCCACGGCA -3’。
(2) the primer sequence of miR-34a is as follows:
the sequence of the upstream primer is as follows: 5'-AATTCGAACGCTGGCGACGGGACATTATTACTTTTGGT-3', respectively;
the sequence of the downstream primer is as follows: 3 '-AAGTCGACTGCCGTGGACGGCGCATTATTACTCAC-5';
(3) the PCR amplification system is as follows: the total system is 20ul, and the oral epithelial DNA is 1 ul; 1ul of primer; high fidelity enzyme mix 10ul, ddH2O 8ul。
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 30s for 32 cycles; extension at 72 ℃ for 7 min.
And 4, respectively purifying the three PCR amplification products by using a PCR product purification kit, wherein the purified DNA can be stored in a refrigerator at the temperature of-20 ℃.
Step 5, double enzyme digestion of purified Pet-31b (+) vector and tRNA fragment
(1) Pet-31b (+) vector after double enzyme digestion purification
a. The double enzyme cutting system is as follows: EcoR I,2ul, BamH I,2ul, 10 XNEB buffer, 5 ul; 30ul of Pet-31b (+) vector; ddH2O11 ul; the total is 50 ul.
b. The enzyme was cleaved in an incubator at 37 ℃ for 12 hours
(2) Purified fragments of double-digested tRNA
a. The double enzyme cutting system is as follows: EcoR I,2ul, BamH I,2ul, 10 XNEBbufferr 3.15ul; 30ul of tRNA fragments; ddH2O11 ul; the total is 50 ul.
b. The enzyme was cleaved in an incubator at 37 ℃ for 12 hours.
(1) Preparing one percent of agarose gel, preparing a macroporous comb, adding the Pet-31b (+) vector subjected to double enzyme digestion into a loading buffer in proportion, completely loading the sample for 120V 40min, and then cutting the gel under an ultraviolet instrument for recovery;
(2) making two percent of agarose gel, a macroporous comb, adding the tRNA fragment subjected to double enzyme digestion into a loading buffer in proportion, completely loading, carrying out 120V 20min, and then cutting the gel under an ultraviolet instrument for recovery.
Step 7, connecting the Pet-31b (+) vector and the tRNA fragment
a. The connecting system is as follows: pet-31b (+) vector, 5 ul; 3ul tRNA fragment; t4 DNA ligase 2ul; buffer 2ul; ddH2O8 ul; the total system was 20 ul;
b. the reaction was carried out at 4 ℃ for 16 hours.
Step 8, transforming, quality improving particles, sequencing and verifying plasmids
a. Transforming the ligation product by using DH5 alpha competent cells, adding the ligation product into the competent cells, incubating for 30min on ice, thermally shocking for 90s at 42 ℃, standing for 5min on ice, adding 500ul LB liquid culture medium without antibiotics, performing shake culture at 37 ℃ and 150rpm for 1 h, uniformly coating the bacterial liquid on a solid LB plate containing 100mg/ml, and performing inversion culture at 37 ℃ for 12-16 h;
b. selecting a monoclonal antibody, placing the monoclonal antibody in a test tube of 5ml LB liquid culture medium containing 100ug/ml ampicillin, performing shake culture at 37 ℃ and 220rpm for 12-16 hours, and extracting plasmids from 3ml of bacterial liquid by using a plasmid miniextraction kit;
c. the plasmid is preliminarily verified by using a PCR amplification method, wherein the PCR amplification system is as follows: plasmid 1 ul; 1ul of primer; high fidelity enzyme mix 10ul, ddH2O8 ul; the total system was 20 ul. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 63 ℃ for 30 s; extension at 72 ℃ for 30s for 32 cycles; extension at 72 ℃ for 7 min. And (4) glue running verification, namely sending the preliminarily screened plasmids to a sequencing company for sequencing until the Pet-tRNA recombinant vector with accurate sequencing is screened.
