CN114990038B

CN114990038B - Bacterial outer membrane vesicle and application thereof in preparation of preeclampsia treatment drug

Info

Publication number: CN114990038B
Application number: CN202210575879.7A
Authority: CN
Inventors: 刘洋; 高兴丽; 李淑丽; 郭永然
Original assignee: Zhengzhou University
Current assignee: Zhengzhou University
Priority date: 2022-05-24
Filing date: 2022-05-24
Publication date: 2023-06-27
Anticipated expiration: 2042-05-24
Also published as: CN114990038A

Abstract

The invention belongs to the technical field of nano-drugs, and particularly relates to a bacterial outer membrane vesicle and application thereof in preparation of a pre-eclampsia treatment drug. The bacterial outer membrane vesicle of the invention has the surface expressed with plCSA-BP target protein, and is obtained by the induction expression and purification of an escherichia coli recombinant expression vector. Experiments prove that the OMVs constructed by adopting the genetic engineering technology have low endotoxin value and high expression quantity, and are safer OMVs vectors. In addition, the bacterial outer membrane vesicle OMVs provided by the invention can realize long-acting protection effect on siRNA drugs in vivo and targeting effect on placenta, can effectively slow down the eclampsia process after drug loading, and have good clinical application prospects in the aspect of preparing anti-eclampsia drugs.

Description

Bacterial outer membrane vesicle and application thereof in preparation of preeclampsia treatment drug

Technical Field

The invention belongs to the technical field of nano-drugs, and particularly relates to a bacterial outer membrane vesicle and application thereof in preparation of a pre-eclampsia treatment drug.

Background

Pregnancy complications affect millions of women each year, some of which have severe morbidity and mortality, such as Preeclampsia (PE), which is a leading cause of maternal and fetal death worldwide. Symptoms of PE generally include hypertension complicated with proteinuria, edema, multiple organ dysfunction, limited intrauterine growth of the fetus, etc., after 20 weeks of pregnancy, and also include hypoxia, oxidative stress, imbalance in angiogenesis, excessive inflammation, endothelial dysfunction, etc. If the pregnant woman is not subjected to intervention treatment in time, the condition of the pregnant woman gradually develops to cause multiple organs to be affected, and serious complications such as eclampsia, renal failure, HELLP syndrome, premature placenta peeling and the like can be possibly caused, so that the maternal and fetal health is extremely seriously threatened.

PE is a disease closely related to abnormal development of placenta, and at present, no drug with both safety and curative effect is used for treating PE. For example, clinically commonly used PE therapeutic drugs include antihypertensive drugs such as labetalol, nifedipine, mannitol, etc. to relieve symptoms of hypertension; in addition, sedative spasmolytics such as diazepam, magnesium sulfate and the like are used for relieving and controlling convulsion symptoms; sodium bicarbonate is also commonly used to correct acidosis after tics or to safeguard the life safety of the mother by terminating pregnancy.

However, the above drugs and treatments mainly prevent and control the disease progression and malignant transformation, and do not radically treat PE. And PE patients may have post-partum complications such as hypertension, cardiomyopathy, long-term kidney disease, etc. even after delivery. The birth of new life is closely related to the future of human beings, so that the research and development of a medicament which can radically and effectively control and treat PE and has little toxic and side effects on puerpera and fetuses has important significance on the healthy development of human beings.

Disclosure of Invention

Based on the above problems, it is an object of the present invention to provide a bacterial outer membrane vesicle capable of effectively loading siRNA drug, actively placenta-targeted delivery of siRNA drug, effectively treating Preeclampsia (PE) while reducing side effects to a greater extent.

The invention also aims to provide an application of the bacterial outer membrane vesicle in preparing a pre-eclampsia treatment drug.

In order to achieve the above purpose, the bacterial outer membrane vesicle of the present invention is achieved by adopting the following technical scheme:

the bacterial outer membrane vesicle is obtained by inducing expression and purification of an escherichia coli recombinant expression vector, and the surface of the bacterial outer membrane vesicle is expressed with plCSA-BP target protein; the escherichia coli recombinant expression vector contains a nucleotide sequence shown as SEQ ID NO.1, and when the expression vector is constructed, the encoding genes of InaXN ice nucleoprotein, sfGFP green fluorescent protein and plCSA-BP target protein are constructed into recombinant plasmids, and then the recombinant plasmids are transferred into attenuated escherichia coli to obtain the escherichia coli recombinant expression vector.

The existing research shows that the growth retardation and DNA damage 45alpha gene (Growth arrest and DNA damage-indable 45alpha, gadd45 alpha) with high expression in PE patients are involved in the regulation of various PE key factors at the same time, so that whether the invention can realize the combined action of various factors to treat PE by targeted regulation of the expression of Gadd45 alpha is considered.

siRNA is a high-efficiency therapeutic drug capable of targeting nucleic acid, but has the defects of extremely easy degradation, difficult transmembrane and the like, and greatly limits the clinical application of the siRNA. Advances in genetic engineering technology have made it possible to achieve active placenta-targeted delivery of siRNA drugs using engineered bacterial Outer Membrane Vesicles (OMVs).

Based on the above conception, the invention originally designs and constructs an attenuated engineering bacteria outer membrane vesicle with active placenta targeting for delivering siRNA medicine aiming at Gadd45 alpha to treat PE, so as to realize effective treatment of PE and simultaneously reduce side effects on lying-in women and fetuses to a greater extent.

The bacterial outer membrane vesicle provided by the invention has the surface expressed with plCSA-BP protein. Experiments prove that the OMVs constructed by adopting the genetic engineering technology have low endotoxin value and high expression quantity, and are safer OMVs vectors. In addition, the bacterial outer membrane vesicle OMVs provided by the invention can realize long-acting protection effect on siRNA drugs in vivo and targeting effect on placenta, can effectively slow down the eclampsia process after drug loading, and have good clinical application prospects in the aspect of preparing anti-eclampsia drugs.

In the escherichia coli recombinant expression vector related to the preparation of the bacterial outer membrane vesicle, inaXN ice nucleoprotein is ice nucleoprotein N-terminal domain protein, sfGFP is super-folded green fluorescent protein (super fold Green fluorescent protein), and plCSA-BP is placenta chondroitin sulfate A binding peptide. According to the invention, early researches prove that the sfGFP green fluorescent protein and the pICS-BP target protein can be effectively fused and expressed on a cell membrane by adopting InaxN ice nucleoprotein as a rivet protein.

The recombinant expression vector of the escherichia coli contains a nucleotide sequence shown as SEQ ID NO.1, the full length of an open reading frame sequence is 1326BP, and InaXN ice nucleoprotein, sfGFP green fluorescent protein and pICS-BP target protein are sequentially encoded. Wherein, the 1-528 BP locus is InaXN ice nucleoprotein encoding gene (528 BP), the 529-1242BP locus is sfGFP green fluorescent protein encoding gene (714 BP), and the 1243-1326 BP locus is pICS-BP target protein encoding gene (84 BP).

