CN110037996A - Endogenous height expresses the preparation method and its application in preparation of anti-tumor drugs of membrane vesicle in the Escherichia coli of miRNA - Google Patents
Endogenous height expresses the preparation method and its application in preparation of anti-tumor drugs of membrane vesicle in the Escherichia coli of miRNA Download PDFInfo
- Publication number
- CN110037996A CN110037996A CN201910359269.1A CN201910359269A CN110037996A CN 110037996 A CN110037996 A CN 110037996A CN 201910359269 A CN201910359269 A CN 201910359269A CN 110037996 A CN110037996 A CN 110037996A
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- membrane vesicle
- protoplast
- mirna
- membrane
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/5005—Wall or coating material
- A61K9/5063—Compounds of unknown constitution, e.g. material from plants or animals
- A61K9/5068—Cell membranes or bacterial membranes enclosing drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Botany (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the preparation methods of membrane vesicle in a kind of Escherichia coli of endogenous height expression nucleic acid anti-tumor drug, using " tRNA Support Method ", miRNA stabilization is inserted into carrier, carrier is transformed into Escherichia coli to the miRNA for making its endogenous great expression have killing cancer cell function again, use the epicyte and periplasmic fraction of lysozyme removal Escherichia coli, obtain Escherichia coli protoplast, protoplast is filtered using polycarbonate membrane, protoplast is smashed, finally using membrane vesicle in the purifying of ultracentrifugal method and separated protoplast, obtain the interior membrane vesicle of the less toxic Escherichia coli of high expression miRNA.Method provided by the invention is easy to operate, and production cost is low, can scale fermentation preparation, low toxicity efficiently.In the preparation of antitumor drugs by its application it can obviously inhibit the growth of non-small cell lung cancer as a kind of new drug carrier, have broad application prospects in pharmaceutical carrier field.
Description
Technical field
The present invention relates to biotechnologys, more particularly, to the low endotoxin Escherichia coli of endogenous height expression miRNA a kind of
Interior membrane vesicle preparation method, the invention further relates to the interior membrane vesicle application in preparations of anti-tumor drugs prepared.
Background technique
The method for carrying medicine using bacteria nano vesica, because its volume production is at low cost, easy modification, stability is strong, and surface egg
It is white relatively easy, by transformation after can substantially reduce immunogenicity the features such as, gradually cause the concern of people in recent years.Leather is blue
Family name's negative bacteria has two membranes --- and outer membrane and inner membrance, containing toxin such as lipopolysaccharides on outer membrane, and the toxin on inner membrance is relative to outer
Film is less.The study found that the outer membrane and inner membrance of gramnegative bacterium can natural or generation nano-scale manually capsules
Bubble.
Bacterial outer membrane vesicles (OMV) are a kind of spherical, bilayer structures, and partial size is about between 50-100nm.
Contain the substances such as lipopolysaccharides (LPS), lipid, water-solubility protein, DNA, mRNA, microRNA in OMV.OMV is that bacterium is distinctive
A kind of physiological structure, is mainly generated by gramnegative bacterium, and OMV can be also generated in a small number of gram-positive bacteriums.Bacterium meeting
The nano vesicle on cell membrane is secreted into outside film in each period of growth phase, but the OMV being spontaneously generated often is carried
There are a variety of toxin such as lipopolysaccharides, is easy to cause the immune response of body as pharmaceutical carrier.
Interior membrane vesicle is also spherical, bilayer structure, and partial size contains in interior membrane vesicle about between 60-250nm
There are the substances such as DNA, microRNA, compared with outer membrane vesicles, the toxin such as lipopolysaccharides is reduced in interior membrane vesicle, it should be to be more suitable for
As the carrier for loading nucleic acid drug.But due in Escherichia coli membrane vesicle (protoplast vesica) relative to outer membrane want crisp
Weak much not only preparation process is more complicated, and acquisition modes are also more difficult, horizontal by current drug delivery technologies, in vitro will
It is irrealizable that drug, which is loaded into interior membrane vesicle,.
Currently, mainly in vitro by drug carrier into OMV in such a way that bacterium membrane vesicle loads drug.It is existing
Method has electric shocking method, 37 DEG C of warm bath methods, ultrasonic methods etc., but the above method is low in the presence of loading drug efficiency, it is complicated to grasp process,
The drawbacks such as expensive instrument facility need to be relied on.In recent years, there are also the appearance of new technology, for example are induced using saponins OMV
OMV surface channel is opened in agent, after drug enters OMV, blocks channel using calcium chloride to complete drug loading etc..These new skills
Although art improves the efficiency of drug carrier to a certain extent, simplify operating process, get rid of expensive instrument facility according to
Lai Xing, but it is still confined to the extracellular technical level for loading drug, so far, there is not yet related carried using interior membrane vesicle
The application of medicine.
Summary of the invention
The purpose of the present invention is to provide a kind of low endotoxin Escherichia coli of endogenous height expression nucleic acid anti-tumor drug
Interior membrane vesicle preparation method, compared to the prior art for, the method for the present invention is easy to operate, production cost is low and safety more
It is good.