Step 9, double enzyme digestion of the purified Pet-tRNA plasmid and miR-34a fragment
(1) Pet-tRNA plasmid after double digestion and purification
a. The double enzyme cutting system is as follows: hind III,2ul, Sal I,2ul, 10 XNEB buffer, 5 ul; 25ul of Pet-31b (+) plasmid; ddH2O16 ul; the total is 50 ul.
b. The enzyme was cleaved in an incubator at 37 ℃ for 12 hours
(2) Double-enzyme digestion miR-34a purified fragment
a. The double enzyme cutting system is as follows: hind III,2ul, Sal I,2ul, 10 XNEB buffer, 5 ul; 30ul of miR-34a fragment; ddH2O16 ul; the total is 50 ul.
b. The enzyme was cleaved in an incubator at 37 ℃ for 12 hours.
(1) Preparing one percent of agarose gel and a macroporous comb, adding the double digested Pet-tRNA plasmid into a loading buffer in proportion, loading all the samples, carrying out 120V 40min, and then cutting the gel under an ultraviolet instrument for recovery;
(2) making two percent of agarose gel, a macroporous comb, adding the miR-34a fragment subjected to double enzyme digestion into a loading buffer according to a proportion, completely loading the sample, carrying out 120V 20min, and then cutting the gel under an ultraviolet instrument for recovery.
Step 11, connecting the Pet-tRNA and the miR-34a fragment
a. The connecting system is as follows: Pet-tRNA, 6 ul; miR-34a fragment 4 ul; t4 DNA ligase 2ul; buffer 2ul; ddH2O6 ul; the total system was 20 ul;
b. the reaction was carried out at 4 ℃ for 16 hours.
a. Transforming the ligation product by using DH5 alpha competent cells, adding the ligation product into the competent cells, incubating for 30min on ice, thermally shocking for 90s at 42 ℃, standing for 5min on ice, adding 500ul LB liquid culture medium without antibiotics, performing shake culture at 37 ℃ and 150rpm for 1 h, uniformly coating the bacterial liquid on a solid LB plate containing 100mg/ml, and performing inversion culture at 37 ℃ for 12-16 h;
b. selecting a monoclonal antibody, placing the monoclonal antibody in a test tube of 5ml LB liquid culture medium containing 100ug/ml ampicillin, performing shake culture at 37 ℃ and 220rpm for 12-16 hours, and extracting plasmids from 3ml of bacterial liquid by using a plasmid miniextraction kit;
c. the plasmid is preliminarily verified by using a PCR amplification method, wherein the PCR amplification system is as follows: plasmid 1 ul; 1ul of primer; high fidelity enzyme mix 10ul, ddH2O8 ul; the total system was 20 ul. The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing at 60 ℃ for 30 s; extension at 72 ℃ for 30s for 32 cycles; extension at 72 ℃ for 7 min. And (3) running glue for verification, and sending the preliminarily screened plasmids to a sequencing company for sequencing until the Pet-tRNA-miRNA recombinant vector with accurate sequencing and no error is screened. The result of agarose gel electrophoresis of the recombinant vector is shown in FIG. 1.
d. The plasmids of the sequencing pair are transformed by BL21 competent cells, so that escherichia coli capable of endogenously expressing a large amount of miRNA is obtained.