In order to stably express the target protein plCSA-BP on the surfaces of escherichia coli and OMVs and effectively improve the expression quantity of the OMVs, the invention fuses and expresses the plCSA-BP and InaxN ice nucleoprotein and connects sfGFP as an indicator protein, so that the expression quantity of the OMVs is improved, and the expression of the OMVs has the characteristics that green fluorescence can be tracked under a microscope, and the expression of the OMVs is superior to that of liposomes, and meanwhile, the expression of the OMVs has better stability, biocompatibility, safety and placenta targeting, and is a carrier capable of effectively protecting siRNA.

Preferably, the particle size of the bacterial outer membrane vesicles according to the invention is 20-80 nm.

Based on the primary consideration of safety, the attenuated escherichia coli adopted by the invention is the escherichia coli from which the msbB gene is knocked out in advance. In specific operation, the CRISPR method can be adopted to knock out the msbB gene of the escherichia coli. The early-stage experiment proves that the toxicity of the expression product can be effectively reduced by the pre-knockout of the msbB gene, and the improvement of the safety of the product is facilitated.

The expression of the product is influenced by the culture temperature, the culture time and the inducer. After screening an inducer, temperature and time, the invention preferably selects that when the escherichia coli recombinant expression vector induces and expresses bacterial outer membrane vesicles, the conditions of induced expression are as follows: LB liquid medium containing 0.1-1 mM isopropyl beta-D-1-thiopyran galactoside, which is induced for 4-14 h at 20-30 ℃. Further preferably, when the escherichia coli recombinant expression vector is used for inducing and expressing outer membrane vesicles of bacteria, the conditions for inducing and expressing are as follows: LB liquid medium containing 1mM isopropyl beta-D-1-thiogalactopyranoside is induced at 30℃for 14h.

In order to improve the separation and recovery effects of OMVs, preferably, the escherichia coli expression vector is used for extracting and purifying the expressed bacterial outer membrane vesicles by adopting an ultrafiltration concentration method after inducing the expressed bacterial outer membrane vesicles.

The technical scheme of the application of the bacterial outer membrane vesicle in preparing the preeclampsia treatment medicine is as follows:

the application of the bacterial outer membrane vesicle in preparing the preeclampsia therapeutic drug specifically takes the bacterial outer membrane vesicle as a carrier to load siRNA drug to form drug-loaded nano particles so as to prepare the preeclampsia therapeutic drug.

The invention proves that the bacterial outer membrane vesicle OMVs provided by the invention can realize the long-acting protection effect on siRNA drugs in vivo and the targeting effect on placenta through a model experiment of preeclampsia of mice. The pharmacodynamics experiment result of pregnant mice shows that compared with nitroso L-arginine methyl ester (L-NAME) group, the bacterial outer membrane vesicle medicine carrying group OMVs provided by the invention ^siRNA Remarkably improves 24h urine protein, oxidation stress level, inflammatory factor and vascular endothelial function of pregnant mice, and improves the expression of hypertension related factorsThe growth and development of pregnant mice, fetal mice and placenta are ended, the degree of damage to liver and kidney functions of eclampsia mice is reduced, the eclampsia process is effectively slowed down, and the preparation method has good clinical application prospect in the aspect of preparing anti-eclampsia medicines.

In order to payload siRNA drug into bacterial outer membrane vesicles, it is preferred that the siRNA drug is loaded into bacterial outer membrane vesicles using electroporation techniques to form drug-loaded nanoparticles for use in the preparation of therapeutic agents for preeclampsia.

In order to increase the siRNA loading effect and to increase the subsequent pharmaceutical effect, preferably, the electroporation technique is operated under the following conditions: the mass ratio of the bacterial outer membrane vesicle to the siRNA is (1-3), the mass ratio is (1-3), and the electroporation voltage is 100-900V. More preferably, the bacterial outer membrane vesicle to siRNA mass ratio is 1:1 and the electroporation is applied at a voltage of 700V.

Drawings

FIG. 1 shows Western blot analysis of E.coli sfGFP in the expression vector according to example 1 of the present invention;

FIG. 2 shows the results of recombinant protein detection of OMVs obtained in example 1 and the control group of the present invention;

FIG. 3 shows wtOMV, mOMV and Affi in the present invention _plCSA-BP OMV hydrated particle size and potential profile;

FIG. 4 is a transmission electron microscope image of recombinant E.coli in example 1 of the present invention;

FIG. 5 is a transmission electron microscope image (scale: 200 nm) of OMVs before and after purification in the present invention;

FIG. 6 shows wtOMV, mOMV and Affi in the present invention _plCSA-BP A transmission electron microscope image of the OMV;

FIG. 7 is a transmission electron microscope image of OMVs before and after placement in the present invention: (a) as-manufactured OMVs; (B) after one month of storage in PBS;

FIG. 8 is a graph showing the yields of OMVs from different experimental groups in accordance with the present invention;

FIG. 9 shows the results of recombinant protein detection of OMVs under different induction conditions according to the invention;

FIG. 10 shows endotoxin results for groups of OMVs before and after cleavage in accordance with the present invention;

FIG. 11 shows the in vivo distribution of different formulations in pregnant mice in the experimental group of the present invention;

FIG. 12 shows changes in plasma sFlt-1 levels in day 18 gestation mice in the experimental group of the present invention;

fig. 13 shows the weight change of mice during gestation in the experimental group of the present invention: (a) PE mice change in body weight during gestation; (B) comparison of body weight of groups of eclamptic mice on day 18 of gestation;

fig. 14 is a view of the appearance of the experimental group of the present invention: (A) a fetal mouse appearance pattern; (B) a placenta appearance map; (a) Control; (b) L-NAME; (c) siRNA; (d) mOMV (mOMV) ^siRNA ；(e)Affi _plCSA-BP OMV ^siRNA ；

FIG. 15 shows the effect of different agents in the experimental group of the present invention on mRNA expression of related genes in placenta;

FIG. 16 shows plasma 8-epi-PGF2α and MDA levels in the experimental group of the present invention: (a) 8-epi-pgf2α; (B) MDA;

FIG. 17 shows plasma inflammatory factor levels in the experimental group of the present invention: (a) TNF- α; (B) MCP-1; (C) IL-17A; (D) IFN-gamma.

Detailed Description

The invention will be described in further detail with reference to the accompanying drawings and examples. The E.coli used in the following examples was E.coli BL21 (DE 3) supplied by Hangzhou Fenghai Biotechnology Co., ltd., LB liquid medium was purchased from Beijing Soy Bao technology Co., ltd; BCA protein quantification kit was purchased from Shanghai elegance biosciences, inc; N-nitro-L-arginine methyl ester hydrochloride was purchased from Sigma-Aldrich trade Co. Other apparatus and reagents not specifically described are commercially available.

Example 1

The bacterial outer membrane vesicle of the embodiment has the surface expressed with pCSA-BP target protein, and is obtained by the induction expression and purification of an escherichia coli recombinant expression vector; the escherichia coli recombinant expression vector contains a nucleotide sequence shown as SEQ ID NO.1, and when the expression vector is constructed, the encoding genes of InaXN ice nucleoprotein, sfGFP green fluorescent protein and plCSA-BP target protein are constructed into recombinant plasmids, and then the recombinant plasmids are transferred into attenuated escherichia coli to obtain the escherichia coli recombinant expression vector. The attenuated E.coli is E.coli BL21 (DE 3) delta msbB with the msbB gene knocked out in advance.

The preparation process comprises the following steps:

1. preparation of E.coli recombinant expression vector

1) Amplification of sfGFP Gene: using the plasmid of sfGFP green fluorescent protein as a template, the following procedure was followed using sfGFP-EcoRI-F/sfGFP-sacI-R primers: 2X Superpfu PCR mix 25. Mu.L; primer P1 (10. Mu.M) 2. Mu.L; primer P2 (10. Mu.M) 2. Mu.L; 2. Mu.L of sfGFP plasmid; ddH2O 19. Mu.L; total 50. Mu.L. Amplification conditions: pre-denaturation at 94℃for 5min; (94 ℃ C. 30s, 55 ℃ C. 30s, 68 ℃ C. 20 s) 30 cycles; then maintained at 10 ℃. Wherein, the primer sequence of sfGFP-EcoRI-F/sfGFP-sacI-R is as follows:

sfGFP-EcoRI-F：GGAATTCATGAGCAAAGGAGAAGAACTTTT；

sfGFP-sacI-R：CGAGCTCTTTGTAGAGCTCATCCATGCCAT。

2) Fusion of polypeptide fragments: the reaction system is as follows: 10 Xannealing buffer 1. Mu.L; tai-F1 (50. Mu.M) 4.5. Mu.L; tai-R1 (50. Mu.M) 4.5. Mu.L; total 10. Mu.L. Wherein, the sequences of the tai-F1 and the tai-R1 are as follows:

tai-F1：attaattttgatacaaaagagaaatttctagcaggatgcttaattgtttct；

tai-R1：agaaacaattaagcatcctgctagaaatttctcttttgtatcaaaattaat。

the reaction system is reacted for 5min at 95 ℃, naturally cooled and used as a PCR template, and the primers tai-F2sacI and tai-R2hindIII are adopted for reaction. The reaction system is as follows: 2X Superpfu PCR mix 25. Mu.L; tai-F2sacI (10. Mu.M) 2. Mu.L; tai-R2hindIII (10. Mu.M) 2. Mu.L; 2. Mu.L of sfGFP plasmid; ddH2O 19. Mu.L; total 50. Mu.L. The reaction conditions are as follows: pre-denaturation at 94℃for 5min; (94 ℃ C. 30s, 55 ℃ C. 30s, 68 ℃ C. 10 s) 30 cycles; then maintained at 10 ℃. The primer sequences were as follows:

tai-F2sacI：CGAGCTCtacaaagaagatgtaaaggatattaattttgatacaaaagag；

tai-R2hindIII：CCCAAGCTTttaattttttccttcatgaaaagaaacaattaagcatcctgct。

3) sfGFP fused to polypeptide fragment: the amplified sfGFP and polypeptide fragment are connected after being cut by sacI single enzyme and used as PCR template, and are amplified by sfGFP-EcoRI-F/tai-R2hindIII, the amplification system is: 2X Superpfu PCR mix 25. Mu.L; sfgfp-EcoRI-F (10. Mu.M) 2. Mu.L; tai-R2hindIII (10. Mu.M) 2. Mu.L; 2. Mu.L of Sfgfp-peptide ligation product; ddH2O 19. Mu.L; total 50. Mu.L. The amplification conditions were: pre-denatured at 94℃for 5min, (94℃for 30s, 55℃for 30s, 68℃for 30 s) 30 cycles, then maintained at 10 ℃.

4) And (3) enzyme cutting: recovering the amplified product fused in the step 3) through a PCR product purification kit, and performing enzyme digestion according to the following conditions:

10X fast digest buffer. Mu.L; fast digest EcoRI 1 μL; fast digest hindIII 1 μL; sfgfp-pICSA-BPS 43. Mu.L; total 50. Mu.L. And (3) enzyme cutting at 37 ℃ for 3 hours, and purifying the PCR product to obtain a carrier enzyme cutting recovery product.

10X fast digest buffer. Mu.L; fast digest EcoRI 1 μL; fast digest hindIII 1 μL; pET30b-inaXN 20. Mu.L; ddH2O 23. Mu.L; total 50. Mu.L. And (3) performing enzyme digestion for 1h at 37 ℃, and purifying the PCR product to obtain a PCR enzyme digestion product.

5) Ligation transformation: 10×T DNA ligase buffer 1.mu.L; 2 mu L of carrier enzyme digestion recovery product; 6 mu L of PCR enzyme cutting product; t4 DNA library 1. Mu.L; total 10. Mu.L. Transformed Ecoli DH5alphA competent cells were plated on Kan-resistant (50. Mu.g/mL) plates overnight at 16℃and cultured at 37℃to perform PCR identification of the colonies grown.

6) Colony PCR identification: the primers used for the identification are: t7: taatagacgctactacttaggg; t7 ter: TGCTAGTTATTGCTCAGCGG.

Amplification system: the monoclonal product is picked up and evenly mixed with 10 mu L of sterile water, 0.5 mu L is taken as a template for amplification according to the following system: 2 XTaq PCR mix 10. Mu.L; t7 (10. Mu.M) 0.5. Mu.L; t7 ter (10. Mu.M) 0.5. Mu.L; 0.5 mu L of bacterial liquid; ddH2O 8.5. Mu.L; total 20. Mu.L; the amplification conditions were: pre-denaturation at 94℃for 5min; (94℃for 30s, 55℃for 30s, 72℃for 30 s) for 32 cycles, then maintained at 10 ℃. And after amplification, positive clones are selected and inoculated into LB liquid culture medium to culture and extract plasmids for sequencing.

7) Transformation of E.coli: the InaXn-sfGFP-pCSA-BP recombinant plasmid with correct sequence (the sequence is shown as SEQ ID NO. 1) is transformed into the prepared attenuated escherichia coli BL21 (DE 3) delta msbb competent cells to obtain recombinant escherichia coli BL21 (DE 3).

2. Cultivation of recombinant E.coli BL21 (DE 3)

Melting the recombinant escherichia coli BL21 (DE 3) strain obtained in the embodiment 1 at 37 ℃, diluting 10 times by PBS, inoculating the strain into a flat plate by a flat plate streaking method, culturing for 20-22 hours at 37 ℃, inoculating single bacterial colonies into 11mL of LB liquid medium, culturing for 20-22 hours at 37 ℃ and 150r/min to obtain seed liquid, performing expansion culture on the seed liquid according to the same condition proportion that each 1mL of seed liquid is inoculated into 100mL of blank LB liquid medium, using the blank medium as a control, measuring the OD600 value of the bacterial culture liquid by using an enzyme-linked immunosorbent assay until the OD600 value is 1, and extracting the bacterial outer membrane vesicles. In addition, when the recombinant E.coli OD600 was 0.5 to 0.8, protein expression was induced by the addition of 1M (0.2383 g/mL) isopropyl β -D-1-thiogalactopyranoside (IPTG; diluted 1:1000 in bacterial culture). Cultures were incubated at 30℃for 14h and after OD600 was measured bacterial outer membrane vesicles were extracted.