To achieve the above object, the present invention can take following technical proposals:
The preparation method of membrane vesicle, includes the following steps: in the Escherichia coli of endogenous height expression miRNA of the present invention
The first step selects tRNA as bracket, miRNA precursor Pre-miRNA is inserted into the anticodon loop of tRNA, forms knot
The stable Pre-miRNA-tRNA of structure, protects miRNA not to be degraded in Escherichia coli, while can be with great expression；Then will
The Pre-miRNA-tRNA of stable structure is inserted into plasmid vector, then plasmid vector is transferred in Escherichia coli；
Second step, the Escherichia coli that the first step is obtained are cultivated in the triangular flask containing LB liquid medium, make its endogenous
Great expression have killing cancer cell function miRNA, then collect bacterium solution；
Third step goes the outer membrane of Escherichia coli and pericentral siphon component in bacteria-removing liquid (while to have also been removed on outer membrane using lysozyme
The endotoxins such as lipopolysaccharides), obtain Escherichia coli protoplast；Then protoplast is filtered using polycarbonate membrane, by plasm
Body is smashed, and membrane vesicle in less toxic protoplast is obtained；
4th step purifies membrane vesicle in the protoplast that third step obtains, to obtain in the Escherichia coli of great expression miRNA
Membrane vesicle.
The aperture that the polycarbonate membrane that protoplast uses is filtered in the third step is followed successively by 12um, 6um, 1.2um.
When purifying membrane vesicle in protoplast in the 4th step, successively by the poly- carbonic acid in the aperture 6um and 1.2 apertures um
The installation of ester film is filtered using ultracentrifugal method on the filter, and the centrifugal rotational speed of filter is 100,000 xg,
Centrifugation time is 70min.
In the Escherichia coli of endogenous height prepared by the present invention expression nucleic acid anti-tumor drug membrane vesicle prepare it is antitumor
Application in drug.
The present invention utilizes the expression of endogenous E. coli height to have the miRNA of killing cancer cell function for the first time, and is made with it
It is loaded into vesica for drug, compared with the method for the external loading drug of existing use, easy to operate, production cost is low,
It can technology large scale preparation by fermentation, mass production easy to accomplish；Simultaneously using membrane vesicle in Escherichia coli protoplast
As pharmaceutical carrier, the toxin such as lipopolysaccharides are reduced compared with outer membrane vesicles, safety is higher, as a kind of new drug carrier
There is biggish application potential in practice.In the preparation of antitumor drugs by its application, non-small cell lung cancer can obviously be inhibited
Growth, have broad application prospects in pharmaceutical carrier field.
Detailed description of the invention
Fig. 1 is the agarose gel electrophoresis figure of the recombinant vector of endogenous great expression miR-34a.
Fig. 2 is the transmission electron microscope picture of membrane vesicle in Escherichia coli.
Fig. 3 be the Escherichia coli of endogenous expression miR-34a prepared by the present invention interior membrane vesicle and exogenous load medicine
Drug-loading efficiency comparison between Escherichia coli outer membrane vesicles.
Fig. 4 is the interior membrane vesicle of the Escherichia coli of endogenous expression miR-34a prepared by the present invention in different time sections pair
The lethal effect of non-small cell lung cancer cell.
Specific embodiment
More detailed explanation is done to the present invention below by specific embodiments and the drawings, in order to those skilled in the art
Understanding.
Key instrument used in the embodiment of the present invention and reagent include:
PCR instrument (TAKARA BIO INC, D-8707)；
Electrophoresis apparatus, ultraviolet device (Liuyi Instruments Plant, Beijing, DYY-7C type)；
Ultramicron nucleic acid-protein analyzer (Nanodrop ND-2000)；
Inverted fluorescence microscope (OLYMPUS Olympus microscope CX31)；
HF-3300 Flied emission transmission electron microscope (high and new technology company, Hitachi)
Constant-temperature table (Shanghai ZHICHENG Anaiytical Instrument Manufacturing Co., Ltd., ZWY-2012C)；
Table model high speed centrifuge (Hunan Xiang Yi Laboratory Instruments development corporation, Ltd., H1650-W)；
Cell membrane green fluorescence probe (the green skies biotechnology research institute in Shanghai)；
Hind III, Sal I, EcoR I, BamH I restriction enzyme, T4 DNA ligase (Beijing NEB company)；
DNA marker, PCR high fidelity enzyme mix, BCA protein concentration try assay kit, BL21 competent cell, K12 large intestine
Bacillus strain (Beijing Suo Laibao company)；
It is the small extraction reagent kit of plasmid, PCR product purification kit, Ago-Gel DNA QIAquick Gel Extraction Kit, RNA extracts kit, anti-
Transcript reagent box, PCR kit for fluorescence quantitative (Zhengzhou Bei Bei Biotechnology Co., Ltd).
Embodiment 1 prepares the Escherichia coli of endogenous great expression miRNA
Step 1 designs the primer sequence of pET-31b (+) and the complete genome sequence of PCR amplification pET-31b (+)
(1) primer sequence of pET-31b (+) carrier is designed
Sequence is as follows:
Upstream primer: 5 '-AAGAATTCAAGCTTATCTCCTTCTTAAAGTTAAACAAAATTATT-3 '；
Downstream primer: 3 '-TTGGATCCGTCGAC GCAATAACTAGCATAACCCCTTG-5 '.