And 13, inducing the escherichia coli obtained in the step 12 by using IPTG (isopropyl-beta-thiogalactoside) to ensure that the escherichia coli internally expresses miR-34a in a large quantity
a. Taking out the BL21 strain after the recombinant plasmid is transferred from a refrigerator at minus 80 ℃, streaking the strain on an LB solid agarose plate added with 100ug/ml ampicillin after the strain is melted, placing the plate in a constant temperature incubator at 37 ℃ for inverted culture for 16-18 hours, and growing a monoclonal on the plate;
b. selecting a single clone in a test tube of 5ml LB liquid culture medium containing 100ug/ml ampicillin, and finally placing the test tube in a shaker at 37 ℃ and carrying out shake culture at the rotating speed of 220rpm for 12-16 hours;
c. inoculating a bacterial solution obtained by test tube culture into an LB liquid culture medium containing 100ug/ml ampicillin according to the volume ratio of 1:100, continuing to shake and culture in a shaker at 37 ℃ at the rotating speed of 220rpm, adding 1mol/L isopropyl thiogalactoside (IPTG) into the LB culture medium when the OD value of escherichia coli reaches 0.5-1 at the wavelength of 600mm, continuing to shake and culture the escherichia coli in the shaker at 37 ℃ at the rotating speed of 220rpm, thereby inducing the endogenous large-scale expression of the miRNA (miR-34 a) with the function of killing cancer cells by the escherichia coli. 14, detecting the specific expression quantity of miR-34a in escherichia coli by using fluorescent quantitative PCR (polymerase chain reaction)
(1) Fluorescent quantitative PCR detection of miR-34a in bacterial liquid
a. Taking 1ml of the bacterial liquid induced by IPTG in the step 13 for 12 hours to a centrifuge tube, centrifuging at 12000rpm for 1 minute, pouring off the supernatant, fully cracking the thalli by using 500ul RL Solution, adding 40ul of chloroform, fully and uniformly mixing, centrifuging at 12000rpm for 10 minutes, carefully sucking 200ul of the supernatant to a new centrifuge tube, adding 400ul of absolute ethyl alcohol, fully and uniformly mixing, adding into a chromatographic column, centrifuging at 12000rpm for 1 minute, pouring off the filtrate, washing twice by using Wash Buffer, and finally washing RNA by using DEPC water without RNase to obtain fresh RNA;
b. reverse transcription is carried out by using the downstream primer of miR-34a in the step 2, and the RNA obtained in the previous step is reverse transcribed into cDNA; 3ul of RNA, 2ul of 10 Xbuffer, 2ul of reverse transcriptase, 1ul of downstream primer and 12ul of DEPC water, wherein the total amount is 20ul, a reverse transcription program is selected in a PCR instrument, the reaction is carried out for 1 hour at 50 ℃, and the reaction is terminated at 5min at 72 ℃;
c. 16S RNA was used as an internal control for fluorescent quantitative PCR, and the primers for 16S RNA were as follows:
an upstream primer 5'-CTCTTGCCATCGGATGTGCCCA-3';
the downstream primer 3 '-CCAGTGTGGCTGGTCATCCTCTCA-5'.
d. B, using the cDNA obtained in the step b as a template, and carrying out silver light quantitative PCR on a fluorescence quantitative machine; 1ul of cDNA, 1ul of miR-34a primer, 10ul of 2 Xfluorescence quantitative mix and 8ul of DEPC water, wherein the total amount is 20ul, the experiment is carried out in a fluorescence quantitative machine, the pre-denaturation is carried out for 5min at 95 ℃, the denaturation is carried out for 94 ℃ for 30s, the annealing is carried out for 60 ℃ for 30s, the extension is carried out for 72 ℃ for 30s, and 40 cycles are total;
e. after the reaction is finished, the concentration and the relative expression quantity of the miR-34a in the escherichia coli are obtained through data analysis.
Example 2 preparation of E.coli inner Membrane vesicles
1. Removing outer cell membrane of Escherichia coli with lysozyme to obtain Escherichia coli protoplast
a. Respectively preparing 50mM Tris-HCl (pH 8.0), 50mM Glucose and 1mM EDTA solution, using the solutions as buffer solution, and preparing lysozyme with the concentration of 4 mg/ml;
b. adding lysozyme into the collected Escherichia coli thallus (prepared in example 1), reacting in water bath at 37 deg.C for 20min, and removing toxins such as lipopolysaccharide on the outer membrane of the cell;
c. taking out a little bacterial liquid, observing and detecting under a microscope until the protoplast with completely removed walls is obtained.
2. Filtering the escherichia coli protoplast by using a polycarbonate membrane to obtain the escherichia coli protoplast inner membrane nano vesicle
a. Mounting a polycarbonate membrane with a pore size of 12um on a filter with a size of 47mm, and filtering the escherichia coli protoplast;
b. installing a polycarbonate membrane with the aperture of 6um on a filter with the size of 47mm, and filtering the escherichia coli protoplast obtained in the previous step;
c. the polycarbonate membrane with the pore size of 1.2um is arranged on a filter with the size of 47mm, and the escherichia coli protoplast obtained in the previous step is filtered to obtain the protoplast internal membrane vesicle with the micron size.
