CN112843083B

CN112843083B - Acute myocardial infarction treatment medicine

Info

Publication number: CN112843083B
Application number: CN202110201770.2A
Authority: CN
Inventors: 于婧; 赵魏芳; 张璐; 刘广焕
Original assignee: Qingdao Central Hospital
Current assignee: Qingdao Central Hospital
Priority date: 2021-02-23
Filing date: 2021-02-23
Publication date: 2021-09-07
Anticipated expiration: 2041-02-23
Also published as: CN112843083A

Abstract

The invention provides a medicine for treating acute myocardial infarction, and belongs to the technical field of cardiovascular disease medicines. The invention proves that the over-expression of the non-coding RNA LOC101928034 can effectively promote the proliferation of myocardial cells and the angiogenesis of vascular endothelial cells for the first time, so that the over-expression reagent LOC101928034 can be used for preparing the myocardial cell proliferation promoter and the angiogenesis promoter of the vascular endothelial cells, and further can be used for preparing the medicine for treating acute myocardial infarction, thereby providing a new medicine for treating the acute myocardial infarction.

Description

Acute myocardial infarction treatment medicine

Technical Field

The invention belongs to the technical field of cardiovascular disease medicines, and particularly relates to a medicine for treating acute myocardial infarction.

Background

Acute myocardial infarction is a cardiovascular disease with the highest worldwide morbidity and mortality, and is caused by myocardial necrosis caused by acute persistent coronary ischemia and hypoxia, and finally leads to myocardial remodeling and new function reduction which is difficult to reverse. Currently, the main clinical treatment modes for patients with myocardial infarction are drug therapy, interventional therapy, thrombolytic therapy and surgical therapy. Although these approaches are effective in improving survival in patients with myocardial infarction, these treatment approaches do not effectively address the issue of myocardial repair.

Non-coding RNAs are a class of RNA molecules in the whole genome that do not encode proteins, and these RNA molecules lack an open reading frame. With the rapid development of high-throughput technology, people gradually discover various ncRNAs, and with the continuous and deep research on the ncRNAs, more and more researchers discover that the ncRNAs play an important role in biological processes. The ncRNAs not only can act on the normal growth and development of organisms, but also have close relation with the occurrence and development of various diseases. At present, the relevant mechanisms of ncRNAs in the treatment of acute myocardial infarction are not yet clear.

Disclosure of Invention

The invention aims to provide a medicine for treating acute myocardial infarction, and provides the following technical scheme for realizing the aim.

In a first aspect, the invention provides an application of LC101928034 in acute myocardial infarction treatment, wherein the RNA nucleic acid sequence of the LOC101928034 is shown as SEQ ID NO. 1.

In a second aspect, the invention provides an application of a reagent for promoting the expression of LOC101928034 in preparing a medicine for treating acute myocardial infarction.

Preferably, the agent is a LOC101928034 overexpression plasmid.

In a third aspect, the invention provides a medicament for treating acute myocardial infarction, which contains LOC101928034 overexpression plasmid.

In a fourth aspect, the invention provides an application of an agent for promoting the expression of LOC101928034 in preparing a cardiomyocyte proliferation promoter.

Preferably, the agent is a LOC101928034 overexpression plasmid.

In a fifth aspect, the invention provides a cardiomyocyte proliferation promoter, which comprises an overexpression plasmid LOC 101928034.

In a sixth aspect, the invention provides an application of a reagent for promoting the expression of LOC101928034 in preparing a vascular endothelial cell angiogenesis promoter.

Preferably, the agent is a LOC101928034 overexpression plasmid.

Finally, the invention provides a vascular endothelial cell angiogenesis promoter, which contains LOC101928034 overexpression plasmid.

The invention has the beneficial effects that:

the invention proves that the over-expression of the non-coding RNA LOC101928034 can effectively promote the proliferation of myocardial cells and the angiogenesis of vascular endothelial cells for the first time, so that the over-expression reagent LOC101928034 can be used for preparing the myocardial cell proliferation promoter and the angiogenesis promoter of the vascular endothelial cells, and further can be used for preparing the medicine for treating acute myocardial infarction, thereby providing a new medicine for treating the acute myocardial infarction.

Drawings

FIG. 1 pcDNA3.1-LOC101928034 overexpression assay results;

figure 2 effect of over-expression of LOC101928034 on cardiomyocyte proliferation;

figure 3 effect of over-expression of LOC101928034 on endothelial cell angiogenesis;

FIG. 4 effect of over-expression of LOC101928034 on vascular endoglin expression.

Detailed Description

In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.

Example 1

Design and verification of LOC101928034 overexpression plasmid

(1) Designing primers according to the RNA nucleic acid sequence NR _125947.1 of LOC101928034, SEQ ID NO.1 and EcoR I and Xho I enzyme cutting sites of pcDNA3.1 to construct pcDNA3.1-LOC101928034 over-expression plasmid, wherein the primer sequences are shown as follows;

an upstream primer: GAATTCACACAACTCACCAAACCA, SEQ ID NO.2

A downstream primer: CTCGAGCCGCACAAACCTATGAGG, SEQ ID NO.3

(2) Inoculating human myocardial cells AC16 into a 6-well plate, when the cell density reaches 80%, transfecting the cells by using lip2000 liposome, transfecting pcDNA3.1 by using a control group, transfecting pcDNA3.1-LOC101928034 by using an experimental group, and setting 3 repeats for each group;

(3) after transfection for 48h, removing the culture medium, washing each well for 2 times by using 2ml of PBS, removing the PBS, and adding 1ml of Trizol for treatment for 10 min;

(4) after blowing, transferring Trizol to a new RNA enzyme-free EP tube, adding 250ul chloroform, standing at room temperature for 5min, placing in a centrifuge, and centrifuging at 4 ℃ and 12500rpm for 15 min;

(5) transferring 400ul of the supernatant to a new EP tube, adding equal volume of precooled isopropanol, mixing uniformly, standing at room temperature for 10min, placing in a centrifuge, and centrifuging at 4 ℃ and 12500rpm for 15 min;

(6) discarding the supernatant, adding 1ml of 75% ethanol into an EP tube, suspending and precipitating, placing in a centrifuge, centrifuging at 7500rpm for 10min at 4 ℃;

(7) discarding the supernatant, drying in an ultraclean workbench for 10min, adding 20-40ul DEPC water according to the size of the white precipitate, and detecting the concentration and purity of RNA;

taking 1 group of samples as an example, the quality result of RNA is

Type of sample	OD 260/280	OD 260/230	Concentration (ng/ul)	Volume (ul)
					pcDNA3.1	1.87	2.26	464.58	30
pcDNA3.1- LOC101928034	1.90	2.07	430.21	30

The RNA extraction requirement is met, and subsequent experiments can be carried out;

(8) removal of genomic DNA

The following reaction system is configured:

5×gDNA Eraser Buffer 2.0μl，

gDNA Eraser 1.0μl，

Total RNA 1.0μg，

RNase Free dH2O up to 10.0μl；

setting the parameters of a PCR instrument at 42 ℃ for 2 minutes and 4 ℃;

(9) carrying out a reverse transcription reaction

The following reaction system is configured:

10.0. mu.l of the reaction solution of the step (8),

PrimeScript RT Enzyme Mix I 1.0μl，

RT Primer Mix 1.0 μl，

5×PrimeScript Buffer 2 4.0 μl，

RNase Free dH2O 4.0 μl；

setting the parameters of a PCR instrument at 37 ℃ for 15 minutes, 85 ℃ for 5 seconds and 4 ℃;

(10) design LOC101928034 primer and carry out fluorescent quantitative PCR reaction

The primer sequence of LOC101928034 is as follows:

a forward primer: GAGAGCGGATACTGCCTTCC, SEQ ID NO.4

Reverse primer: GAGCCACACCCTTGTTCTGT, SEQ ID NO.5

The primer sequences for GAPDH are as follows:

a forward primer: GATTTGGTCGTATTGGGCGC, SEQ ID NO.6

Reverse primer: GCCTTCTCCATGGTGGTGAA, SEQ ID NO.7

The following reaction system is configured:

SYBR Green Premix Ex Taq（2×） 10.0μl，

LOC101928034 forward primer: the amount of the suspension was 0.4. mu.l,

LOC101928034 reverse primer: the amount of the suspension was 0.4. mu.l,

the cDNA template was 2.0. mu.l,

ddH2O 7.2μl；

setting the parameters of a PCR instrument as pre-denaturation at 95 ℃ for 3min for 1 cycle; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s, for 40 cycles, and each sample was provided with 3 multiple wells;

by using 2^{-△△ ct}The method processes real-time quantitative PCR data;

the experimental result is shown in FIG. 1, wherein, in the cell transfected with pcDNA3.1-LOC101928034, the relative expression level of LOC101928034 is 4.581 + -0.061, and it can be seen that pcDNA3.1-LOC101928034 can effectively promote the expression of LOC 101928034.

Example 2

Over-expression of LOC101928034 promotes proliferation of cardiomyocytes

(1) Preparing a cell suspension from the human myocardial cell AC16 transfected with pcDNA3.1 and pcDNA3.1-LOC101928034, and adjusting the cell density to 50000/ml;

(2) inoculating 100ul of cell suspension into a 96-well plate, arranging 5 multiple wells in each group, placing in a cell culture box, and culturing for 48 h;

(3) after the incubation, absorbance at 570nm was measured using MTT.

The results are shown in FIG. 2, wherein the absorbance of pcDNA3.1 is 0.409 + -0.036, and the absorbance of pcDNA3.1-LOC101928034 is 0.590 + -0.033, and it can be seen from the above results that the over-expression of LOC101928034 can effectively promote the proliferation of cardiomyocytes.

Example 3

Over-expression of LOC101928034 promotes vascularization of vascular endothelial cells

(1) Taking the Matrigel out of a refrigerator at the temperature of-20 ℃, putting the Matrigel into a refrigerator at the temperature of 4 ℃ for overnight melting, adding 40ul of Matrigel into a pre-cooled 96-well plate the next day, and flatly paving the Matrigel in a gentle shaking way;

(2) the vascular endothelial cell HUVEC transfected with pcDNA3.1 and pcDNA3.1-LOC101928034 was prepared into cell suspensions, and each well was addedInto 2X 10⁴(ii) individual cells;

(3) the 96-well plate was placed in a 37 ℃ cell incubator, and after 4 hours of incubation, photographs were taken and the total branch length was calculated.

The experimental results are shown in fig. 3, and it can be seen from the figure that over-expression of LOC101928034 can effectively promote the vascularization of vascular endothelial cells (relative fold is 1.399 ± 0.144).

Example 4

Over-expression of LOC101928034 to promote the expression of vascular endothelial growth factor

(1) Inoculating human vascular endothelial cells HUVEC into a 6-well plate, when the cell density reaches 80%, transfecting the cells according to a lip2000 liposome transfection instruction, transfecting pcDNA3.1 in a control group, transfecting pcDNA3.1-LOC101928034 in an experimental group, and setting 3 times for each group;

(2) after transfection for 48h, the medium was removed, after PBS cleaning, 100ul of protein lysate was added, cells were collected into an EP tube and lysed for 30min on ice;

(3) centrifuging the cell lysate for 12min at 12000g, transferring the supernatant to a new EP tube, measuring the protein concentration, and adjusting the sample loading amount to 20 ug;

(4) preparing separation gel and concentrated gel, adding a protein sample into a sample application hole, and performing electrophoresis according to the constant pressure of the concentrated gel of 80V and the constant pressure of the separation gel of 120V until bromophenol blue comes out;

(5) installing an electric rotating clamp according to the sandwich model, and rotating for 1.5 hours at a constant current of 300 mA;

(6) after the electrotransformation is finished, taking out the membrane, placing the membrane in 5% of skimmed milk powder, and sealing the shaking table for 1 h;

(7) VEGF and GAPDH primary antibodies are incubated and sealed overnight at 4 ℃;

(8) after washing the membrane, incubating the secondary antibody, and incubating for 1h at room temperature;

(9) after washing the film, developing and photographing are carried out.

The experimental results are shown in fig. 4, and it can be seen that over-expression of LOC101928034 can effectively promote protein expression of VEGF (relative fold is 1.818 ± 0.174), which indicates that over-expression of LOC101928034 promotes angiogenesis of vascular endothelial cells by promoting VEGF.

Sequence listing

<110> Qingdao city central hospital

<120> a medicine for treating acute myocardial infarction

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1390

<212> DNA

<213> Human source (Human)

<400> 1

acacaactca ccaaaccaag aaagaagaag cgctgaggag agagggttgt agagagggga 60

agaatgggga cggcccagag gtctgaccta tttatacccc agccaggccc tgcccatagc 120

aggggacagg ggagagcgga tactgccttc ctgctgtggg ctgatgcgcg ccctgcgtat 180

tcctggaagg tgcacacgat ggcagctacc gcctgctcca gaggcctggc catcctcact 240

gtcacagaac aagggtgtgg ctcacagcag agttccaggc cagcccccca gctcacctct 300

gccctctgtg tttctcagag actgttccca gacccatctt aacctccatc aggcttcagg 360

ccccgcagtc tccccctcct ctgagtagcc ctcccagacc acaccagccc ctcctaattt 420

atccccctgc tgtcctgttg ttatttcccc atgtagaggt ctcattgccc caacatcgct 480

gtaaactcct cagagagaca gcatcctacc ccaccaccca cacaccccac cgtggggctc 540

cttaagcact ctcagattat ctgccacctc ttcttatccc caacacccag ggatggctcg 600

gtcccagtct gccccagccc atgagatgcc ctagaagcct ccctccctgc aggaacttgc 660

acaaggagag cctggccctg tgcttctctg ccctcagccc ttggagaagc taggccttag 720

cagggagggg caggtctgag aggcgccccc acagcctcac caccactgcc ctcaccctgc 780

ctcctgccct gaactcgagg aagctgcacc cagaagaaaa acttgtggga tcctctctgc 840

ctgtcgccag ctgtgcaacc ttggaagaga acccaaaacc tagaagagcg tgagagggaa 900

aagaggaagg agattgactc ccaggccggc aaagaagcct tcctgcccgt gcaggcagcc 960

agagcgccag tgacaccttc gacctcgccc tcggccccca gcacccaagc cttgcctgtg 1020

ccgtcctctc cttggagact cagccctgtt gaggagggga gtgagcaata gaggagggaa 1080

ggaaaagagg agctgtgatt agccctgttt tataatgggc tacatagccc tgttttatat 1140

gggcttttta atggaagtat ggggagcagg gggcagagaa caagagacag tcacgcagca 1200

gaaggggggg ccagagtgca ccagcaatta attcagctct aggtcgagct taattattcc 1260

cacctatgat atcccagctc tgcccccagc cacctccctt aagcagccta cctctgctct 1320

cggggcttca ttttactcac ctgtcagtga tggagggtga taatagtaac tacctcatag 1380

gtttgtgcgg 1390

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaattcacac aactcaccaa acca 24

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctcgagccgc acaaacctat gag 23

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gagagcggat actgccttcc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gagccacacc cttgttctgt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gatttggtcg tattgggcgc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gccttctcca tggtggtgaa 20

Claims

1. Application of a reagent for promoting expression of LOC101928034 in preparation of a medicine for treating acute myocardial infarction is characterized in that the sequence of the LOC101928034 is shown as SEQ ID No.1, and the reagent is an over-expression plasmid of LOC 101928034.

2. The medicine for treating acute myocardial infarction is characterized by comprising an LOC101928034 overexpression plasmid, wherein the sequence of the LOC101928034 is shown as SEQ ID No. 1.