(2) plasmid of K12 Escherichia coli, the template as PCR amplification pET-31b (+) carrier are extracted
A, from the K12 coli strain being stored in 20% glycerol is taken out in -80 low temperature refrigerators, to its thawing, in ultra-clean work
It is lined in platform on the solid LB plate containing 100mg/ml ampicillin, 37 DEG C of inversions are cultivated 12-16 hours；
B, picking monoclonal is in the 5ml LB liquid medium containing 100mg/ml ampicillin, the item of 37 DEG C of 220rmp
Shake culture 12-16 hours under part；
C, it takes 3ml bacterium solution to extract Plasmid DNA using the small topic kit of plasmid, is stored in -20 DEG C of refrigerators.
(3) PCR amplification pET-31b (+) carrier
PCR amplification system are as follows: total system 20ul, template plasmid 0.2ul；Primer 1ul；High fidelity enzyme mix 10ul, ddH2O
8.8ul。
PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s；60 DEG C of annealing 30s；72 DEG C of extension 5min, altogether
32 circulations；72 DEG C of extension 7min.
Step 2 designs the primer sequence of tRNA and the gene order of PCR amplification tRNA
(1) sequence of tRNA are as follows: 5 '-TGGCTGGGGTCAATGGATTCGAACCAGGGAATGCCGGTATCAAAAACCGGTGG
CCTTACCGCTTGGCGATACCCCA-3’
(2) primer sequence of tRNA is:
Upstream primer 5 '-TTGAATTCTGGCTGGGGTACCTGGATTCGAACCAG-3 '；
Downstream primer 3 '-AACTTAAGCGGGTCCAGGGTTCAAGTCCCTGTTC-5 '.
(3) human gene group DNA is extracted, the template as PCR amplification tRNA:
A, it is gargled three times with clear water, scrapes mouth epithelial cells using the toothpick sterilized；
B, the toothpick for scraping mouth epithelial cells is immersed in SLA lysate 5 minutes；
C, oral epithelium DNA is extracted using DNA extraction kit.
(4) PCR amplification tRNA sequence:
PCR amplification system are as follows: total system 20ul, oral epithelium DNA 1ul；Primer 1ul；High fidelity enzyme mix 10ul, ddH2O
8ul。
PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s；63 DEG C of annealing 30s；72 DEG C of extension 30s, totally 32
A circulation；72 DEG C of extension 7min.
Step 3 designs the primer sequence of miR-34a and the gene order of PCR amplification miR-34a
(1) gene order of miR-34a are as follows:
5’-CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAATAA
TGCGCCGTCCACGGCA -3’。
(2) primer sequence of miR-34a are as follows:
Upstream primer sequence: 5 '-AATTCGAACGCTGGCGACGGGACATTATTACTTTTGGT-3 '；
Downstream primer sequence: 3 '-AAGTCGACTGCCGTGGACGGCGCATTATTACTCAC-5 '；
(3) PCR amplification system are as follows: total system 20ul, oral epithelium DNA 1ul；Primer 1ul；High fidelity enzyme mix 10ul,
ddH2O 8ul。
PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s；60 DEG C of annealing 30s；72 DEG C of extension 30s, altogether
32 circulations；72 DEG C of extension 7min.
Step 4 carries out product purification to above three pcr amplification product respectively using PCR product purification kit, pure
DNA after change can be reserved in -20 DEG C of refrigerators.
Step 5, double digestion Pet-31b (+) carrier after purification and tRNA segment
(1) Pet-31b (+) carrier of double digestion after purification
A, double digestion system are as follows: EcoR I, 2ul;BamH I,2ul;10×NEB buffer 5ul；Pet-31b (+) carrier
30ul；ddH2O 11ul；Total system is 50ul.
B, in 37 DEG C incubator digestion 12 hours
(2) segment of double digestion tRNA after purification
A, double digestion system are as follows: EcoR I, 2ul;BamH I,2ul;10×NEBbuffer3.1 5ul；TRNA segment 30ul；
ddH2O 11ul；Total system is 50ul.
B, in 37 DEG C incubator digestion 12 hours.
Step 6, Pet-31b (+) carrier and tRNA segment that glue recycling double digestion is crossed
(1) centesimal Ago-Gel is made, Pet-31b (+) carrier after double digestion is proportionally added by macropore comb
Loading buffer, whole loadings, 120V 40min, the later gel extraction under ultraviolet device；
(2) the tRNA segment after double digestion is proportionally added by the Ago-Gel of production 2 percent, macropore comb
Loading buffer, whole loadings, 120V 20min, the later gel extraction under ultraviolet device.
Step 7 connects Pet-31b (+) carrier and tRNA segment
A, linked system are as follows: Pet-31b (+) carrier, 5ul；TRNA segment 3ul；T4 DNA ligase 2ul；Buffer 2ul；
ddH2O 8ul；Total system is 20ul；
B, it reacts 16 hours for 4 DEG C.