3. Preparation and purification of OMVs

Using ultrafiltration concentration, 1L of the bacterial fluid was centrifuged at 5000g for 30min at 4℃to remove bacterial cells. The resulting supernatant was filtered through a 0.45 μm cellulose acetate filter and concentrated to 1/5 volume using a 100K ultrafiltration membrane (Millipore) and centrifuged at 4000g at 4 ℃. Centrifuging at 4deg.C for 10min at 5000g to remove impurities during concentration, and filtering with 0.22 μm microporous membrane. Then ultracentrifugation at 150000g for 3h at 4deg.C, discarding the supernatant, and resuspension the pellet with appropriate amount of PBS buffer; the supernatant was discarded after ultracentrifugation at 150000g for 3h at 4 ℃. The pellet was then resuspended in 50mL, 100K ultrafiltration centrifuge tube with PBS to 1/5 of the original volume, and the ultrafiltration tube was again concentrated to 1/5 of the original volume with PBS and this step was repeated 10 times. Centrifugation was performed at 5000g for 10min at 4℃to remove impurities during concentration, and filtration was performed with a 0.22 μm microporous filter membrane. Then ultracentrifugation at 4℃for 3h at 150000g, discarding the supernatant, finally resuspending the pellet in 200. Mu.LPBS, filtering again with 0.22 μm cellulose acetate filter, sub-packaging 50. Mu.L of each tube for 4 tubes and storing at-20 ℃. Plates were streaked overnight to confirm sterility.

Example 2

The bacterial outer membrane vesicles purified in example 1 of the invention are used as carriers to prepare siRNA-loaded nanoparticles for preparing drugs for treating eclampsia. Specifically, the extracted and purified OMVs are mixed with the siRNA drugs for electroporation, and when voltage is applied, holes are formed in phospholipid bilayer of the OMVs to enable the siRNA drugs to enter the OMVs. During electroporation, the operating conditions of the electroporation technique may be: the mass ratio of the bacterial outer membrane vesicle to the siRNA is (1-3), the mass ratio is (1-3), and the electroporation voltage is 100-900V. The electroporation conditions used in this example were specifically: the mass ratio of the bacterial outer membrane vesicle to the siRNA is 1:1, and the electroporation is applied with a voltage of 700V.

Experimental example

Experimental example 1 Western blot analysis to detect expression of recombinant proteins

To confirm the presence or absence of a specific antigen on the recombinant strain, the wild-type E.coli strain (wtE.coli), the attenuated E.coli strain (mE.coli), the recombinant E.coli strain (Affi) according to example 1 of the present invention _plCSA- _BP E.coli) performing western blot analysis (Westerrn blotting), and detecting the expression of fusion proteins (about 55 KDa) including InaXN ice nucleoprotein (about 25 KDa), sfGFP fluorescent protein (26.2 KDa), plCSA-BP peptide (3.4 KDa) with the tag protein sfGFP fluorescent protein as a target. The specific operation comprises the following steps: (1) extraction of E.coli cell culture proteins; (2) BCA protein quantification; (3) polyacrylamide gel electrophoresis; (4) transferring membrane, sealing and incubating antibody; (5) The target protein bands were scanned using a chemiluminescent gel imager. The results are shown in FIG. 1.

As can be seen from FIG. 1, the DNA sequences were obtained in wild type E.coli (wtE.coli), attenuated E.coli (mE.coli) and recombinant E.coli (Affi _plCSA-BP Westerrn blotting detection of the outer membrane proteins extracted from E.coli) with sfGFP protein as indicator protein, 55kDa being the site of theoretical expression of the fusion protein, where neither wtE.coli nor mE.coli has a Western blot at 55kDa, while Affi _plCSA-BP The coloi has a distinct footprint here. The above results indicate that the outer membrane proteins of wild E.coli and attenuated E.coli do not contain recombinant proteins, whereas the outer membrane of the recombinant E.coli of the invention successfully expresses fusion proteins.

Further, to confirm furtherAffi _plCSA-BP Whether OMVs expressed recombinant proteins and whether the proteins were localized on the outer membrane, the extraction of purified wtOMVs (wild-type), mOMVs (attenuated) and Affi from the expression of example 1 of the invention was continued by Westerrn blotting experiments _plCSA-BP OMV and PK or EDTA treated Affi _plCSA-BP OMVs are tested. Wherein PK can only degrade proteins exposed outside OMVs, while EDTA can disrupt membrane structure, exposing intramembrane proteins. The results are shown in FIG. 2, where wtOMV, mOMV and Affi are the first _plCSA-BP Of OMVs, only Affi _plCSA-BP OMVs were western blotted at 55kDa, indicating Affi _plCSA-BP OMVs successfully expressed the protein of interest. In addition, PK-treated Affi alone _plCSA-BP Western blot of OMVs disappeared at 55kDa, indicating that at Affi _plCSA-BP The recombinant protein exposed outside of OMV is degraded, and the recombinant protein expressed in the membrane is not detected by Westerrn blotting technology; EDTA treatment of Affi alone _plCSA-BP OMVs have little effect on the fusion protein, i.e., the target protein expression is unchanged before and after cleavage, and most of the protein is exposed on the surface of the membrane; while PK treatment followed by EDTA cleavage of Affi _plCSA-BP OMVs have no western blot at 55kDa, again confirming that the recombinant protein is barely expressed in the membrane. The above results demonstrate that the protein of interest is successfully presented on the surface of OMVs and is hardly expressed in the membrane, guided by the InaXN ice nucleoprotein guide sequence.

Experimental example 2 morphology and size of OMVs

The morphology and the size of the OMVs expressed in example 2 were analyzed in this experimental example, and the specific procedure is briefly described as follows: experiments used a laser particle sizer to determine the particle size and potential of OMVs. Taking a proper amount of Affi _plCSA-BP OMV, diluted to 1mL with PBS, mixed well and measured using a malvern laser particle sizer. Affi was prepared by Tccnai transmission electron microscopy before and after purification and after one month at room temperature _plCSA-BP OMVs and the morphology of recombinant E.coli. Selecting a copper mesh with 200 meshes, sucking 10 mu L of nano particle dilution liquid drops on the front surface of the copper mesh, standing for 1-3 min, sucking redundant liquid from the edge of the liquid drops, slightly airing, taking 2% phosphotungstic acid staining liquid, and dripping a small drop of the phosphotungstic acid staining liquid on waxAnd (3) placing the copper mesh adsorbed with the sample on the surface of the dye liquor on a disc, dyeing for 3-5 min, airing under an incandescent lamp, and taking a picture. The results are shown below:

extracting and purifying wtOMV, mOMV and Affi by laser particle size analyzer _plCSA-BP OMV was used to measure the particle size and potential of hydration. As shown in FIG. 3, the hydrated particle size of wtOMV was 51.49.+ -. 1.31nm, the potential was-16.3.+ -. 1.9mV, and the PDI was 0.31.+ -. 0.04; the hydration particle size of mOMV is 51.33+ -1.64 nm, the potential is-16.6+ -1.3 mV, and PDI is 0.33+ -0.05; affi _plCSA-BP The hydrated particle size of OMV was 51.34 + -1.44 nm, the potential was-16.9+ -0.7 mV, and the PDI was 0.31+ -0.03. No significant difference was observed in the hydrated particle size and potential of the three groups of carriers.