3. Performing ultradensity gradient centrifugation purification (100000 Xg 70 min) on the micron protoplasm in vivo membrane vesicles obtained in the step 2; ultracentrifugation (100000 Xg 70 min) again after primary purification; thereby obtaining the escherichia coli protoplast inner membrane nano vesicle (namely the escherichia coli inner membrane vesicle with endogenous high expression miRNA).
Example 3 fluorescent quantitative PCR detection of miR-34a in E.coli inner membrane vesicles prepared in example 2
a. Separating escherichia coli inner membrane vesicles by using the method provided by the embodiment 2, resuspending the escherichia coli inner membrane vesicles by using 100ul PBS, fully lysing thalli by using 500ul RL Solution, adding 40ul chloroform, fully mixing the mixture, centrifuging the mixture at 12000rpm for 10min, carefully sucking 200ul supernatant into a new centrifuge tube, adding 400ul absolute ethyl alcohol, fully mixing the mixture, adding the mixture into a chromatographic column, centrifuging the mixture at 12000rpm for 1 min, pouring off filtrate, washing the filtrate twice by using Wash Buffer, and finally eluting RNA by using RNA (deoxyribonucleic acid) enzyme-free DEPC (diethyl phthalate) water to obtain fresh RNA;
b. reverse transcription is carried out by using the downstream primer of miR-34a in the step 2, and the RNA obtained in the previous step is reverse transcribed into cDNA; 3ul of RNA, 2ul of 10 Xbuffer, 2ul of reverse transcriptase, 1ul of downstream primer, 12ul of DEPC water and 20ul of the whole system, selecting a reverse transcription program in a PCR instrument, reacting for 1 hour at 50 ℃, terminating the reaction for 5min at 72 ℃ and finishing the reaction for 40 cycles;
c. 16S RNA was used as an internal control for fluorescent quantitative PCR, and the primers for 16S RNA were as follows:
an upstream primer 5'-CTCTTGCCATCGGATGTGCCCA-3';
the downstream primer 3 '-CCAGTGTGGCTGGTCATCCTCTCA-5'.
d. B, using the cDNA obtained in the step b as a template, and carrying out silver light quantitative PCR on a fluorescence quantitative machine; 1ul of cDNA, 1ul of primers of miR-34a, 10ul of 2 Xfluorescence quantitative mix, 8ul of DEPC water, and 20ul of the total system, performing experiments in a fluorescence quantitative machine, pre-denaturing at 95 ℃ for 5min, denaturing at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extending at 72 ℃ for 30 s;
e. after the reaction is finished, the concentration and the relative expression amount (fluorescent quantitative PCR result) of the miR-34a in the escherichia coli inner membrane vesicle are obtained through data analysis and are shown in the following table.
As can be seen from the data in the table: the expression level of miR-34a in the bacterial liquid is 1.36 times of that of internal reference (16 sRNA), and the expression level of miR-34a in the inner membrane vesicle can reach 0.71 times of that of the internal reference.
Example 4 morphological Observation of inner Membrane vesicles of E.coli prepared in example 2
1. Dropping the solution of the escherichia coli inner membrane vesicle obtained by ultracentrifugation in the example 2 on the clean surface of the sealing membrane;
2. placing the copper mesh membrane surface on the liquid drop of the escherichia coli inner membrane vesicle, suspending for 10min, and slowly sucking dry by using filter paper;
3. transferring the copper mesh onto 3% glutaraldehyde stationary liquid drops, suspending for 5min, and blotting with filter paper;
4. transferring the copper net onto the DW liquid drop, repeating for ten times, each time for 2min, and drying by using filter paper each time;
5. transferring the copper mesh onto 4% uranyl acetate dye solution drops, and sucking the dye solution drops with filter paper after 10 min;
6. transferring the copper net onto 1% methyl cellulose liquid drop, and sucking dry with filter paper after 5 min;
7. and (4) after the sample is naturally dried, generally more than 30min, observing by using a transmission electron microscope and taking a picture. The transmission electron micrograph of the inner membrane vesicle of Escherichia coli is shown in FIG. 2, in which the saucer-like morphology (shown by arrows) of the inner membrane vesicle can be seen, and the size is 30-200nm, which is consistent with the morphology and size characteristics of the inner membrane vesicle.
Example 5 drug loading efficiency of E.coli inner membrane vesicles prepared in example 2
Extracting RNA from the escherichia coli intimal vesicle solution prepared in the example 2 by using an RNA extraction kit, then performing reverse transcription on the RNA into cDNA by using a reverse transcription kit, and finally performing fluorescence quantitative PCR by using a fluorescence quantitative PCR kit to obtain the drug loading efficiency of endogenous drug-loaded escherichia coli intimal vesicle;
preparing an escherichia coli outer membrane vesicle solution with the same concentration as the inner membrane vesicle solution in the previous step by using an ultracentrifugation method, suspending the solution by using PBS, adding a medicament for co-incubation, then performing electric shock by using an electroporator, and incubating for 30min again to obtain the medicament-carrying outer membrane vesicle. And (3) extracting RNA from the obtained outer membrane vesicle solution by using an RNA extraction kit, then carrying out reverse transcription on the RNA into cDNA by using a reverse transcription kit, and finally carrying out fluorescence quantitative PCR by using a fluorescence quantitative PCR kit to obtain the drug loading efficiency of the escherichia coli outer membrane vesicle loaded by the in vitro method.
Fig. 3 shows a histogram comparing the drug loading efficiency of the inner membrane vesicles of escherichia coli endogenously expressing miRNA in a large amount with the drug loading efficiency of the outer membrane vesicles of escherichia coli loaded with drugs by an in vitro method, and it can be seen that: the medicine carrying efficiency of the inner membrane vesicles prepared by the invention is far higher than that of the outer membrane vesicles.
Example 6 evaluation of the killing effect of endogenous E.coli intimal vesicles expressing a large amount of miRNA (Ribose nucleic acid) prepared in example 2 of the invention on non-small cell lung cancer cells
(1) Culture of cells
a. Taking out the frozen A549 non-small cell lung cancer cells from the liquid nitrogen tank, screwing the mouth of the frozen bottle down, and then putting the bottle into a 37 ℃ water bath kettle to shake until the cells are completely melted;
b. centrifuging the thawed cells in a centrifuge at 1000rpm for 10 min;
c. adding 9ml of culture medium into a culture dish, pouring the culture medium in a freezing storage tube, and adding 1ml of 1640 complete culture medium;
d. culturing cells, pouring out the culture medium after the cells are full, adding 2ml PBS to wash twice, adding 1ml trypsin to digest in an incubator at 37 ℃ for 10 min;
e. taking out the culture dish, adding 3ml of complete culture medium, mixing, terminating the digestion of pancreatin, and centrifuging at 1500rpm for 5min in a centrifuge;
f. pouring off the supernatant, adding 2ml PBS to wash twice, and centrifuging at 1500rpm for 5 min;
g. cells were counted and adjusted to the same number under the microscope.
(2) Cell infection experiment
a. Dyeing the drug-loaded intima vesicle by using a cell membrane green fluorescent probe Dio, adding 5ul of cell membrane green fluorescent probe dye into 500ul of intima vesicle suspension, incubating in a water bath at 37 ℃ for 30min, and separating the dyed drug-loaded intima vesicle again by adopting an ultracentrifugation method;
b. measuring the protein concentration of the drug-loaded inner membrane vesicle by using the BCA kit and an enzyme labeling instrument to obtain 200ug/ml drug-loaded inner membrane vesicle;
c. and respectively adding the drug-loaded inner membrane vesicles with the three concentrations into three culture dishes which are provided with the same number of cells and are grown with A549 cells after cell counting, observing the killing effect of the drug-loaded inner membrane vesicles of escherichia coli on the A549 non-small cell lung cancer cells at intervals, and counting.