Step 8, conversion, upgrading grain, sequence verification plasmid
A, it is attached the conversion of product using DH5 α competent cell, connection product is added in competent cell, on ice
30min, 42 DEG C of thermal shock 90s are incubated for, stand 5min on ice, are added the LB liquid medium of 500ul antibiotic-free, 37 DEG C
150rpm shake culture 1 hour, bacterium solution is uniformly coated on the solid LB plate containing 100mg/ml, 37 DEG C of inversion cultures
12-16 hours；
B, picking monoclonal is in the test tube that 5ml contains the LB liquid medium of 100ug/ml ampicillin, and 37 DEG C
220rpm shake culture 12-16 hours, 3ml bacterium solution is taken to extract plasmid using the small extraction reagent kit of plasmid；
C, using the method preliminary identification plasmid of PCR amplification, PCR amplification system are as follows: plasmid 1ul；Primer 1ul；High fidelity enzyme
Mix 10ul, ddH2O 8ul；Total system 20ul.PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s；63 DEG C are moved back
Fiery 30s；72 DEG C of extension 30s, totally 32 recycle；72 DEG C of extension 7min.Run glue verifying, by preliminary screening to plasmid send to sequencing
Company's sequencing, until screening sequencing accurately Pet-tRNA recombinant vector.
Step 9, double digestion Pet-tRNA plasmid after purification and miR-34a segment
(1) the Pet-tRNA plasmid of double digestion after purification
A, double digestion system are as follows: Hind III, 2ul;Sal I,2ul;10×NEB buffer 5ul；Pet-31b (+) plasmid
25ul；ddH2O 16ul；Total system is 50ul.
B, in 37 DEG C incubator digestion 12 hours
(2) segment of double digestion miR-34a after purification
A, double digestion system are as follows: Hind III, 2ul;Sal I,2ul;10×NEB buffer 5ul；MiR-34a segment
30ul；ddH2O 16ul；Total system is 50ul.
B, in 37 DEG C incubator digestion 12 hours.
Step 10, the Pet-tRNA plasmid and miR-34a segment that glue recycling double digestion is crossed
(1) centesimal Ago-Gel is made, Pet-tRNA plasmid after double digestion is proportionally added by macropore comb
Loading buffer, whole loadings, 120V 40min, the later gel extraction under ultraviolet device；
(2) the miR-34a segment after double digestion is proportionally added by the Ago-Gel of production 2 percent, macropore comb
Loading buffer, whole loadings, 120V 20min, the later gel extraction under ultraviolet device.
Pet-tRNA and miR-34a segment is attached by step 11
A, linked system are as follows: Pet-tRNA, 6ul；MiR-34a segment 4ul；T4 DNA ligase 2ul；Buffer 2ul；ddH2O
6ul；Total system is 20ul；
B, it reacts 16 hours for 4 DEG C.
Step 12, conversion, upgrading grain, sequence verification plasmid
A, it is attached the conversion of product using DH5 α competent cell, connection product is added in competent cell, on ice
30min, 42 DEG C of thermal shock 90s are incubated for, stand 5min on ice, are added the LB liquid medium of 500ul antibiotic-free, 37 DEG C
150rpm shake culture 1 hour, bacterium solution is uniformly coated on the solid LB plate containing 100mg/ml, 37 DEG C of inversion cultures
12-16 hours；
B, picking monoclonal is in the test tube that 5ml contains the LB liquid medium of 100ug/ml ampicillin, and 37 DEG C
220rpm shake culture 12-16 hours, 3ml bacterium solution is taken to extract plasmid using the small extraction reagent kit of plasmid；
C, using the method preliminary identification plasmid of PCR amplification, PCR amplification system are as follows: plasmid 1ul；Primer 1ul；High fidelity enzyme
Mix 10ul, ddH2O 8ul；Total system 20ul.PCR amplification program are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s；60 DEG C are moved back
Fiery 30s；72 DEG C of extension 30s, totally 32 recycle；72 DEG C of extension 7min.Run glue verifying, by preliminary screening to plasmid send to sequencing
Company's sequencing, until screening sequencing accurately Pet-tRNA-miRNA recombinant vector.The Ago-Gel of recombinant vector
Electrophoresis result is as shown in Figure 1.
D, the plasmid by sequencing pair is converted using BL21 competent cell, so that obtaining can be with endogenous great expression
The Escherichia coli of miRNA.
Step 13, the Escherichia coli obtained using IPTG induction step 12 make its endogenous great expression miR-34a
A, the BL21 bacterial strain after recombinant plasmid is transferred to is taken out in -80 DEG C of refrigerators, to its thawing, is lined added with 100ug/ml ammonia
On the LB solid agar sugar plate of parasiticin, it is placed in 37 DEG C of constant incubators and is inverted culture 16-18 hours, on plate
Grow monoclonal；
B, picking monoclonal is finally placed in the test tube that 5ml contains the LB liquid medium of 100ug/ml ampicillin
37 DEG C of shaking tables, 220rpm revolving speed shake culture 12-16 hours；
C, the bacterium solution that Tube propagation obtains is seeded to the LB liquid containing 100ug/ml ampicillin by the volume ratio of 1:100
In culture medium, continue in 37 DEG C of shaking tables with the revolving speed shake culture of 220rpm, under the wavelength of 600mm, as Escherichia coli OD
When value reaches 0.5-1, the isopropylthiogalactoside (IPTG) of 1mol/L is added in LB culture medium, continues in 37 DEG C of shaking tables
In with the revolving speed shake culture Escherichia coli of 220rpm, thus induce endogenous E. coli great expression have killing cancer cell
The miRNA(miR-34a of function).Step 14 uses fluorescence quantitative PCR detection miR-34a embodying in Escherichia coli
Amount
(1) in bacterium solution miR-34a fluorescence quantitative PCR detection
A, take the bacterium solution after IPTG is induced 12 hours in 1ml step 13 to centrifuge tube, 12000 rpm are centrifuged 1 minute, outwell
Clearly, thallus is sufficiently cracked using 500ul RL Solution, after addition 40ul chloroform mixes well, 12000rpm centrifugation
10min, the careful supernatant 200ul that draws are added 400ul dehydrated alcohol, chromatographic column are added after mixing well to new centrifuge tube
In, 12000rpm is centrifuged 1 minute, outwells filtrate, is cleaned twice using Wash Buffer, is finally used the DEPC of no RNA enzyme
Water elution RNA obtains fresh RNA；
B, reverse transcription is carried out using the downstream primer of the miR-34a in step 2, the RNA reverse transcription that upper step is obtained is at cDNA；
RNA 3ul, 10 × Buffer 2ul, reverse transcriptase 2ul, downstream primer 1ul, DEPC water 12ul, total system 20ul, in PCR
The program of reverse transcription is selected in instrument, 50 DEG C are reacted 1 hour, and 72 DEG C of 5min terminate reaction；
C, use 16s RNA as the internal reference of quantitative fluorescent PCR, the primer of 16S RNA is as follows:
Upstream primer 5 '-CTCTTGCCATCGGATGTGCCCA-3 '；
Downstream primer 3 '-CCAGTGTGGCTGGTCATCCTCTCA-5 '.
D, the use of cDNA obtained in step b is template, silver-colored Fluorescent Quantitative PCR is carried out on the machine of fluorescent quantitation；cDNA
1ul, miR-34a primer 1ul, 2 × fluorescent quantitation mix 10ul, DEPC water 8ul, total system 20ul, in fluorescent quantitation
It just being tested in machine, 95 DEG C of 5min of initial denaturation are denaturalized 94 DEG C of 30s, and anneal 60 DEG C of 30s, extend 72 DEG C of 30s, altogether 40
A circulation；
E, to, analyze to obtain concentration and relative expression quantity of the miR-34a in Escherichia coli after reaction by data.
Embodiment 2 prepares membrane vesicle in Escherichia coli
1, using the epicyte of lysozyme removal Escherichia coli, Escherichia coli protoplast is made
A, prepare 50mM Tris-HCl(pH 8.0 respectively), 50mM Glucose, 1mM EDTA solution, in this, as buffer,
Configuration concentration is the lysozyme of 4mg/ml；
B, it is inner that lysozyme is added to the coli somatic (embodiment 1 is prepared) being collected into, is reacted in 37 DEG C of water-baths
20min removes the toxin such as epicyte and lipopolysaccharides thereon；
C, it takes out a little bacterium solution and observes detection under the microscope, the protoplast until being removed wall completely.
2, Escherichia coli protoplast is filtered using polycarbonate membrane, obtains Escherichia coli protoplast inner membrance nano vesicle
A, the polycarbonate membrane in the aperture 12um is installed on the filter of 47mm size, filters Escherichia coli plasm
Body；
B, the polycarbonate membrane in the aperture 6um is installed on the filter of 47mm size, the large intestine bar walked in filtering
Bacterium protoplast；
C, the polycarbonate membrane in the aperture 1.2um is installed on the filter of 47mm size, the large intestine walked in filtering
Bacillus protoplast obtains membrane vesicle in the protoplast of micron-scale.
3, membrane vesicle in micron protoplast that step 2 obtains is subjected to hypervelocity density gradient centrifugation purifying (100000g
70min)；Ultracentrifugation (100000g 70min) again after initial purification；It is received to obtain Escherichia coli protoplast inner membrance
Rice vesica (namely membrane vesicle in the Escherichia coli of endogenous height expression miRNA).
In the Escherichia coli of 3 embodiment 2 of embodiment preparation in membrane vesicle miR-34a fluorescence quantitative PCR detection
A, membrane vesicle in the method separating Escherichia coli provided using embodiment 2 is resuspended with 100ul PBS, uses 500ul RL
Solution sufficiently cracks thallus, and after addition 40ul chloroform mixes well, 12000rpm is centrifuged 10min, carefully draws supernatant
200ul is added 400ul dehydrated alcohol, is added in chromatographic column after mixing well, 12000rpm is centrifuged 1 point to new centrifuge tube
Clock outwells filtrate, is cleaned twice using Wash Buffer, finally uses the DEPC water elution RNA of no RNA enzyme, obtain fresh
RNA；
B, reverse transcription is carried out using the downstream primer of the miR-34a in step 2, the RNA reverse transcription that upper step is obtained is at cDNA；
RNA 3ul, 10 × Buffer 2ul, reverse transcriptase 2ul, downstream primer 1ul, DEPC water 12ul, total system 20ul, in PCR
The program of reverse transcription is selected in instrument, 50 DEG C are reacted 1 hour, and 72 DEG C of 5min terminate reaction, altogether 40 circulations；
C, use 16s RNA as the internal reference of quantitative fluorescent PCR, the primer of 16S RNA is as follows:
Upstream primer 5 '-CTCTTGCCATCGGATGTGCCCA-3 '；
Downstream primer 3 '-CCAGTGTGGCTGGTCATCCTCTCA-5 '.
D, the use of cDNA obtained in step b is template, silver-colored Fluorescent Quantitative PCR is carried out on the machine of fluorescent quantitation；cDNA
The primer 1ul of 1ul, miR-34a, 2 × fluorescent quantitation mix 10ul, DEPC water 8ul, total system 20ul, in fluorescent quantitation
Machine in just test, 95 DEG C of 5min of initial denaturation are denaturalized 94 DEG C of 30s, and anneal 60 DEG C of 30s, extend 72 DEG C of 30s；
E, to after reaction, the concentration obtained miR-34a in Escherichia coli in membrane vesicle and opposite is analyzed by data
Expression quantity (fluorescent quantitative PCR result), as shown in the table.
。
As can be seen from the table: the expression quantity of miR-34a is 1.36 times of internal reference (16sRNA) in bacterium solution, and inner membrance
0.71 times up to internal reference of the expression quantity of miR-34a in vesica.
The morphologic observation of membrane vesicle in the Escherichia coli of 4 embodiment 2 of embodiment preparation
1, the Escherichia coli inner membrance vesicle solution that 2 ultracentrifugation of embodiment obtains is dripped and is washed one's face in sealed membrane；
2, copper mesh film surface is placed in Escherichia coli on the drop of membrane vesicle, suspension 10min, is slowly blotted with filter paper；
3, copper mesh is transferred on 3% glutaraldehyde fixer drop, suspension 5min is blotted with filter paper；
4, copper mesh is transferred on DW drop, is repeated ten times, each 2min is blotted with filter paper every time；
5, copper mesh is transferred on 4% uranium acetate dye liquor drop, is blotted after 10min with filter paper；
6, copper mesh is transferred on 1% methylcellulose drop, is blotted after 5min with filter paper；
7, after natural drying to sample, generally it is greater than 30min, using transmission electron microscope observing and takes pictures.Membrane vesicle in Escherichia coli
The transmission electron microscope picture of bubble is as shown in Fig. 2, can be seen that the saucer shape form (shown in arrow) of interior membrane vesicle, and size exists in figure
Between 30-200nm, meet the form and size characteristic of interior membrane vesicle.
The drug-loading efficiency of membrane vesicle in the Escherichia coli of 5 embodiment 2 of embodiment preparation
Escherichia coli inner membrance vesicle solution prepared by embodiment 2 extracts RNA using RNA extracts kit, later using reversion
Kit is recorded by RNA reverse transcription into cDNA, finally quantitative fluorescent PCR is carried out using the kit of quantitative fluorescent PCR, obtains endogenous
Property carry medicine Escherichia coli in membrane vesicle drug-loading efficiency；
Escherichia coli outer membrane vesicles solution identical with inner membrance vesicle solution concentration in upper step is made using supercentrifugation, uses
PBS suspends, and drug is then added and is incubated for jointly, is shocked by electricity later using electroporation apparatus, is incubated for 30min again, carried
Medicine outer membrane vesicles.The outer membrane vesicles solution obtained extracts RNA using RNA extracts kit, uses reverse transcription reagent box later
By RNA reverse transcription at cDNA, quantitative fluorescent PCR finally is carried out using the kit of quantitative fluorescent PCR, in vitro method is obtained and carries medicine
The drug-loading efficiency of Escherichia coli outer membrane vesicles.
Histogram shown in Fig. 3 be endogenous great expression miRNA Escherichia coli interior membrane vesicle drug-loading efficiency with
In vitro method carries the comparison of the drug-loading efficiency between the Escherichia coli outer membrane vesicles of medicine, can be seen that inner membrance prepared by the present invention in figure
The drug-loading efficiency of vesica is significantly larger than the drug-loading efficiency of outer membrane vesicles.
Membrane vesicle is to non-in the Escherichia coli of the endogenous great expression miRNA of 6 embodiment of the present invention 2 of embodiment preparation
The lethal effective evaluation of small cell lung cancer cell
(1) culture of cell
A, the A549 non-small cell lung cancer cell frozen is taken out in liquid nitrogen container, is placed on after the bottleneck for freezing bottle is tightened
It is rocked in 37 DEG C of water-baths, until cell all melts；
B, cell 1000rpm in centrifuge is centrifuged 10min after melting；
C, first add 9ml culture medium in culture dish, then the culture medium in cryopreservation tube is outwelled, 1ml 1640 is added and cultivates completely
Base；
D, cell is cultivated, outwells culture medium after cell covers with, 2ml PBS is added and rinses twice, 1ml tryptose is added later
Enzyme digests 10min in 37 DEG C of incubators；
E, take out culture dish, be added 3ml complete medium mix, while terminate pancreatin digestion, in centrifuge 1500rpm from
Heart 5min；
F, supernatant is outwelled, 2ml PBS is added and cleans twice, 1500rpm is centrifuged 5min again；
G, cell is tuned into identical number under the microscope by cell count.
(2) cellular invasion is tested
A, it is dyed using cell membrane green fluorescence probe Dio to membrane vesicle in medicine is carried, is added in membrane vesicle suspension in 500ul
Enter 5ul cell membrane green fluorescence probe dye, is incubated for 30min in 37 DEG C of water-bath, again using ultracentrifugal method
Membrane vesicle in load medicine after separation dyeing；
B, interior membrane vesicle BCA kit and the microplate reader measurement obtained upper step carries the protein concentration of membrane vesicle in medicine, obtains
Membrane vesicle in medicine is carried to 200ug/ml；
C, membrane vesicle in the load medicine for three kinds of concentration that upper step obtains is separately added into after cell count has same cell
In three several culture dishes with A549 cell, it is non-to A549 small that observation at regular intervals carries membrane vesicle in medicine Escherichia coli
The fragmentation effect of cell lung cancer cell, is counted.
Fig. 4 be endogenous expression miR-34a Escherichia coli interior membrane vesicle in different time sections to non-small cell lung cancer
The lethal effect of cell.It is seen that with the extension of time, survival non-small cell lung cancer cell gradually decrease,
After 24 hours, the survival volume of non-small cell lung cancer cell has been lower than 10%, it was demonstrated that endogenous height expression nucleic acid prepared by the present invention is anti-
If membrane vesicle is prepared into anti-tumor drug in the Escherichia coli of tumour medicine, there is effect well to the clinical treatment of tumour
Fruit.
It should be understood that
In the method for the present invention, plasmid vector can also use other cloning vectors, such as pBSMrnaSeph carrier, pGEMEX-1, Psp64
Deng.
Claims (4)
1. the preparation method of membrane vesicle in a kind of Escherichia coli of endogenous height expression nucleic acid anti-tumor drug, it is characterised in that:
Include the following steps:
The first step selects tRNA as bracket, miRNA precursor Pre-miRNA is inserted into the anticodon loop of tRNA, forms knot
The stable Pre-miRNA-tRNA of structure；Then Pre-miRNA-tRNA is inserted into plasmid vector, then plasmid vector is transferred to
In Escherichia coli；
Second step, the Escherichia coli that the first step is obtained are cultivated in the triangular flask containing LB liquid medium, collect bacterium solution；
Third step goes the outer membrane of Escherichia coli and pericentral siphon component in bacteria-removing liquid using lysozyme, obtains Escherichia coli protoplast；
Then protoplast is filtered using polycarbonate membrane, obtains membrane vesicle in protoplast；
4th step purifies membrane vesicle in the protoplast that third step obtains, to obtain in the Escherichia coli of great expression miRNA
Membrane vesicle.
2. the preparation side of membrane vesicle in the Escherichia coli of endogenous height expression nucleic acid anti-tumor drug according to claim 1
Method, it is characterised in that: in the third step filter protoplast use polycarbonate membrane aperture be followed successively by 12um, 6um,
1.2um。
3. the preparation side of membrane vesicle in the Escherichia coli of endogenous height expression nucleic acid anti-tumor drug according to claim 1
Method, it is characterised in that: when purifying membrane vesicle in protoplast in the 4th step, successively by the aperture 6um and 1.2 apertures um
Polycarbonate membrane is mounted on filter and is filtered, and the centrifugal rotational speed of the filter is 100,000 xg, centrifugation time
It is 70min.
4. endogenous height expresses membrane vesicle application in preparation of anti-tumor drugs in the Escherichia coli of nucleic acid anti-tumor drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910359269.1A CN110037996B (en) | 2019-04-30 | 2019-04-30 | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910359269.1A CN110037996B (en) | 2019-04-30 | 2019-04-30 | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110037996A true CN110037996A (en) | 2019-07-23 |
| CN110037996B CN110037996B (en) | 2022-01-18 |
Family
ID=67280345
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910359269.1A Active CN110037996B (en) | 2019-04-30 | 2019-04-30 | Preparation method of escherichia coli inner membrane vesicle of endogenous high-expression miRNA and application of escherichia coli inner membrane vesicle in preparation of antitumor drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110037996B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804621A (en) * | 2019-10-31 | 2020-02-18 | 郑州大学 | Preparation method of escherichia coli extracellular vesicle with endogenous high-expression miRNA (micro ribonucleic acid) |
| CN114990038A (en) * | 2022-05-24 | 2022-09-02 | 郑州大学 | Bacterial outer membrane vesicle and application thereof in preparation of preeclampsia treatment medicine |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105701364A (en) * | 2016-02-18 | 2016-06-22 | 南昌大学第二附属医院 | Identification method for properties pleural effusion |
| CN107142228A (en) * | 2017-04-18 | 2017-09-08 | 浙江大学 | A kind of preparation of Escherichia coli outer membrane vesicles, medicine-carrying method and its application in antitumor |
| US20170304212A1 (en) * | 2016-04-25 | 2017-10-26 | University-Industry Foundation, Yonsei University | Gene carrier using cell-derived nanovesicles and method for preparing the same |
| CN108175861A (en) * | 2016-12-08 | 2018-06-19 | 暨南大学 | A kind of delivery system of antitumor small nucleic acids drug and its application |
-
2019
- 2019-04-30 CN CN201910359269.1A patent/CN110037996B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105701364A (en) * | 2016-02-18 | 2016-06-22 | 南昌大学第二附属医院 | Identification method for properties pleural effusion |
| US20170304212A1 (en) * | 2016-04-25 | 2017-10-26 | University-Industry Foundation, Yonsei University | Gene carrier using cell-derived nanovesicles and method for preparing the same |
| CN108175861A (en) * | 2016-12-08 | 2018-06-19 | 暨南大学 | A kind of delivery system of antitumor small nucleic acids drug and its application |
| CN107142228A (en) * | 2017-04-18 | 2017-09-08 | 浙江大学 | A kind of preparation of Escherichia coli outer membrane vesicles, medicine-carrying method and its application in antitumor |
Non-Patent Citations (4)
| Title |
|---|
| MOREIN S等: "Separation of Inner and Outer Membrane Vesicles from Escherichia coli in Self-Generating Percoll Gradients", 《ANALYTICAL BIOCHEMISTRY》 * |
| WEI-PENG WANG等: "Bioengineering Novel Chimeric microRNA-34a for Prodrug Cancer Therapy: High-Yield Expression and Purification, and Structural and Functional Characterization", 《J PHARMACOL EXP THER》 * |
| 丁平田: "《药剂学》", 31 May 2008, 人民军医出版社 * |
| 张灵芝: "《脂质体制备及其在生物医学中的应用》", 30 April 1998, 北京医科大学 中国协和医科大学联合出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110804621A (en) * | 2019-10-31 | 2020-02-18 | 郑州大学 | Preparation method of escherichia coli extracellular vesicle with endogenous high-expression miRNA (micro ribonucleic acid) |
| CN114990038A (en) * | 2022-05-24 | 2022-09-02 | 郑州大学 | Bacterial outer membrane vesicle and application thereof in preparation of preeclampsia treatment medicine |
| CN114990038B (en) * | 2022-05-24 | 2023-06-27 | 郑州大学 | Bacterial outer membrane vesicle and application thereof in preparation of preeclampsia treatment drug |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110037996B (en) | 2022-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105567641A (en) | Preparation method and application of targeting exosome carrying anti-tumor protein | |
| CN110037996A (en) | Endogenous height expresses the preparation method and its application in preparation of anti-tumor drugs of membrane vesicle in the Escherichia coli of miRNA | |
| CN112553142B (en) | 3D organ of nasal mucosa epithelial cells and culture method and application thereof | |
| CN107164332A (en) | Leukaemia's excretion body that the TGF β 1 modified through interference sequence keep silent and its preparation method and application | |
| CN102839181A (en) | Nucleic acid aptamer sequence of gastric cancer cells, and uses thereof | |
| CN106867967A (en) | The LM3 cell lines and its construction method of Midkine stable low-expressions | |
| US20230323352A1 (en) | Exosome secreted from gene-modified cells with long non-coding ribonucleic acids and application thereof | |
| CN111440816A (en) | Surface display type yeast host cell and application thereof in preparation of porcine astrovirus yeast vaccine | |
| CN110106150A (en) | A kind of preparation method and application of synovial sarcoma cells system hSS-005R | |
| CN104877011B (en) | The protein transduction domain in fish nervous necrosis virus source as well as preparation method and application thereof | |
| CN105349561B (en) | A method of fermented cells density is improved using hemoglobin | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN107446949A (en) | PLS3 recombinant proteins eukaryon expression plasmid and its construction method and application | |
| CN107557391A (en) | Based on the canine distemper sensitive cell line method for building up of Nectin4 acceptors and application | |
| CN110804621A (en) | Preparation method of escherichia coli extracellular vesicle with endogenous high-expression miRNA (micro ribonucleic acid) | |
| CN114657184B (en) | Multivalent aptamer functionalized DNA nanostructure probe and preparation method and application thereof | |
| CN113528519B (en) | Egg duck circular RNA circ _2136 and detection reagent, method and application thereof | |
| CN110129319A (en) | A kind of siRNA of PRALR and application thereof | |
| CN115851858A (en) | Method for producing and purifying RSPO1 cell factor | |
| CN106148337A (en) | Long non-coding RNA AY927503 and application thereof | |
| CN105462928B (en) | A kind of Chinese oral cavity K-1735 COMM-1 and its method for building up | |
| CN112391385B (en) | siRNA, siRNA plasmid and lentivirus for targeted inhibition of NCEH1 gene expression as well as construction method and application thereof | |
| CN114712392A (en) | Immune cell preparation from autologous blood separation and application thereof | |
| CN114410636A (en) | Improved AS1411 aptamers and EVs conjugated therewith | |
| CN110161253A (en) | A kind of screening technique of immune-active peptides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |