CN115851858A

CN115851858A - Method for producing and purifying RSPO1 cell factor

Info

Publication number: CN115851858A
Application number: CN202211570522.6A
Authority: CN
Inventors: 刘源
Original assignee: Shenzhen Betis Biotechnology Co ltd
Current assignee: Shenzhen Betis Biotechnology Co ltd
Priority date: 2022-12-08
Filing date: 2022-12-08
Publication date: 2023-03-28

Abstract

The present application provides a method of producing RSPO1 cytokine, the method comprising: culturing a stable cell line over expressing RSPO1 cytokine. The invention has the following advantages: the invention is constructed by taking PCDNA3.1 as an eukaryotic expression vector, breaks through the traditional virus vector construction method, can be operated in a non-virus culture laboratory environment, and has the advantages of simple and safe operation and short production period. The RSPO1 protein produced by the invention is not a fusion protein, so that the stability of the molecular weight of the RSPO1 protein is ensured, and the RSPO1 protein obtained by the RSPO1 protein produced by the invention is purified by two steps, has higher concentration and higher purity.

Description

Method for producing and purifying RSPO1 cell factor

Technical Field

The invention relates to the field of biological medicine, in particular to a method for producing and purifying RSPO1 cell factors.

Background

Stem cell research is of great importance for future human health applications, and one of the key advances made in the stem cell research field over the past decade has been the development of organoid systems. Organoids belong to three-dimensional (3D) cell cultures, and surface markers and cell structures thereof are the same as those of homologous adult organs, and since the three-dimensional structures of organoids are compared with the traditional two-dimensional planar cell structures to study organoids, which can represent the interaction of organ cells in vivo, the study of organoids has important significance in a plurality of fields such as human tissue repair, reversal of aging, personalized drug screening, and the like.

However, different tissues require cell culture media containing specific growth factors, of which RSPO1 cytokine is a member of the WNT signaling pathway, essential in organoid development, and critical for the function of intestinal stem cells and the regeneration of intestinal epithelium.

Most RSPO1 protein products on the market are fusion proteins, the proteins are provided with a green fluorescent protein and are not pure, most RSPO1 proteins are used by human and mice in species, and pure human RSPO1 proteins are not available.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to overcome the defects that most RSPO1 protein products in the prior art are fusion proteins, the proteins are not pure and are commonly used by human and mice, and thus, a relatively pure human RSPO1 protein is provided.

The present invention provides a method for producing RSPO1 cytokine, the method comprising: culturing a stable cell line over expressing RSPO1 cytokine.

Preferably, the method comprises cloning a sequence encoding a RSPO1 cytokine into a eukaryotic expression vector to form a recombinant eukaryotic expression vector;

the recombinant eukaryotic expression vector is transferred into a host cell to form a stable transfer cell line.

Preferably, the RSPO1 cytokine is linked to a tag protein at its C-terminus.

Preferably, the tag protein is a 3xFLAG tag.

Preferably, the eukaryotic expression vector is pcDNA3.1.

Preferably, the host cell is a HEK293 cell.

Preferably, the method of culturing a stable transgenic cell line overexpressing RSPO1 cytokine comprises: basic culture, pressurized culture, enlarged culture and protein expression culture;

the basic culture medium comprises 500ml of DMEM high glucose syrup (1X) 440ml, fetal bone serum (50 ml), penicillin-streptomycin (100X) 5ml and Gluta MAX supplement (5 ml).

The culture medium used for the pressure culture is a selective culture medium; the selection culture medium is obtained by adding a resistance screening reagent into a basic culture medium;

the culture medium used for protein expression culture is an expression culture medium which does not contain protein; the formula of the expression medium is as follows: CD293 medium (1X) 990ml and Gluta MAX supplement 10ml, 1000 ml.

The basic culture medium and the amplification culture medium do not contain resistance screening reagents;

the time of the pressure culture is 3-5 days, preferably 4 days;

the time of the amplification culture is 2-4, preferably 3 days;

the protein expression culture time is 6-8 days, preferably 7 days.

Preferably, the resistance screening agent is G418.

Preferably, the method further comprises purifying RSPO1 cytokine; the purification method includes ultrafiltration and purification by a flag tag.

Preferably, the ultrafiltration membrane has a pore size of 10kD.

Any of the following biomaterials is also within the scope of the present invention:

(1) The recombinant eukaryotic expression vector is formed by cloning a sequence for coding RSPO1 cell factors into the eukaryotic expression vector;

(2) And (2) stably transferring a cell line, and transferring the recombinant eukaryotic expression vector in the step (1) into a host cell to form the stably transferred cell line.

The invention has the following advantages:

1. the invention is constructed by taking PCDNA3.1 as an eukaryotic expression vector, breaks through the traditional virus vector construction method, can be operated in a non-virus culture laboratory environment, and has the advantages of simple and safe operation and short production period.

2. The RSPO1 protein produced by the invention is not a fusion protein, which ensures the stability of the molecular weight of the RSPO1 protein,

3. the RSPO1 protein produced by the invention is purified by two steps, and the obtained RSPO1 protein has higher concentration and higher purity.

4. The stable cell line expressing the RSPO1 protein constructed by the invention can produce 80 micrograms of RSPO1 protein after 10 to 15 days.

5. The RSPO1 protein, the commercial RSPO1 protein and the like are used for metering and respectively culturing primary intestinal cancer stem cells, and the discovery shows that the intestinal cancer organoids cultured by the method are faster in development, larger in average growth diameter, better in state and higher in balling rate.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a map of pcDNA3.1 vector in example 1;

FIG. 2 is a schematic diagram showing the proportional dilution of Human R-spondin 1Standard with reagent diluent, etc. in example 1.

FIG. 3 shows the results of using the RSPO1 protein of example 1 for organoid growth.

Detailed Description

Example 1

1. Construction of pcDNA3-3 Xflag-Rspo 1 vector

RCR amplification of human Rspo1CDs region

1.1 obtaining PCR templates

A549 cells (lung cancer human alveolar basal epithelial cells) growing to 80% in a T75 cell culture flask were collected, and total RNA of the cells was extracted using the UPure Tissue RNA Kit (New Baiji, china).

1.2RNA inversion to cDNA

Use of

Script RT Master Mix kit (TaKaRa Co., japan)

A nuclease-free centrifuge tube was used, and the following reaction system was prepared on ice:

the reaction system in the centrifuge tube was placed in a 56 ℃ water bath for 5min, placed on ice, and then a new reaction system was added to the centrifuge tube:

and (3) gently and uniformly mixing liquid in the centrifugal tube, placing the centrifugal tube in a 42 ℃ water bath for 1h, then placing the centrifugal tube in a 70 ℃ metal bath for 5min, and finally obtaining cDNA, wherein the obtained cDNA can be directly used for a subsequent PCR experiment.

Amplification of the sequence of 1.3human Rspo1CDs

The sequence of human Rspo1CDs (see SEQ ID NO.1, 862 to 1653) was amplified using phanta high fidelity DNA polymerase (Vazyme, china). SEQ ID NO.1 is a cDNA sequence corresponding to the mRNA sequence of human Rspo 1. The amino acid sequence of the Rspo1 protein is shown in SEQ ID NO.2. The primers used were Rspo1-F and Rspo1-R.

Rspo1-F：5'-CCCAAGCTTGCCACC atgcggcttgggctgtgtg-3'(SEQ ID NO.3)

Rspo1-R:5'-CGCGGATCC ggcaggccctgcagatgtgagtg-3'(SEQ ID NO.4)

PCR reaction (50. Mu.l):

the PCR conditions were:

step 1: at 95 ℃ for 3 minutes

Step 2:95 ℃ for 15 seconds

And step 3: at 58 ℃ for 15 seconds

And 4, step 4:72 ℃ for 2 minutes

Repeating the steps 2 to 4 for 40 times

And 5:72 ℃ for 10 minutes

1.4human Rspo1CDs fragment purification

The amplified PCR fragment was recovered and purified using a DNA gel recovery kit (Vazyme, china).

2 digestion of human Rspo1CDs sequence and pcDNA3.1 vector (Liuyuan FOXO3 inhibition transcription factor SOHLH1 for the study of oocyte specific expression gene Bmp15/Gdf9 transcription Activity [ D ]. Chinese medical university, this vector is disclosed in)

The recovered Rspo1CDs fragment and pcDNA3.1 plasmid were generated by double-enzymatic cleavage with Hind III-HF (NEB) and BamH I-HF (NEB), respectively, as follows:

the enzyme was digested at 37 ℃ for 15-120min, and purified using a gel recovery kit (Takara, japan).

3 connection

The recovered Rspo1CDS fragment and pcDNA3.1 vector fragment were ligated using T4 DNA ligase (NEB). The Rspo1CDS fragment and pcdna3.1 vector fragment were added in a molar ratio of 6 in the reaction system, as shown in the following table:

ligation was carried out overnight at 16 ℃.

4 transformation

JM109 competent cells (Takara, japan) were used to transfer the ligation products into prokaryotic competent cells. Taking out the competent cells from a refrigerator at the temperature of-70 ℃, unfreezing on ice, adding the ligation product into the unfrozen JM109 competent cells, uniformly blowing and sucking, incubating on ice for 30min, processing at 42 ℃ for 60s, keeping on ice for 2-3min, adding 1mL of LB culture medium preheated at the temperature of 37 ℃, and performing shake culture in an incubator at the temperature of 37 ℃ for 1h; 100 mu L of culture bacteria liquid is evenly smeared on an LB-Amp plate and cultured overnight in an incubator at 37 ℃ to obtain a monoclonal colony.

5 screening

Screening of monoclonal colonies was performed using colony PCR. The enzymes, primers, reaction systems and adjustments used were referred to the above experiments, and the template was the selected portion of the colony. Note that half of each monoclonal colony was picked for colony PCR identification, and the remaining half was reserved as a stock. Amplifying and culturing the bacterial colony with positive bacterial colony PCR result, adding 5mL LB culture medium into the centrifuge tube and adding 5ul Amp ⁺ (100 mg/mL), the remaining half of the colonies were picked up and shake-cultured overnight in a 37 ℃ incubator.

6 identification

Carrying out enzyme digestion agarose electrophoresis verification after extracting plasmids from the cultured bacterial liquid, sending the plasmids to a biological company for sequencing (Shanghai, china), detecting the information of the inserted sequence, carrying out blast comparison on the sequencing sequence and the sequence in an NCBI database, and successfully inserting all the sequences, namely the human Rspo1 gene into pcDNA3.1 to obtain the pcDNA3-Rspo1 recombinant vector.

7A 3Xflag tag was inserted into the C-terminus of the Rspo1 gene on the pcDNA3-Rspo1 recombinant vector by the method described above.

In order to facilitate subsequent detection and purification, a 3Xflag tag is added at the C-terminal of the Rspo1 gene. Inserting a 3Xflag tag sequence between Bam HI and Eco RI sites of the pcDNA3-Rspo1 recombinant vector to obtain the recombinant vector. The DNA sequence of pcDNA3-3 × flag-Rspo1 vector 3 × flag is: GACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAG (SEQ ID NO. 5).

2. Expression and identification of Rspo1 protein in cells

HEK293 cell culture

Using DMEM high sugar medium (gibco, USA) containing 10% fetal bovine serum (FBS, gibco, USA), 1% (v/v) penicillin-streptomycin (100 ×, gibco, USA) and 1% (v/v) GlutaMAX supplement (100 ×, gibco, USA), 5% CO at 37 deg.C ₂ HEK293 cell culture was performed in an incubator.

pcDNA3-3 Xflag-Rspo 1 plasmid transfection

Plasmid transfection was performed using LipoGene (Sbjbio, china) transfection or Lipofectamine (gibco, USA). The method comprises the following specific steps:

(1) one day before transfection, HEK293 cells were seeded in six-well plates, 0.1-0.5X 10 cells per plate ⁶ And (4) cells. The next day transfection experiments were performed when cells were grown to approximately 70% -90% confluence.

(2) Add 4. Mu.g plasmid DNA to 250. Mu.l serum-free antibiotic-free DMEM solution in a sterile centrifuge tube and mix gently with a pipette.

(3) Take another centrifuge tube, add 8 μ l lipoGene2000 to 250 μ l serum-free antibiotic-free DMEM solution, mix gently using a pipette, and incubate for 5min at room temperature.

(4) The diluted DNA from the first two steps and the LipoGene2000 transfection reagent were mixed and gently mixed, and left at room temperature for 20min.

(5) The LipoGene 2000-DNA mixture was added to the plate and shaken up.

(6) Cultured at 37 ℃ and can be used for stable transfection after 4-6h of transfection.

And 3. Determining the screening concentration of G418.

The transfected HEK293 cells were plated in 8 wells of 12-well plates at 1-2X 10/well ⁴ When the confluence degree of each cell reaches 10-20% the next day, G418 with different concentrations is respectively added into the culture medium of each well, the final concentration of the added G418 is respectively 100 mug/ml, 200 mug/ml, 300 mug/ml, 400 mug/ml, 500 mug/ml, 600 mug/ml, 700 mug/ml and 800 mug/ml, the continuous culture is carried out for 10 days, fresh culture medium containing G418 with different concentrations is replaced every 2-3 days, and when the cells die in a large amount on the 8 th-9 th day, the concentration is selected as a proper screening concentration. This experiment determined the screening concentration to be 400. Mu.g/ml.

4. And (4) screening of stably transfected cell strains.

(1) Cells 24h after transfection were inoculated in fresh medium at 1.

(2) The screening culture is carried out for 14-15 days, and the fresh G418-containing conditioned medium is replaced every 2-3 days. Cells that survived the G418 pressure screen grew clonally.

(3) Picking of positive clones: under a microscope, a sterile 10ul gun head is used for scratching out the cloning boundary, then the cloning is picked out, the monoclonal cell mass is sucked into the gun head and transferred into a 24-pore plate, the monoclonal cell mass is digested and blown away by pancreatin, and the conditional culture medium containing G418 is continuously used for expanding culture. After the 24-well plate is full, half of the cells are frozen and preserved, the other half of the cells are transferred to a new plate for continuous culture, and DNA level identification is carried out after the full growth.

(4) And (3) positive cell clone identification: in order to detect whether the human Rspo1 DNA is integrated into the genome of the HEK293 cell, UPure Tissue DNA Kit (New Baiji, china) is used for extracting the genome DNA of the cell in each hole, and PCR amplification is carried out by using a specific primer aiming at the Rspo1, so that the cell clone with a positive band amplified is a positive cell clone (HEK 293-pcDNA3-3 x flag-Rspo 1).

(5) And (3) continuously performing successive multiplication after the recovery of the positive clone cells, and performing multiplication through a 24-pore plate, a six-pore plate, a 6cm plate and a 10cm plate respectively to obtain T75 cell culture bottles for subsequent protein expression detection. During the culture process, partial cells should be taken out for seed preservation and freezing storage, and the cell amount in the freezing storage tube is 1 multiplied by 10 ⁶ One tube per tube.

Expression detection of Rspo1 protein

5.1 application ELISA Kit (Human R-Spondin 1DuoSet ELISA R &D dy4645-05, duoSet ELISA Ancillary Reagent Kit 2R &D dy008b)

Human Rspo1 protein expression in HEK293-pcDNA3-3 × flag-Rspo1 cell culture supernatant was detected.

5.2 Mass spectrometric detection of the protein fraction in the crude cell supernatant.

And (3) performing mass spectrometry on the HEK293-pcDNA3-3 Xflag-Rspo 1 cell culture medium solution in the second step, the second step and the third step (4) and (5) after filtration sterilization of 0.22 mu m (Sammerfei), and confirming that the solution contains the Rspondin1 target protein through mass spectrometry.

3. Production of human recombinant Rspo1 protein

TABLE 1 reagents required

Medicine and food additive	Source
		advanced DMEM/F12 medium	Gibco 12624010
fetal bovine serum	Gibco 16140071
		DMEM high clucose(1×)	Gibco 11965092
Penicillin-Streptomycin(100×)	SANGON BIOTECH (SHANGHAI) Co.,Ltd.
		Gluta MAX supplement	Gibco 35050061
0.5％trypsin-EDTA(10×)	Gibco 15400054
		PBS	Gibco
CD293 medium(1×)	Gibco 11913019

TABLE 2 basal medium formulations for cytokine production

Total volume	500ml
		DMEM high clucose(1×)	440ml
Fetal bovine serum	50ml
		Penicillin-streptomycin(100×)	5ml
Gluta MAX supplement	5ml

TABLE 3 selection Medium formulation for cytokine production

Selection medium	Total volume 50ml
		Basic culture medium	49.1ml
G418 solution mother liquor 25mg/ml	0.9ml (G418 final concentration 450. Mu.g/ml)

Table 4 formulation of 2 x cell cryopreservation solution (mixed with cell suspension 1 at time of use)

Basic culture medium	5ml
		Fetal bovine serum	3ml
DMSO	2ml

TABLE 5 expression media formulations required for cytokine production

Total volume of expression Medium	1000ml
		CD293 medium(1×)	990ml
Gluta MAX supplement	10ml

1. Reviving HEK293-pcDNA3-3 Xflag-Rspo 1 stable transgenic cell strain (D1):

resuscitating and culturing the screened HEK293-pcDNA3-3 Xflag-Rspo 1 cell strain with 1X 10 cells in each cryopreservation tube ⁶ And (3) stably transforming HEK293-pcDNA3-3 Xflag-Rspo 1 cells.

(1) The frozen HEK293-pcDNA3-3 Xflag-Rspo 1 cells were placed in liquid nitrogen and transported to the cells.

(2) The cryopreserved tube was held with forceps, shaken in a 37 ℃ water bath for 2min, and removed from the water bath.

(3) Spraying alcohol on the surface of the cryopreservation tube, sucking cells in the cryopreservation tube into a 15ml sterile centrifuge tube in a super clean bench, adding 1ml of basal medium preheated at 37 ℃ into the cryopreservation tube to wash the cryopreservation tube, recovering 1ml of basal medium in the cryopreservation tube, and transferring the basal medium into the 15ml sterile centrifuge tube filled with the cells.

(4) The 15ml centrifuge tubes from the previous step were centrifuged at 200g for 3min at room temperature.

(5) The supernatant was discarded and the cell pellet was resuspended in 3ml of basal medium preheated to 37 ℃.

(6) 10ml of a basal medium preheated at 37 ℃ was added to the T75 cell culture flask, and the resuspended cells were inoculated into the T75 cell culture flask, and the cell culture flask was gently shaken in the shape of "8" to uniformly inoculate the cells.

(7) HEK293-pcDNA3-3 Xflag-Rspo 1 cells were observed under the mirror to be round and not attached to the wall, and the cells were observed to grow attached to the wall after the cell culture flask was placed in a 5-percent CO2 ℃ cell culture box and allowed to stand for 12 hours.

2. HEK293-pcDNA3-3 Xflag-Rspo 1 cells were cultured under pressure (D2-D6).

And taking out the T75 RS293 cell culture bottle inoculated on the previous day from the incubator, sucking out the basic culture medium in the culture bottle, changing the basic culture medium into 15ml of a selection culture medium preheated at 37 ℃, and changing the culture medium every 2 days until the cells grow to 80% in the T75 culture bottle, wherein the HEK293-pcDNA3-3 Xflag-Rspo 1 cells have the best growth state, and a part of the cells can be kept for freezing.

3. HEK293-pcDNA3-3 Xflag-Rspo 1 cell expansion culture (D7-D10)

When HEK293-pcDNA3-3 × flag-Rspo1 cells were grown to 80% in selective medium, they were ready for passage at 1.

(1) The selection medium was aspirated from the T75 flask and the cells were washed with 37 ℃ pre-warmed PBS.

(2) Adding 3ml of 0.5 percent of trypsin-EDTA into a T75 culture bottle, paving 0.5 percent of trypsin-EDTA at the bottom of the T75 culture bottle, digesting at room temperature for 2-3min, observing that HEK293-pcDNA3-3 Xflag-Rspo 1 cell pseudopodia is withdrawn under the mirror, rounding the cell edge, and adding 3 times of 0.5 percent of trypsin-EDTA volume (9 ml) of basal medium to stop digestion when the cell edge is gradually fallen off from an adherent state.

(3) Cells attached to the bottom of the T75 flask were gently pipetted off with a disposable sterile pipette to disperse the cell pellet.

(4) The cell suspension in the T75 flask was collected and transferred to a 15ml sterile centrifuge tube and centrifuged at 200g for 3min at room temperature.

(5) And (3) preparing 5-8 new T75 cell culture bottles according to the passage expansion ratio in the centrifugation process, and adding 15ml of preheated basal medium at 37 ℃ into each T75.

(6) The supernatant from the 15ml centrifuge tube was discarded and 3ml of fresh, 37 ℃ pre-warmed basal medium was added to resuspend the cell pellet.

(7) The cell suspension was uniformly inoculated into a T75 cell culture flask containing 15ml of the basal medium, and the cell culture flask was gently shaken in the shape of "8" to uniformly inoculate the cells.

(8) The old medium in the flask was replaced every 2 days with basal medium preheated at 37 ℃ until HEK293-pcDNA3-3 Xflag-Rspo 1 cells grew to 80% (this procedure is typically 2-4 days).

4. RSPO1 protein Collection (D10-D17)

The RSPO1 protein belongs to a secretory protein, and RS293 cells are synthesized and secreted to the outside of cells, namely culture media.

(1) When HEK293-pcDNA3-3 Xflag-Rspo 1 cells grow to 80% in a basal medium, the expression medium without protein components is replaced to obtain pure RSPO1 protein, specifically, the basal medium in a T75 bottle is completely sucked, and 15ml of expression medium preheated at 37 ℃ is added. The culture flask was returned to the incubator at 37 ℃ of 5%, and the culture was continued for 7 to 9 days without changing the medium.

(2) In the continuous culture stage, the growth state of HEK293-pcDNA3-3 Xflag-Rspo 1 cells is observed every day, liquid is not changed in the period, and the bottle cap of a T75 culture bottle is not opened.

(3) After HEK293-pcDNA3-3 Xflag-Rspo 1 cells are continuously cultured in an expression culture medium for 7-9 days, secreted human RSPO1 protein is diffused in culture medium supernatant, the culture medium in a T75 culture bottle is collected in a 50ml sterile centrifuge tube, the culture medium is centrifuged at 4 ℃ by 500g for 5min, and the supernatant is reserved after the sediment is discarded.

(4) Centrifuging the supernatant of the previous step at 4 deg.C for 15min at 3000g, and retaining the supernatant. This step can also be repeated once.

(5) After the supernatant was sterilized by filtration through a 0.22 μm filter, a secreted RSPO1 protein solution was obtained. And (3) subpackaging and storing the protein solution in a refrigerator at the temperature of-80 ℃, reserving a part of the protein solution for WB, elisa, mass spectrometry, purification and freeze-drying, and using the verified human RSPO1 protein for culturing stem cells and organoids.

Note: the obtained RSPO1 protein solution can be stored for more than half a year at the temperature of minus 80 ℃.

4. Quality control of RSPO1 protein solution

And (5) sampling the protein solution obtained in the third step, the 4 step and the 5 step, sending to quality control, wherein the content of the quality control comprises common bacteria, fungi, mycoplasma, chlamydia, viruses or other toxic and harmful microorganisms, and trusting the Shanghai organism to detect.

5. Identification of RSPO1 protein

1. Collecting RSPO1 protein solution, and WB detecting whether the collected RSPO1 protein solution contains the target RSPO1 protein

(1) Mixing RSPO1 protein solution with SDS protein sample buffer, boiling in boiling water for 5min, placing in ice box, ice-cooling for 5min, and repeating for 3 times.

(2) Preparing glue: preparing 12% separating gel, pouring into a gel making device, adding water, pressing, solidifying the separating gel, pouring off the water, sucking, preparing 5% laminated gel, pouring into the gel making device, inserting into a 10-hole comb, and solidifying for later use.

(3) SDS-PAGE electrophoresis: directly adjusting the extracted protein according to the dyeing result of Coomassie brilliant blue.

(4) Film transfer: preparing an NC membrane with the same size as the gel, soaking the NC membrane, the gel and six pieces of filter paper in a membrane transferring buffer solution for about 30min, and sequentially stacking from the negative electrode to the positive electrode between the two electrodes of a transfer electrophoresis tank: 3 pieces of filter paper, gel, NC membrane and 3 pieces of filter paper, no air bubble is left between each layer, and the electrophoresis apparatus is placed on a steady flow stage and transferred for 100min at 100V.

(5) Ponceau red staining: placing NC membrane in ponceau red dye, shaking table for about 5min, and eluting with TBST.

(6) And (3) sealing: blocking with 5% skimmed milk (blocking solution) at room temperature for 1h.

(7) Adding a primary antibody: the NC membrane was added with RSPO1 antibody (Abcam rabbit anti-human) and β -actin antibody (Abcam) diluted with blocking solution, respectively, overnight at 4 ℃, closed, and washed 5min × 3 times with TBST.

(8) Adding a secondary antibody: NC membrane was incubated with goat anti-rabbit IgG (Abcam) antibody, gently shaken at room temperature for reaction for 1h, and washed with PBS 5min X3 times.

(9) ECL development: and uniformly mixing the solution A and the solution B of the ECL, coating the mixture on an NC film, tabletting, and then placing the film in a developing solution for 1min, and finishing development in a fixing solution for 1 min.

As a result, it was found that the collected protein was RSPO1 protein.

2. The human RSPO1 protein solution is sent to mass spectrum detection, the mass spectrum result is confirmed to be correct, and the specific information is shown in the following table.

TABLE 5

3. Elisa detection of RSPO1 protein titer

The required kit is as follows: human R-Spondin 1DuoSet ELISA R &D dy4645-05, duoSet ELISAAncillary Reagent Kit 2R &D dy008b

Preparation of the experiment:

and standing the reagent in the kit for at least 15min at room temperature, and diluting the components to the specified concentration on the reagent bottle. The Human R-spondin 1Standard was diluted with reagent equivalent at the concentrations shown in FIG. 2, and a Standard curve was constructed from the diluted standards and a set of reagent containing no standards (blank). The reagents required for the Elisa experiment are all provided in the kit.

The Elisa detection specifically comprises the following steps:

(1) capture antibodies were diluted to working concentrations with PBS without carrier protein. Add 100. Mu.l of diluted capture antibody into each well of the plate, seal the plate with cover film, and go overnight at room temperature.

(2) The cover plate film is torn off, the reagent in the wells of the ELISA plate is discarded, and each well is repeatedly cleaned for three times by 400 mul wash buffer. After the last washing, the enzyme label plate is reversely placed on the absorbent paper, the enzyme label plate is lightly tapped, and the residual wash buffer is removed.

(3) Add 300. Mu.l reagent to each well, cover the membrane and incubate for 1h at room temperature.

(4) And (5) removing the cover plate film, and repeating the step (2).

(5) 100 mul of Human R-spondin 1Standard protein Standard and RSPO1 protein solution samples diluted to concentration gradient are added into each hole of the enzyme label plate, and each group has two auxiliary holes. Cover plate films are adhered, and incubation is carried out for 2h at room temperature in a dark place. .

(6) Removing the cover plate film, repeating the step (2)

(7) To each well, 100. Mu.l of Detection solution diluted with reagent solution was added, a new cover plate was attached, and incubated for 2h at room temperature in the dark.

(8) And (5) removing the cover plate film, and repeating the step (2).

(9) Add 100. Mu.l Streptaxidin-HRP to each well, apply the cover plate membrane, incubate 20min at room temperature in the dark.

Add 50. Mu.l of stop solution to each well in the R, gently tap the plate, and ensure thorough mixing.

The OD value was measured by setting a microplate reader at a wavelength of 450nm, and the optical density of each well was immediately measured.

And generating a standard curve according to the OD value of the standard substance, and substituting the OD value of the target RSPO1 protein solution to be detected into a curve equation to obtain a result multiplied by the sample dilution multiple, wherein the obtained result is the concentration of the RSPO1 protein produced by the user. The concentration detected was about 1000ng/ml.

6. RSPO1 protein purification

The RSPO1 protein solution is purified by two steps, wherein the first step is to select an ultrafiltration membrane with proper ultrafiltration pore diameter according to the molecular weight of the RSPO1 protein of 27kD for separation and purification, and the second step is to purify according to a C-terminal connected FLAG label. Through the two-step purification, the purity of the RSPO1 protein is more than 99%.

1. Purification of RSPO1 protein by ultrafiltration

Using a merk ultrafiltration tube, wherein the molecular weight of RSPO1 protein is 27KD, selecting the aperture of a filter membrane of MWCO 10KD, and a small amount of glycerin is arranged on an Amicon-Ultra-15 filter membrane and can be washed by milliq water, and the specific steps are as follows:

(1) to Amicon-Ultra-15 (15mL, 10kDa MWCO, millipore) was added 15ml of the sample.

(2) The horizontal rotor was centrifuged at 4000g for 60min at 4 ℃.

(3) Immediately recovering the concentrated solution after the centrifugation in the previous step, blowing the concentrated solution on 200 mul of gun head ice, sucking 200 mul of concentrated solution each time until the suction is finished, and finally adding MilliQ water into an ultrafiltration tube to prevent the membrane from drying due to water loss.

(4) After one ultrafiltration, the concentrate was transferred away. Alternatively, ultrafiltration may be performed multiple times.

The experiment recovers a tube of HEK293-pcDNA3-3 Xflag-Rspo 1 cell strain, and 120ml of RSPO1 protein solution with the concentration of about 1000ng/ml can be obtained. After 8 times of ultrafiltration, concentration is finished to obtain 1600 mul ultrafiltrate, the recovery efficiency is more than 95 percent, the concentration of the RSPO1 protein solution after ultrafiltration is about 80 mug/ml, and the RSPO1 protein solution can be preserved for a long time at the temperature of minus 80 ℃; or freeze-drying and storing, wherein the total amount of the RSPO1 protein after freeze-drying is 120 mug, the concentration of the RSPO1 required by organoid culture is 100-1000 ng/ml, and the RSPO1 can be re-dissolved before use according to the working concentration.

2. The RSPO1 protein ultrafiltrate is repurified by the flag tag

The kit is Tiandi human and Anti-DYKDDDDK MAGAROSE BEADS kit (SM 00901L), and each milliliter of magnetic BEADS can be combined with more than 1mg of tag protein.

Preparation before experiment:

(1) before loading on the column, the sample is sterilized and filtered by 0.22 μm (Saimerfin), so as to reduce impurities, improve the protein purification efficiency and prevent the column from being blocked.

Formal experiment:

(2) magnetic bead pretreatment: inverting Anti-DYKDDDDK MAGAROSE BEADS for several times to ensure that the magnetic BEADS are completely and uniformly mixed, taking 200 mu l of magnetic bead suspension, transferring the magnetic bead suspension into a 1.5ml centrifuge tube, placing the centrifuge tube on a magnetic separator, standing for 1min, and sucking and removing supernatant after the solution is clarified. Taking the centrifugal tube off the magnetic separator, adding 200 μ l of the balance liquid, repeatedly blowing and beating for 5 times with the gun head, placing the centrifugal tube on the magnetic separation rack again, clarifying the solution after 1min, removing the supernatant, and repeatedly washing the magnetic beads for 2 times.

(3) Purifying the FLAG tag protein: adding 1ml of RSPO1 protein ultrafiltrate obtained in the step six, the step 1 and the step 4 into the centrifuge tube processed in the step six, the step 2 and the step 2, uniformly mixing by vortex oscillation, placing the centrifuge tube in an overturning mixer at room temperature, uniformly mixing for more than 30min to ensure that the RSPO1 protein ultrafiltrate is fully contacted with magnetic beads, placing the centrifuge tube after uniform mixing on a magnetic separator, and after 1min, sucking and storing supernatant as a flow-through sample after the solution is clarified for subsequent detection.

(4) Washing impurities with magnetic beads: adding 5 times of magnetic bead volume (1000 μ l) of the washing solution into the centrifuge tube, shaking for suspension, placing on a magnetic separation rack, after about 1min, after the solution becomes clear, removing the supernatant by suction, and repeating for 2 times.

(5) Competitive elution of the protein of interest: eluting with competitive eluent (flag polypeptide content 100 mu g/ml) with the volume of 3-5 times of that of magnetic beads (600 mu l-1000 mu l), incubating at 2-8 ℃ for 30min, placing the centrifuge tube on a magnetic separation frame for 1min, taking out supernatant after the solution is clarified, wherein the supernatant is an elution component, and the RSPO1 protein can be stored at-80 ℃ for more than half a year.

3. RSPO1 protein solution is prepared by freeze-drying.

A VDF2000a type freeze dryer is adopted, and in order to avoid pollution, a special Lyotray freeze-drying tray (type LDT-1.8LB1) of Dongfulong is used, so that the splash phenomenon in the freeze-drying process can be overcome, the waste is reduced, the heat transfer is uniform, and the product stability is ensured.

The method recovers one tube of RS293 cells to obtain 120ml of RSPO1 protein solution, the concentration of the RSPO1 protein is 1000ng/ml, two steps of purification of ultrafiltration and FLAG tag are carried out, 80 mu g of RSPO1 protein can be obtained after freeze-drying, and the RSPO1 protein can be stored for a long time at the temperature of minus 20 ℃.

7. Use of RSPO1 protein for organoid growth

From the first day, the RSPO1 protein of the invention, the commercial RSPO1 protein and the like are used for metering and respectively culturing primary intestinal cancer stem cells, and the intestinal cancer organoids cultured by the method are found to be faster in development, larger in average growth diameter, better in state and higher in balling rate, and the result is shown in figure 3.

Claims

1. A method for producing RSPO1 cytokine, comprising: culturing a stable cell line over expressing RSPO1 cytokine.

2. The method of claim 1, comprising cloning a sequence encoding a RSPO1 cytokine into a eukaryotic expression vector to form a recombinant eukaryotic expression vector;

3. The method of claim 1 or 2, wherein the RSPO1 cytokine is C-terminally attached to a tag protein.

4. The method of any one of claims 1-3, wherein the tag protein is a 3xFLAG tag.

5. The method of any one of claims 2 to 4, wherein the eukaryotic expression vector is pcDNA3.1.

6. The method of any one of claims 2 to 5, wherein the host cell is a HEK293 cell.

7. The method of any one of claims 1 to 6, wherein the method of culturing a stable transgenic cell line overexpressing the RSPO1 cytokine comprises: basic culture, pressurized culture, enlarged culture and protein expression culture;

the culture medium used for the pressure culture is a selective culture medium; the selective culture medium contains a resistance screening reagent;

the culture medium used for protein expression culture is an expression culture medium, and the expression culture medium does not contain protein;

the basic culture medium and the amplification culture medium do not contain resistance screening reagents.

8. The method of any one of claims 1 to 7, wherein the resistance selection agent is G418.

9. The method of any one of claims 1-8, further comprising purifying RSPO1 cytokine; the purification method comprises an ultrafiltration method and purification by a flag tag; preferably, the ultrafiltration membrane has a pore size of 10kD.

10. The biomaterial as described in any one of the following

(1) A recombinant eukaryotic expression vector is formed by cloning a sequence encoding RSPO1 cell factors into the eukaryotic expression vector;

(2) And (2) a stable cell line is formed by transferring the recombinant eukaryotic expression vector in the step (1) into a host cell.