Recombinant E.coli, OMVs before and after purification, wtOMV, mOMV and Affi using transmission electron microscopy _plCSA-BP OMV and Affi after one month of storage at room temperature _plCSA-BP The morphology features of OMVs were characterized, and the morphology, purification effect and morphology of three groups of OMVs of recombinant E.coli were evaluated, and the results are shown in FIGS. 4 to 7.

As shown in FIG. 4, the recombinant E.coli is a species with rounded ends, and has a length of about 1-3 μm, and the individual cells may be in the form of myopia spheres or filaments depending on the growth conditions, and no significant difference from the common E.coli is observed.

As a result of observation of OMVs before and after purification under a transmission electron microscope, as shown in FIG. 5, it was found that a large amount of flagella originally present had almost disappeared after purification. Comparing wtOMV, mOMV and Affi _plCSA-BP The transmission electron microscopy of OMVs (fig. 6) showed no significant difference in morphology size for the three groups of OMVs. The particle size of OMVs is mostly distributed at 20-60 nm, and is smaller than the hydration particle size of about 50nm measured by a laser particle sizer, and the particle size of each large OMVs can reach about 80nm. OMVs are in a spherical vesicle structure, exhibit a phospholipid bilayer structure of cell membranes, and individual OMVs are in a erythrocyte-like flat vesicle structure.

In contrast to a transmission electron micrograph of PBS at room temperature for one month before and after placement, affi was not found _plCSA-BP Morphological size of OMVsWith a clear change, only slight aggregation (see FIG. 7), illustrating the Affi obtained in the present invention _plCSA-BP OMVs have good stability in PBS and can be placed in PBS at room temperature for at least one month.

Experimental example 3 determination of yield of OMVs

The yield of OMVs is a key indicator for measuring the bacterial encapsulation rate. The yield of OMVs from different experimental groups was determined in this experimental example, and the specific procedure is as follows:

reagent A and reagent B were mixed according to the BCA kit instructions at a volume ratio of 50:1 to prepare a BCA working solution. Standard proteins (2 mg/mL) were diluted to varying concentration ratios (n=3) with dd H2O in 96-well plates, 200 μLBCA working solution was added to each well, and incubated with gentle shaking at 37℃for 30min in a microplate thermostated shaker. After cooling to room temperature, absorbance was measured at a wavelength of 562nm using a multifunctional microplate reader. And drawing a standard curve according to the set standard protein concentration, and calculating the concentration of the protein sample to be detected. The extracted and purified wtOMV, mOMV and Affi obtained in example 2 were measured separately _plCSA-BP After the protein content of OMV, the number of harvested bacteria was calculated as OD600 (the number of bacteria corresponding to od600=1 was 5.6x10 ¹⁰ cfu/mL). Finally in a protein yield ratio of every 10 ¹⁰ The total protein amount (μg) obtained for each bacterium was calculated as the yields of the three OMVs, respectively. The results are shown in FIG. 8.

As can be seen from FIG. 8, wtOMV, mOMV and Affi _plCSA-BP The yield ratio of OMVs was 14.32.+ -. 1.24. Mu.g/10, respectively ¹⁰ Bacteria 15.19+ -1.97 μg/10 ¹⁰ Bacteria, 19.98+ -2.18 μg/10 ¹⁰ Bacteria. Wherein there was no significant difference in the yields of wtOMV and mOMV (p>0.05)；Affi _plCSA-BP The yield of OMVs was significantly higher than the yields of wtomvs and momvs (<0.01 The invention can obviously improve the yield of OWVs through protein fusion expression.

Experimental example 4 optimization of expression conditions of recombinant proteins on OMVs Membrane

The experimental example is based on the earlier stage exploratory experiment, and the preferred expression conditions are selected as follows: LB liquid medium containing 0.1-1 mM isopropyl beta-D-1-thiopyran galactoside, which is induced for 4-14 h at 20-30 ℃. To further determine the optimal conditions, the present invention further investigated the effect of two temperatures, two time periods and two inducer concentrations on the expression level. Experimental conditions and results as shown in fig. 9,

group

1 and 2, and

group

4 and 5 were compared, and it was found that protein bands induced at 30 ℃ induced more recombinant protein expression than 20 ℃ no matter induced for 4h or 14h (< p < 0.05); comparing

groups

2 and 3, and

groups

5 and 6, and finding that the induced protein expression amount is greater than that induced for 4h (p < 0.0001) under the conditions of induction for 14h at 20 ℃ or 30 ℃; in addition,

groups

1 and 4,

groups

2 and 5, and

groups

3 and 6 were compared, and found that 1mM isopropyl β -D-1-thiogalactopyranoside (IPTG) induced protein bands were all more pronounced than 0.1mM IPTG induced protein bands (p < 0.01). In summary, the optimal condition for induction of the target protein in this experiment was to add IPTG at a final concentration of 1mM and induce at 30℃for 14h.

Experimental example 5 Limulus reagent method for detecting endotoxin content of OMVs

By preparing endotoxin standard substances with a series of concentration gradients, using a limulus kit, carrying out linear regression by taking endotoxin concentration as an abscissa and taking absorbance at 545nm as an ordinate, the standard curve equation is y=1.2917 x+0.0161, R ² =0.998. Correlation coefficient R of standard curve ² Is 0.998>0.980。Affi _plCSA-BP OMVs and mOMVs are vesicles secreted by E.coli with endotoxin knocked out, so Affi _plCSA-BP The OMVs endotoxin detection concentration was consistent with that of the mOMVs. wtOMVs, mOMVs and Affi _plCSA-BP The endotoxin results before and after cleavage of the OMVs three groups of vectors are shown in FIG. 10, which shows that there is no significant difference between the endotoxin before and after cleavage (p>0.05 A) is provided; and the endotoxin values of wtOMVs before and after the cracking are obviously larger than those of mOMVs and Affi _plCSA-BP Endotoxin values (×p) of OMVs<0.0001). The result shows that compared with common escherichia coli, the escherichia coli with the endotoxin gene knocked out has obviously reduced secreted OMVs endotoxin values, reduces toxicity caused by in-vivo and in-vitro administration of bacterial endotoxin, and is a safer OMVs carrier.

Experimental example 6Affi _plCSA-BP Drug carrying performance of OMV vectorStudy of

The GADD 45. Alpha. SiRNA sequence used in this experiment was 5'-AACGTCGACCCCGATAACGTG-3', which was synthesized by Shanghai Ji Ma pharmaceutical technologies Co. Loading siRNA drug into Affi obtained in example 1 by electroporation _plCSA-BP In OMV carrier, confocal microscope, polyacrylamide gel electrophoresis and Westerrn blotting experiment all prove Affi after drug loading _plCSA-BP OMV ^siRNA The on-membrane targeting protein plCSA-BP is still normally expressed after electroporation. At the same time TEM image shows Affi under electroporation conditions of the present experiment _plCSA-BP OMV ^siRNA The particle size is increased and is mainly concentrated at about 90nm without breakage. Affi _plCSA-BP OMV ^siRNA The hydrated particle diameter of (2) is 90.00+ -2.04 nm, the potential is-20.0+ -0.2 mM, and the PDI is 0.344+ -0.013. Affi _plCSA-BP OMV ^siRNA The drug loading rate which can be realized under the optimal condition (the mass ratio of the voltage 700V, OMV to the siRNA is 1:1) reaches 20.17+/-1.56 percent. In vitro release studies showed Affi _plCSA-BP OMV ^siRNA The siRNA has good drug release characteristics in normal physiological environment and acid environment, and can protect the siRNA drug from being metabolically eliminated before reaching target cells. Furthermore, the agarose gel electrophoresis result showed Affi _plCSA-BP OMV ^siRNA The stability in RNase A is good, the preparation is a carrier capable of effectively protecting siRNA, and the stability of the siRNA drug in blood circulation is greatly improved.

Experimental example 7 Affi after drug delivery _plCSA-BP OMV ^siRNA In vivo evaluation experiment of nanoparticles

The experimental example is directed to Affi _plCSA-BP OMV ^siRNA Targeting, efficacy and biosafety in vivo were examined. Study of Affi by in vivo imaging _plCSA-BP OMV ^siRNA Verifying its targeting; the Affi was evaluated by taking 24h urine protein amount, the contents of inflammatory factors and oxidation factors in plasma, gadd45a and ACE, AGT1R, eNOS and other vasodilation related genes in placenta tissue as investigation indexes _plCSA-BP OMV ^siRNA Is effective in vivo and has biological safety. The specific experimental materials and methods are as follows: the mice used in this experiment were SPF-grade KM miceMice, purchased from Beijing Bei Fu Biotechnology Inc., weighing 30-40 g, females, 8-10 weeks old. The feeding laboratory is clean-grade, standard process feeding, pad replacement daily, free diet, light/dark period of 12h, temperature of 22-25deg.C, and relative humidity of 60% + -10%.

Animal model construction A preeclampsia model was constructed using the preeclampsia modeling method in the reference, with nitroso-L-arginine methyl ester (L-NAME) injected subcutaneously in the nape of the neck to construct a preeclampsia gestation mouse model. The L-NAME was dissolved in phosphate buffer to prepare 30mg/mL of L-NAME solution for ready use. Pregnant mice were fed ad libitum, were given water, and then subcutaneously injected with L-NAME solution (75 mg/kg/d) at the nape of the neck on day 9 of gestation (GD 9) and were continuously dosed to GD19.

The experimental groupings were as follows: after the KM mice are adaptively fed for one week, the female mice and the male mice are caged at 6 points in the evening according to the ratio of 2:1, the pessary is found to be GD0 in the next morning of 7-8, and then the pregnant mice are fed in single cages. 50 pregnant mice were randomly divided into 5 groups of 10 mice each. The specific grouping is as follows: normal pregnancy group (Control group): tail vein injection of physiological saline every other day until GD19; L-NAME group: GD9 was subcutaneously injected with L-NAME 75mg/kg/d to GD19; free siRNA group: GD9 was subcutaneously injected with L-NAME 75mg/kg/d and tail vein injected with free siRNA every other day on GD10 until GD19; mOMV (mOMV) ^siRNA Group: GD9 was subcutaneously injected with L-NAME 75mg/kg/d and mOMV was intravenously injected every other day at GD10 ^siRNA Up to GD19; affi _plCSA-BP OMV ^siRNA Group: GD9 was subcutaneously injected with L-NAME 75mg/kg/d and Affi was injected every other day at GD10 tail vein _plCSA-BP OMV ^siRNA Up to GD19.

When the in vivo distribution of the preparation is detected by near infrared in vivo fluorescence imaging investigation: in vivo biodistribution studies were performed with IR-783 instead of siRNA. KM pregnant mice were randomly divided into three groups (n=3) of: free IR-783, non-targeting group mOMV ^IR-783 Targeting group Affi _plCSA-BP OMV ^IR-783 . The specific experimental operation is as follows: sterilizing tail with 75% alcohol and exposing blood vessel, fixing tail of mouse, and injecting three preparations into the mouse via tail vein, wherein IR-783 dose is 5.0 mg-kg. The mice are anesthetized by 4% chloral hydrate, then the mice are fixed and placed in an optical living body imager, and an X-ray image and a fluorescence image of the mice are respectively acquired. The fluorescence intensities of IR-783 at various times (1 h, 4h, 8h, 12h, 24h, 48h and 72 h) at heart, liver, spleen, lung, kidney and placenta sites were detected using a living body imaging method, the distribution of the drug-loaded nanoparticles in each tissue was observed, and the targeting of tumor tissue and the concentration of each non-target tissue were evaluated to evaluate side effects. In order to further examine the distribution state of each preparation in the body, selecting mice in the later gestation period, grouping and dosing according to the above, dissecting and taking heart, liver, spleen, lung, kidney, placenta and fetal tissues after cervical vertebra is deswhite and killed when each preparation reaches the maximum distribution in 12 hours, placing the mice on a living body imager for taking X-ray and fluorescent pictures, and analyzing the distribution state of each preparation in viscera.

Plasma Malondialdehyde (MDA) levels were determined using TBA method; inflammatory factor level detection is performed by collecting blood from pregnant mice at day 19 of gestation in heparin-lubricated 1.5mLEP tube by eye drop. Centrifugation was performed at 1000 Xg for 30min, and the supernatant was frozen at-80 ℃. And (3) recovering the kit and the collected plasma sample to room temperature 30min before the experiment, adding a detection antibody, incubating, developing color, and measuring by adopting an enzyme-labeled instrument.

The 24-hour urine protein assay procedure was as follows: BCA assay measures 24 hours urine protein concentration. The mice were placed in metabolism cages at day 18 of gestation, and in order to eliminate the interference of protein-containing diet on the results, the mice were fasted without water withdrawal, 24h urine was collected and the urine volume was recorded, centrifuged at 3000rpm for 20min, and the supernatants were frozen in a-80 ℃ refrigerator. The urine stored in the refrigerator at-80 ℃ is taken out in advance before measurement, diluted by 10 times by ultrapure water and placed on ice for detection.

The qRT-PCR technology detects the mRNA expression and the measurement process is as follows: from the blank control group, the modeling control group, the free siRNA group and the mOMV respectively ^siRNA Group, affi _plCSA-BP OMV ^siRNA Randomly selecting placenta from 5 mice, detecting Gadd45 alpha gene, angiotensin I transferring enzyme (ACE), AGT1R receptor for angiotensin II, and endothelial nitric oxide synthase (eNOS) by qRT-PCRExpression of mRNA in placenta of different preparation groups. The PCR primer sequence was designed and synthesized by Shanghai Biotechnology Co. The genes related to the placenta tissue of the pregnant mice are Gadd45 alpha, ACE and AGT1R, eNOS respectively, the reference primer is GAPDH, and the primer sequences and the product sizes are shown in Table 1. The expression difference of Gadd45 alpha in each group of cells is counted by adopting a relative quantification method, the Ct value of each sample is calculated according to an amplification curve drawn by PCR, and then the formula is used: y=2- ΔΔct, ΔΔct= [ experimental group (Ct purpose-Ct internal reference)]- [ control group (Ct purpose-Ct internal reference)]The relative expression level of mRNA was calculated. The experimental results are shown below:

TABLE 1 Real-time PCR primer sequences and products

The distribution condition of different preparations in each tissue and organ in the body is monitored in real time by a near infrared fluorescence imager of the small animal. Free IR-783, non-targeted mOMV IR-783 and targeted Affi via tail vein _plCSA-BP The distribution of OMV IR-783 over time after injection into mice is shown in FIG. 11. First none of the three formulations reached the fetal site. The fluorescence intensity of free group drug IR-783 is weakest, most of free drug is in liver and lung, almost no accumulation is generated at tumor part, the metabolism speed in vivo is high, the fluorescence intensity begins to decrease after reaching strongest at 8 hours, and only weak fluorescence remains at 24 hours, which indicates that siRNA is basically cleared. The non-targeted group preparation mOMV IR-783 is distributed in a large amount in liver, lung and kidney tissues, is partially accumulated at placenta parts, and has maximum 12h fluorescence intensity, and the 24h fluorescence intensity is still at a medium level, so that the circulating time of the preparation in vivo can be obviously enhanced by loading fluorescent dye on mOMV IR-783. Targeted group formulation Affi _plCSA-BP OMV IR-783 has relatively less accumulation in liver and other tissues, realizes maximum accumulation in placenta part in 12h, has fluorescence intensity obviously higher than that of free medicine and non-targeting group, and realizes good targeting effect. A mice with advanced gestation period is selected and intravenous injection administered for 12 hours, and then is killed by cervical vertebra whitening, and the heart is dissected and taken outThe liver, spleen, lung, kidney and placenta fetal tissue were photographed in a living imager, and the results were consistent with the above results. To sum up, affi _plCSA-BP OMV IR-783 can realize long circulation and accumulation of tumor parts in vivo and has excellent targeting ability.

Kidney damage is often present in pregnancy related complications like eclampsia, where malfunction of the kidneys to accommodate changes in body fluids of pregnancy results in kidney damage. Preeclampsia causes the glomerular filtration barrier to be destroyed to a different extent, the glomerular filtration function to be significantly reduced, and glomerular proteinuria and serum myogenesis to be increased. Proteinuria reflects the effect of preeclampsia on the kidneys, and is often used clinically as one of the indicators for assessing preeclampsia patients' kidney involvement and judging the severity of the condition. The results of the 24h urine protein amount change in the 18 th day of gestation mice are shown in FIG. 12. Wherein, the amount of urine protein of the eclampsia mice is obviously increased in 24h compared with the normal control group in the L-NAME group, and the difference has statistical significance (p)<0.0001 A) is provided; free siRNA group had no significant effect on urine protein amount (p>0.05 A) is provided; while mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA The effect of the group on inhibiting 24h urine protein amount is remarkable (p<0.0001 And mOMV) ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA The group treatment effect was not significantly different (p>0.05). The above results illustrate mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA The groups can effectively improve the kidney function of the eclampsia mice and reduce the urine protein quantity for 24 hours.

The weight change of the mice during gestation is one of important indexes for evaluating the drug effect and the biosafety of the preparation, the weight of the mice during normal gestation can be obviously increased, and the weight increase in the normal range is to meet the metabolic demand of the special physiological phenomenon of gestation. The result is shown in figure 13, and the weight of the pregnant mice in the Control group is obviously larger than that of the L-NAME group at the 18 th day of pregnancy, which shows that L-NAME is continuously given at the 9 th day of pregnancy, so that the weight increase of the pregnant mice is inhibited; the body weight of free siRNA group pregnant mice has no obvious change (P > 0.1) compared with L-NAME group, while mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA Group pregnant mice gain significantly in body weight (P<0.0001 Affi), and Affi _plCSA-BP OMV ^siRNA The maximum weight gain amplitude (P) of the group pregnant mice<0.0001 Affi is described in _plCSA-BP OMV ^siRNA The group can effectively improve the weight inhibition phenomenon of the mice with gestational eclampsia. Meanwhile, the preparation has good biological safety and has no obvious toxic or side effect on organisms.

The appearance of the fetal mice and the placenta is shown in fig. 14, and the fetal mice in the L-NAME group grow in an ischemic and anoxic environment due to placenta lesions, so that the fetal mice grow and develop limited, the placenta is also edematous, the surface of the fetal mice is obviously whitened, and severe placenta vasoconstriction and intrauterine growth restriction (IUGR) are shown. Whereas free siRNA group, mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA Normal development of group fetal mice and placenta was improved, and Affi _plCSA-BP OMV ^siRNA Group vs free siRNA group and mOMV ^siRNA The group showed more remarkable effect. The above results show Affi _plCSA-BP OMV ^siRNA The vector can protect the siRNA drug and target the placenta to exert greater efficacy, and no obvious biosafety problem is found.

The expression of mRNA is shown in FIG. 15: mRNA expression of ACE, AGT1R and Gadd45a in placenta was significantly up-regulated after L-NAME molding in pregnant mice (P<0.001 While the mRNA expression of eNOS was significantly decreased (P)<0.0001 Free siRNA group, mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA The groups each significantly reduced the expression of ACE, AGT1R and Gadd45a mRNA in the placenta, while increasing the expression of eNOS mRNA in the placenta. Wherein Affi is _plCSA-BP OMV ^siRNA The group showed the most pronounced effect, indicating Affi _plCSA-BP OMV ^siRNA Greatly improves the in vivo gene silencing effect of siRNA and can obviously improve the symptom of eclampsia mice.

The etiology of preeclampsia is quite complex, its main etiology including activation and injury of vascular endothelial cells, while oxidative stress, especially lipid peroxidation, is an important factor in the impairment of vascular endothelial function. Malondialdehyde (MDA) and 8-isoprostadine (8-epi-PGF2α) are important in vivoAnd studies have shown that lipid oxidative stress is likely to reflect the severity of preeclampsia. The 8-epi-PGF2α and MDA levels in plasma of each group of pregnant mice are shown in FIG. 16. Wherein the levels of 8-epi-PGF2α and MDA in plasma were both significantly elevated in the L-NAME group compared to the normal control group, the differences were statistically significant (p<0.0001 A) is provided; free siRNA group had no significant effect on oxidative stress level (p>0.05)mOMV ^siRNA Group sum Affi _plCSA- _BP OMV ^siRNA The group can obviously reduce the concentration of 8-epi-PGF2α and MDA in blood, and Affi _plCSA-BP OMV ^siRNA The group showed a more pronounced reduction effect (p<0.01). The above results illustrate mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA The group can effectively reduce the oxidative stress level in the eclampsia mice, improve the preeclampsia symptoms and Affi _plCSA-BP OMV ^siRNA The group showed more excellent effects.

Preeclampsia is an excessive inflammatory response whose occurrence and clinical manifestations are closely related to the changes in the levels of some inflammatory cytokines, and thus the severity of preeclampsia can be reflected by the detection of inflammatory factors in the plasma of pregnant mice of each group. The levels of inflammatory factors TNF- α, MCP-1, IL-17A and IFN- γ in plasma of pregnant mice of each group are shown in FIG. 17. Wherein, compared with the normal control group, the levels of TNF-alpha, MCP-1, IL-17A and IFN-gamma in the blood plasma are all obviously increased; free siRNA group had no significant effect on plasma inflammatory factor concentration (p>0.05)；mOMV ^siRNA Group sum Affi _plCSA-BP OMV ^siRNA The group can obviously reduce the concentration of TNF-alpha, MCP-1 and IL-17A in blood, and Affi _plCSA-BP OMV ^siRNA The group showed a more pronounced reduction effect (p<0.01). The difference in IFN-gamma levels in plasma of each treatment group was not statistically significant (p>0.05). The above results illustrate Affi _plCSA-BP OMV ^siRNA The group was effective in reducing the concentration of inflammatory factors TNF- α, MCP-1 and IL-17A in eclamptic mice.

In summary, it is clear that the bacterial outer membrane vesicles (Affi) expressing the protein plCSA-BP of interest provided by the invention _plCSA- _BP OMV), is a targetNatural biological carrier with directionality and safety. After drug loading (Affi) _plCSA-BP OMV ^siRNA ) Can realize long-acting protection effect on siRNA drugs in vivo and targeting effect on placenta. The pharmacodynamics experiment result of pregnant mice shows that compared with the L-NAME group, affi _plCSA-BP OMV ^siRNA The group obviously improves the 24h urine protein, the oxidative stress level, the inflammatory factors, the vascular endothelial functions and the expression of the hypertension related factors of pregnant mice, improves the growth and development ending of the pregnant mice, the fetal mice and the placenta, reduces the degree of liver and kidney function damage of the eclampsia mice and effectively slows down the progress of eclampsia. In addition, affi during treatment _plCSA-BP OMV ^siRNA Group mice weight, liver, kidney placenta H&E staining results and liver and kidney biochemical index detection show that Affi _plCSA-BP OMV ^siRNA Has no obvious toxic and side effects on mice, can not pass through placenta barrier to reach fetus, and has good biological safety. The experimental results show that the bacterial outer membrane vesicle has good clinical application prospect in preparing a pharmaceutical preparation for treating eclampsia.

Sequence listing

<110> university of Zhengzhou

<120> a bacterial outer membrane vesicle and its use in preparation of a medicament for treating preeclampsia

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1326

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

aatcgcgaaa aagtcttggc attacgcact tgcacgaaca acatgtccga tcattgcggg 60

ctgatctggc cactgtccgg catcgtcgaa tgtcggcatt ggcaacccag catcaaacag 120

gaaaacggct tgaccggctt gttgtgggga cagggcacca atgcgcatct gaacatgcat 180

gccgacgcgc attgggtcgt ctgcatggtg gacaccgccg acatcatctg gctgggcgaa 240

gagggaatga tcaagttccc cagggcggag gtggtctacg ccggcaaccg tgcaggcgcg 300

atgagctgca tcgccgccgg catcgagcaa cattcgccac ccaagcccga gccgcctgca 360

gacagtgtga ttgctgcgga gttcactccc aaggcggcgc atgcgcaatt cacggcgccc 420

atcgttgaaa gcggtgcgca ttccaccgcg ccactgccat cgccgcctaa tggcatcggc 480

ccacaagccg cgcagccgtc aaatgcgatc ctgcgtaccc gcgaaatcat gagcaaagga 540

gaagaacttt tcactggagt tgtcccaatt cttgttgaat tagatggtga tgttaatggg 600

cacaaatttt ctgtccgtgg agagggtgaa ggtgatgcta caaacggaaa actcaccctt 660

aaatttattt gcactactgg aaaactacct gttccgtggc caacacttgt cactactctg 720

acctatggtg ttcaatgctt ttcccgttat ccggatcaca tgaaacggca tgactttttc 780

aagagtgcca tgcccgaagg ttatgtacag gaacgcacta tatctttcaa agatgacggg 840

acctacaaga cgcgtgctga agtcaagttt gaaggtgata cccttgttaa tcgtatcgag 900

ttaaagggta ttgattttaa agaagatgga aacattcttg gacacaaact cgagtacaac 960

tttaactcac acaatgtata catcacggca gacaaacaaa agaatggaat caaagctaac 1020

ttcaaaattc gccacaacgt tgaagatggt tccgttcaac tagcagacca ttatcaacaa 1080

aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct gtcgacacaa 1140

tctgtccttt cgaaagatcc caacgaaaag cgtgaccaca tggtccttct tgagtttgta 1200

actgctgctg ggattacaca tggcatggat gagctctaca aagaagatgt aaaggatatt 1260

aattttgata caaaagagaa atttctagca ggatgcttaa ttgtttcttt tcatgaagga 1320

aaaaat 1326

Claims

1. The bacterial outer membrane vesicle is characterized in that the bacterial outer membrane vesicle is obtained by the induction expression and purification of an escherichia coli recombinant expression vector, and the surface of the bacterial outer membrane vesicle is expressed with plCSA-BP target protein;

the escherichia coli recombinant expression vector contains a nucleotide sequence shown as SEQ ID NO.1, and when the expression vector is constructed, the encoding genes of InaXN ice nucleoprotein, sfGFP green fluorescent protein and plCSA-BP target protein are constructed into recombinant plasmids, and then the recombinant plasmids are transferred into attenuated escherichia coli to obtain the escherichia coli recombinant expression vector.

2. The bacterial outer membrane vesicle of claim 1, wherein the bacterial outer membrane vesicle has a particle size of 20-80 nm.

3. The bacterial outer membrane vesicle of claim 1, wherein the conditions for the induction of expression of the bacterial outer membrane vesicle by the recombinant expression vector of e.coli are: LB liquid medium containing 0.1-1 mM isopropyl beta-D-1-thiopyran galactoside, which is induced for 4-14 h at 20-30 ℃.

4. The bacterial outer membrane vesicle of claim 3, wherein the conditions for the induction of expression of the bacterial outer membrane vesicle by the recombinant expression vector of e.coli are: LB liquid medium containing 1mM isopropyl beta-D-1-thiogalactopyranoside is induced at 30℃for 14h.

5. The bacterial outer membrane vesicle according to any one of claims 1 to 4, wherein the escherichia coli expression vector, after inducing expression of the bacterial outer membrane vesicle, is extracted and purified by ultrafiltration concentration.

6. Use of the bacterial outer membrane vesicles according to claim 1 as carriers for loading siRNA drugs to form drug-loaded nanoparticles for the preparation of a therapeutic agent for preeclampsia.

7. The use of the bacterial outer membrane vesicles according to claim 6 for the manufacture of a medicament for the treatment of preeclampsia wherein the medicament-carrying nanoparticle is formed by loading siRNA medicament into the bacterial outer membrane vesicles using electroporation.

8. The use of the bacterial outer membrane vesicle of claim 7 for the manufacture of a medicament for the treatment of preeclampsia, wherein the electroporation technique is operated under conditions of: the mass ratio of the bacterial outer membrane vesicle to the siRNA is (1-3), the mass ratio is (1-3), and the electroporation voltage is 100-900V.

9. The use of the bacterial outer membrane vesicle of claim 8 in the manufacture of a medicament for the treatment of preeclampsia, wherein the electroporation technique is operated under conditions of: the mass ratio of the bacterial outer membrane vesicle to the siRNA is 1:1, and the electroporation is applied with a voltage of 700V.