FIG. 4 shows the killing effect of inner membrane vesicles of E.coli endogenously expressing miR-34a on non-small cell lung cancer cells at different time periods. As can be seen from the figure, the survival rate of the non-small cell lung cancer cells is gradually reduced along with the prolonging of the time, and the survival amount of the non-small cell lung cancer cells is less than 10 percent after 24 hours, which proves that the escherichia coli intima vesicle of the endogenous high-expression nucleic acid antitumor drug prepared by the invention has good effect on the clinical treatment of tumors if being prepared into the antitumor drug.
It should be noted that:
in the method of the present invention, other cloning vectors such as pBSMrnaSeph vector, pGEMEX-1, Psp64, etc. may be used as the plasmid vector.
Claims (2)
1. A preparation method of endogenous miR-34a high-expression non-small cell lung cancer resistant Escherichia coli inner membrane vesicles is characterized by comprising the following steps:
firstly, selecting tRNA as a bracket, and inserting a miR-34a precursor Pre-miR-34a into an anticodon of the tRNA to form Pre-miR-34a-tRNA with a stable structure; then inserting the Pre-miR-34a-tRNA into a plasmid vector, and transferring the plasmid vector into escherichia coli;
secondly, culturing the escherichia coli obtained in the first step in a triangular flask containing a liquid LB culture medium, and collecting a bacterial liquid;
thirdly, using lysozyme to remove outer membrane and periplasm components of the escherichia coli in the bacterial liquid, and reacting for 20min in water bath at 37 ℃ to obtain an escherichia coli protoplast; then filtering the protoplast by using a polycarbonate membrane and mounting the polycarbonate membrane on a 47mm filter to obtain a protoplast inner membrane vesicle; the lysozyme is prepared by using 50mM Tris-HCl, 50mM Glucose and 1mM EDTA with pH =8.0 as a buffer solution, and the concentration of the lysozyme is 4 mg/mL; the aperture of the polycarbonate membrane adopted by the filtering protoplast is 12 microns, 6 microns and 1.2 microns in sequence;
fourthly, purifying the protoplasm in vivo membrane vesicles obtained in the third step, and carrying out ultradense gradient centrifugation purification on the obtained protoplasm in vivo membrane vesicles; then carrying out ultracentrifugation again to obtain endogenous Escherichia coli inner membrane vesicles with high miR-34a expression; the conditions of the ultradensity gradient centrifugation and the ultracentrifugation are 100000Xg and 70 min.
2. The application of the endogenous high-expression miR-34a inner membrane vesicle prepared by the preparation method according to claim 1 in preparation of non-small cell lung cancer resistant drugs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910359269.1A CN110037996B (en) | 2019-04-30 | 2019-04-30 | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910359269.1A CN110037996B (en) | 2019-04-30 | 2019-04-30 | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110037996A CN110037996A (en) | 2019-07-23 |
| CN110037996B true CN110037996B (en) | 2022-01-18 |
Family
ID=67280345
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910359269.1A Active CN110037996B (en) | 2019-04-30 | 2019-04-30 | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110037996B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804621A (en) * | 2019-10-31 | 2020-02-18 | 郑州大学 | Preparation method of escherichia coli extracellular vesicle with endogenous high-expression miRNA (micro ribonucleic acid) |
| CN114990038B (en) * | 2022-05-24 | 2023-06-27 | 郑州大学 | Bacterial outer membrane vesicle and application thereof in preparation of preeclampsia treatment drug |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105701364A (en) * | 2016-02-18 | 2016-06-22 | 南昌大学第二附属医院 | Identification method for properties pleural effusion |
| CN107142228A (en) * | 2017-04-18 | 2017-09-08 | 浙江大学 | A kind of preparation of Escherichia coli outer membrane vesicles, medicine-carrying method and its application in antitumor |
| CN108175861A (en) * | 2016-12-08 | 2018-06-19 | 暨南大学 | A kind of delivery system of antitumor small nucleic acids drug and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101842768B1 (en) * | 2016-04-25 | 2018-03-27 | 연세대학교 산학협력단 | Gene delivery carrier using cell-derived nanovesicles and method for producing the same |
-
2019
- 2019-04-30 CN CN201910359269.1A patent/CN110037996B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105701364A (en) * | 2016-02-18 | 2016-06-22 | 南昌大学第二附属医院 | Identification method for properties pleural effusion |
| CN108175861A (en) * | 2016-12-08 | 2018-06-19 | 暨南大学 | A kind of delivery system of antitumor small nucleic acids drug and its application |
| CN107142228A (en) * | 2017-04-18 | 2017-09-08 | 浙江大学 | A kind of preparation of Escherichia coli outer membrane vesicles, medicine-carrying method and its application in antitumor |
Non-Patent Citations (2)
| Title |
|---|
| Bioengineering Novel Chimeric microRNA-34a for Prodrug Cancer Therapy: High-Yield Expression and Purification, and Structural and Functional Characterization;Wei-Peng Wang等;《J Pharmacol Exp Ther》;20150831;第131–141页摘要、导言、材料和方法、讨论 * |
| Separation of Inner and Outer Membrane Vesicles from Escherichia coli in Self-Generating Percoll Gradients;Morein S等;《Analytical Biochemistry》;19940131;第47-51页摘要部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110037996A (en) | 2019-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110037996B (en) | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs | |
| CN109609656B (en) | Goat circular RNA circ _ ZCCHC2 and identification method and application thereof | |
| CN105567641A (en) | Preparation method and application of targeting exosome carrying anti-tumor protein | |
| CN112501112A (en) | Separation and enrichment method for rapidly extracting tissue extracellular vesicles | |
| CN111073856A (en) | Trophoblast, preparation method thereof and application thereof in NK cell amplification | |
| CN106867967A (en) | The LM3 cell lines and its construction method of Midkine stable low-expressions | |
| CN114432452B (en) | Medicine for resisting esophageal squamous cell carcinoma | |
| CN110129318B (en) | Long-chain non-coding RNA PRALR, expression plasmid and application thereof | |
| WO2015016124A1 (en) | Modified β-glucuronidase | |
| CN113846115A (en) | Dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein and preparation method and application thereof | |
| RU2750928C1 (en) | Method for isolating exosomes from conditioned cell culture medium | |
| CN110804621A (en) | Preparation method of escherichia coli extracellular vesicle with endogenous high-expression miRNA (micro ribonucleic acid) | |
| CN1817263A (en) | Souvenir containing DNA and production thereof | |
| CN107142279A (en) | A kind of method of the external efficient infection T cell of AAV6 types adeno-associated virus | |
| CN117025663A (en) | Gene transient expression method and application | |
| CN116731933A (en) | Corynebacterium glutamicum and application thereof in valine production | |
| CN113528519B (en) | Egg duck circular RNA circ _2136 and detection reagent, method and application thereof | |
| CN106811484B (en) | Construction and identification method of bovine PDHB (human immunodeficiency Virus) gene adenovirus interference vector | |
| CN109884304A (en) | A kind of the CHA iodine system and hypersensitive visible detection method of HCV Core Protein | |
| CN115141778A (en) | Method for screening akkermansia muciniphila by using composite regulator specificity | |
| CN115109747A (en) | Experimental method for promoting generation of human umbilical cord mesenchymal stem cell outer vesicles through hypoxia | |
| CN111378621B (en) | B lymphoma cell strain stably transfected by EB virus latent membrane protein 1, construction method and application thereof | |
| CN113186304A (en) | Fluorescence isothermal amplification primer, probe, kit and detection method for orientia tsutsutsugamushi nucleic acid | |
| CN113528531A (en) | Nucleic acid aptamer for detecting human lung cancer cell strain A549 extracellular vesicles and application thereof | |
| CN111436617B (en) | Application of fucose-like glycoprotein based on bovine serum albumin in inhibiting inert agglutinobacterium and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |