CN113846115A - Dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein and preparation method and application thereof - Google Patents
Dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein and preparation method and application thereof Download PDFInfo
- Publication number
- CN113846115A CN113846115A CN202111121774.6A CN202111121774A CN113846115A CN 113846115 A CN113846115 A CN 113846115A CN 202111121774 A CN202111121774 A CN 202111121774A CN 113846115 A CN113846115 A CN 113846115A
- Authority
- CN
- China
- Prior art keywords
- der
- pro
- recombinant
- protein
- allergen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6402—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
- C12N9/6405—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
- C12N9/641—Cysteine endopeptidases (3.4.22)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
- C12N2710/14141—Use of virus, viral particle or viral elements as a vector
- C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/103—Plasmid DNA for invertebrates
- C12N2800/105—Plasmid DNA for invertebrates for insects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96402—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from non-mammals
- G01N2333/96405—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from non-mammals in general
- G01N2333/96408—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from non-mammals in general with EC number
- G01N2333/96413—Cysteine endopeptidases (3.4.22)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a dermatophagoides pteronyssinus I allergen pro-Der p1 recombinant protein, a preparation method and application thereof, wherein the pro-Der p1 gene sequence has an optimized insect codon and a His protein sequence coupled to the 3' end, and the sequence is shown as SEQ ID NO: 1 is shown. Specifically, a pro-Der p1 gene sequence having an optimized insect codon and a His protein sequence linked thereto was constructed to a shuttle vector-based pFastBacTMIn Dual modified pFastBac-SCUVI, obtaining a recombinant baculovirus plasmid Bacmid-Der p1, preparing and amplifying recombinant Der p1 baculovirus by transfecting insect cells Sf9, and obtaining expressed pro-Der p1 recombinant protein. The physical and chemical properties of the pro-Der p1 recombinant protein are closer to those of a natural allergen protein component, so that the detection sensitivity is high, the non-specificity is less, the correlation between the detection results of ELISA and a liquid chip and the detection result of ImmunoCAP of a clinical allergen specific antibody is high, and the kit is particularly suitable for the rapid detection of dermatophagoides pteronyssinus allergens.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein, and a preparation method and application thereof.
Background
Dust mites, pollen, animal hair and the like are major allergens causing allergic diseases, and particularly dust mites, which are important allergens in the environment where people live. The common dust mites now include two types, one is house dust mite (Dermatophagoides pteronyssinus) and the other is dust mite (Dermatophagoides farina). It has been reported that about 60% to 80% of patients with allergic diseases are allergic to house dust mites. The secretions and excretions of house dust mites and the degradation products of dead insects can all become allergens. It has been shown that house dust mite crude extracts contain a number of components which bind to human serum IgE antibodies, but the cause of the disease in the patient may be related to only one or some of these components, which are called "fractions". As regards the constituents of house dust mites, there are over 30 components already named by the international society for immunology, of which component 1 and component 2 are considered to be the most important components in house dust mite allergens.
The currently common allergen-specific detection methods mainly comprise: in vivo tests (intradermal test or skin prick test), organ stimulation tests (through nasal mucosa, conjunctiva or airway), detection of serum specific IgE (sIgE), patch tests, and the like. The serum specific IgE detection is used as a safe, effective and convenient detection means and is widely applied to diagnosis of allergic diseases. However, most of the currently commercialized serum-specific IgE detection reagents are crude extracts, and due to the differences of extraction methods, post-treatment and storage methods, the crude extracts may have the phenomena of partial component loss or more impurity proteins, so that false negative results are easily caused. In addition, in crude protein extracts there may be substances with similar epitopes to the true allergens, which could cause cross-reactivity with false positive results. Therefore, the improvement of the accuracy of the detection result of serum specific IgE is a problem which needs to be solved urgently at present. Meanwhile, the crude extract contains a plurality of allergen components, and the content of the same component in different batches of products is inconsistent, so that the product standardization is not facilitated.
Therefore, the allergen components of house dust mites need to be known, the allergen single-component recombinant proteins, particularly the recombinant proteins of the house dust mite group I allergen Der p1, are prepared, technical means are provided for rapid diagnosis of house dust mite allergic diseases, and a basis is provided for clinically formulating an effective desensitization treatment scheme.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention provides a dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein, which is particularly suitable for rapid detection and desensitization treatment of dermatophagoides pteronyssinus allergens.
Specifically, the dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein, wherein the pro-Der p1 gene sequence has optimized insect codons and is coupled with a His protein sequence at the 3' end, and the sequence is shown as SEQ ID NO: 1 is shown. The pro-Der p1 recombinant protein has higher expression level and has similar biological activity with natural protein.
According to the inventionThe other purpose is to provide a recombinant plasmid containing the dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein. The recombinant plasmid is characterized in that a pro-Der p1 recombinant gene sequence which has optimized insect codons and is coupled with a His protein sequence at the 3' end is inserted into a shuttle vector-based pFastBac by utilizing Xho I and KpnI enzyme cleavage sitesTMObtained in Dual modified pFastBac-SCUVI. Further, the pro-Der p1 recombinant plasmid was transformed into DH10Bac strain to obtain pro-Der p1 recombinant baculovirus plasmid (i.e., recombinant baculovirus plasmid Bacmid-Der p 1).
It is still another object of the present invention to provide an expression vector comprising the above recombinant plasmid. Specifically, the recombinant baculovirus plasmid Bacmid-Der p1 is transfected into Sf9 cells to obtain a pro-Der p1 expression vector.
The fourth purpose of the invention is to provide a preparation method of the dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein. Specifically, a pro-Der P1 gene sequence connected with a His protein gene sequence and described in SEQ ID NO.1 is synthesized, and is connected to a shuttle vector pFastBac-SCUVI through Xho I and KpnI enzyme cutting sites, a recombinant baculovirus plasmid Bacmid-Der P1 is obtained by transforming DH10Bac competent cells, then Sf9 insect cells are transfected to prepare recombinant baculovirus, Sf9 cells are infected by P2 generation recombinant baculovirus, and supernatant is collected by centrifugation.
Specifically, the protein was purified as follows: filtering the collected supernatant with 0.45um filter; loading the filtrate on a His chromatography column, eluting the filtrate with 100mM imidazole and 200mM imidazole respectively; running SDS-PAGE gel on the eluate to obtain a pure pro-Der p1 band with a size of about 34 kD; and concentrating the eluent by using an ultrafiltration membrane package and performing PBS replacement to obtain the purified pro-Der p1 recombinant protein resuspended by PBS.
The fifth purpose of the invention relates to the application of the dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein in preparing diagnostic reagents or desensitization treatment and other biological products for detecting allergic diseases caused by dermatophagoides pteronyssinus.
The invention also relates to application of the dermatophagoides pteronyssinus class I allergen pro-Der p1 recombinant protein in preparation of diagnostic reagents or biological products for detecting dermatophagoides pteronyssinus.
The seventh object of the present invention relates to the use of the aforementioned recombinant protein of the group I allergen pro-Der p1 of house dust mites in a method for detecting house dust mites. The method comprises an in-vitro diagnosis method based on antigen and antibody, such as ELISA, a liquid phase chip, a solid phase chip, colloidal gold and the like, and can be used for rapidly detecting the house dust mite allergen.
The physical and chemical properties of the recombinant pro-Der p1 protein are closer to those of a natural allergen protein component, and the recombinant pro-Der p1 protein has higher cysteine protease activity, so that the detection sensitivity is high, the non-specificity is less, the correlation between the ELISA and liquid chip detection results and the ImmunoCAP results is high, the trend is consistent, and the recombinant pro-Der p1 protein is particularly suitable for the rapid detection of house dust mite allergens.
The pro-Der p1 gene sequence of the recombinant protein of the dermatophagoides pteronyssinus class I allergen pro-Der p1 provided by the invention has an optimized insect codon, has stronger specificity to the dermatophagoides pteronyssinus and is beneficial to the specific detection of the dermatophagoides pteronyssinus. And the 3' end of the pro-Der p1 gene sequence is coupled with His protein, which is beneficial to the purification of protein and the elution and separation of a His chromatography column, and the purity of the obtained recombinant protein is higher. The high-purity recombinant protein is favorable for clinical rapid etiological diagnosis and treatment of house dust mite allergens, is favorable for accurately diagnosing house dust mite allergic components, shortens the treatment period, saves the medical cost and generates good social benefits.
Drawings
FIG. 1 is a diagram showing the alignment of pro-Der p1 original sequence and optimized sequence.
FIG. 2 is a map of the pro-Der p1 recombinant plasmid.
FIG. 3 is a comparison of the sequencing of the pro-Der p1 recombinant protein and the original pro-Der p1 protein.
FIG. 4 shows SDS-PAGE detection of pro-Der p1 recombinant protein.
Lane 1: sf9 cell culture supernatant; lane 2: enabling the protein sample to flow through a nickel column; lane 3: 50mM imidazole eluent; lane 4: 200mM imidazole eluent; lane 5: 1M imidazole regenerates the eluent.
FIG. 5 shows the evaluation of the pro-Der p1 recombinant protease activity.
FIG. 6 shows the correlation analysis between the proDer p1 recombinant protein sIgE antibody ELISA (TMB method) and the ImmunoCAP detection result.
FIG. 7 shows the correlation analysis between the pro-Der p1 recombinant protein sIgE antibody chemiluminescence enzyme immunoassay (CLEIA) and immunocAP detection results.
FIG. 8 is the correlation analysis of the proDer p1 recombinant protein sIgE antibody liquid phase chip and the ImmunoCAP detection result.
Detailed Description
The technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. For those skilled in the art to which the invention pertains, several simple deductions or substitutions can be made without departing from the spirit of the invention, and all shall be considered as belonging to the protection scope of the invention.
Wherein, pFastBacTM Dual is purchased from Thermo Fisher company, Sf9 insect cells are purchased from American culture Collection (ATCC), 2 XPCR reaction solution, KOD FX enzyme and dNTPs are purchased from Toyobo textile (Shanghai) Biotech Co., Ltd., anti-human HRP-IgE and chemiluminescent substrates are purchased from Thermo Fisher company, and liquid phase chip microspheres and protein coupling kit are purchased from Bio-Rad company.
The specific implementation process comprises the following steps:
(1) preparing a dermatophagoides pteronyssinus component I-pro-Der p1 recombinant protein: finding out a gene sequence of Der p1 from an NCBI database, optimizing insect codons, inserting the gene sequence into a pFastBac-SCUVI vector modified based on a shuttle vector pFastBacTM Dual after connecting a His protein gene sequence at the 3' end, transforming DH10Bac competent cells to select Bacmid particles, preparing recombinant baculovirus by transfecting Sf9 insect cells, obtaining pro-Der p1 recombinant protein and purifying.
Insect codon optimization references: horse garden, Zhongliang, Wangkouhua, etc. foot-and-mouth disease virus VP1 gene codon preference analysis, Chinese animal quarantine, 2021. 28(4): 116-123.
(2) Evaluation of the Activity of the pro-Der p1 recombinant protein: the protein activity of the purified pro-Der p1 recombinant proteolytic cysteine protease substrate Z-phe-arg-MCA was evaluated by comparing its post-fluorescence intensity.
(3) Application of pro-Der p1 recombinant protein: the obtained pro-Der p1 recombinant protein is used for detecting Der p1 sIgE antibodies, an ELISA (TMB) method, a chemiluminescence enzyme immunoassay (CLEIA) method and a liquid chip method are respectively adopted, and compared with the detection result of the ImmunoCAP, the pro-Der p1 recombinant protein shows good correlation, and is particularly suitable for quickly detecting house dust mite allergens.
Example 1 preparation of recombinant protein of Dermatophagoides pteronyssinus component I pro-Der p1
Construction of pro-Der p1 recombinant plasmid
The gene sequence of Der p1, which contains a precursor peptide portion, was found from the NCBI database, and after insect codon-optimizing the sequence and adding His protein gene sequence to its 3' terminus (fig. 1), the optimized pro-Der p1 was amplified by RT-PCR or directly synthesized and inserted into the shuttle vector pFastBac SCUV using Xho I and KpnI enzyme cleavage sites to obtain the pro-Der p1 recombinant plasmid pFastBac-SCUVI-Der p1 (fig. 2).
2. Preparation and identification of baculovirus plasmid (Bacmid)
(1) Transformation and amplification
To 100ul DH10 MultiBac competent cells, 250ng of the recombinant plasmid pFastBac-SCUVI-Der p1 was added, ice-washed for 30 minutes, heat-shocked at 42 ℃ for 90 seconds, left on ice for 3 minutes, and then 900ul of non-resistant LB liquid medium was added to continue culturing for 5 hours. 200ul of bacterial liquid is taken and coated on an LB resistant plate (containing 10mg kanamycin sulfate, 10mg tetracycline hydrochloride and 1.4mg gentamicin sulfate) added with IPTG and X-gal, after culturing for 48 hours at 37 ℃, a target white colony is screened out through a blue-white spot, the white colony is streaked on the LB resistant plate added with IPTG and X-gal again, after culturing for 24 hours at 37 ℃,1 white colony is selected to be cultured in 5ml LB liquid culture medium (containing 10mg kanamycin sulfate, 10mg tetracycline hydrochloride and 1.4mg gentamicin sulfate) for 16 hours continuously.
(2) Bacmid-Der p1 Bacmid extraction
1) Taking 1 sterile 2ml centrifuge tube, collecting 6ml of the bacterial liquid of the bacmid to be extracted in three times, wherein the centrifugation condition is 12000 Xg each time, 1 minute, room temperature, centrifuging and discarding the supernatant. The following operations were performed for each centrifuge tube.
2) Add 250. mu.l Buffer S1 (RNase already added) (Axygen plasmid miniprep kit AP-MN-P-250) and resuspend the bacterial pellet with a 1ml pipette.
3) Add 250. mu.l Buffer S2 (from Axygen plasmid extraction kit), gently and thoroughly turn up and down 6 times to mix well to lyse the cells thoroughly until a clear solution is formed, and let stand for 3 minutes. This step did not exceed 5 minutes.
4) Add 350. mu.l Buffer S3 (from Axygen plasmid extraction kit), mix gently and thoroughly by tumbling 8 times, place on ice for 5 minutes and then centrifuge at 12000 Xg for 10 minutes, collect the supernatant into a new centrifuge tube at approximately 800. mu.l.
5) An equal volume of DNA extract (phenol/chloroform/isoamyl alcohol 25:24:1) was added to the hood, mixed by gentle inversion, and then centrifuged at 12000 × g for 5 minutes, and the supernatant (about 800ul) was collected.
6) Adding 0.6 volume (480 μ l) of isopropanol, mixing, and standing at-20 deg.C for 1 hr; centrifuging at 12000 Xg for 20 min, and discarding the supernatant;
7) add 700. mu.l 70% ethanol per tube to rinse the precipitate for desalting, centrifuge at 12000 Xg for 5 minutes, and discard the supernatant.
8) Centrifuging at 12000 Xg for 5 min, sucking off the residual supernatant with a pipette in a clean bench, and air drying for several minutes to obtain precipitate.
9) Adding 30 mul of sterilized water into an ultra-clean workbench, dissolving the mixture in the sterilized water, and temporarily storing the dissolved mixture at 4 ℃ to obtain the pro-Der p1 recombinant baculovirus plasmid (Bacmid-Der p 1).
(3) Identification of Bacmid-Der p1
PCR identification of the extracted bacmid was performed using specific primers P10(F: ATACGGACCTTTAATTCAACCCAAC; R: ACCCGTGCGTTTTATTCTGTCTTTT) and STAP3(F: CCGGCTCGTATGTTGTGTGGAATT; R: ATGTGGACAAAATACCTGGTTACCC). The PCR reaction system was as shown in the following Table, and the total volume of the reaction system was 50. mu.l.
Reaction system for PCR identification of baculovirus plasmids:
PCR reaction procedure:
STAP3:94 ℃ for 2 minutes; (98 ℃,10 seconds; 68 ℃, 5 minutes), 26 cycles; at 68 ℃ for 20 minutes; and preserving at 4 ℃.
P10, 94 ℃ for 2 minutes; (98 ℃,10 seconds; 57 ℃,30 seconds; 68 ℃,2 minutes), 26 cycles; at 68 ℃ for 20 minutes; and preserving at 4 ℃.
As shown in the results of the PCR product gene sequencing analysis and the PCR product detection in FIG. 3, the recombinant protein is pro-Der p1 protein.
3. Preparation of recombinant baculovirus and expression of recombinant pro-Der p1
(1) Culturing insect cells Sf9 in a serum-free Grace's culture medium, taking cells in a logarithmic growth phase, transfecting the obtained recombinant baculovirus plasmid bacmid-Der P1 into Sf9 cells, continuously culturing for 4-5 days after changing a Grace's complete culture medium (5% FBS), and collecting supernatant to obtain the P1 generation recombinant baculovirus.
(2) Taking Sf9 cells in logarithmic growth phase, adjusting cell density to 3.5 × 106And (3) infecting Sf9 cells by using P1 generation recombinant baculovirus solution according to the volume ratio of 1:50 for virus amplification, culturing for 4 days, and collecting supernatant, namely P2 generation recombinant baculovirus.
(3) Taking Sf9 cells in logarithmic growth phase, adjusting cell density to 3.5 × 106And (3) infecting Sf9 cells by using P2 generation recombinant baculovirus solution according to the volume ratio of 1:50 for virus amplification, culturing for 4 days, and collecting supernatant, namely P3 generation recombinant baculovirus.
(4) Taking Sf9 cells in logarithmic growth phase, adjusting cell density to 3.5 × 106And (2) infecting Sf9 cells by using P3 generation recombinant baculovirus solution according to the volume ratio of 1:50 for virus amplification, collecting cell culture solution on the 4 th day of culture, and centrifuging to collect supernatant for protein purification.
Purification and identification of pro-Der p1 recombinant protein
(1) Filtering the collected cell culture supernatant by using a 0.45um filter membrane; and purifying the sample by a nickel ion affinity chromatography column, eluting the sample by 50mM, 200mM and 1M imidazole respectively, and collecting the flow-through liquid obtained in each stage.
(2) And (3) purification and identification: the eluate was subjected to SDS-PAGE gel electrophoresis and then stained with Coomassie Brilliant blue, as shown in FIG. 4, and the target protein was mainly concentrated in 200mM imidazole eluate, resulting in relatively pure pro-Der p1 protein with a size of about 34 kD.
(3) Concentration and desalination: and (3) concentrating the 200mM imidazole eluent by using an ultrafiltration membrane pack and performing PBS replacement to obtain the pro-Der p1 recombinant protein resuspended by PBS, wherein the concentration is 3.5mg/ml, and the protein yield is 25mg per 1L of insect cell culture supernatant.
Example 2 evaluation of the Activity of the pro-Der p1 recombinant protein
The protease activity of the expressed recombinant pro-Der p1 is detected by using a specific fluorescent substrate Z-amphetamine-arginine-7-amino-4-methylcoumarin hydrochloride (Z-phe-arg-MCA) of cysteine protease.
1. Adding a proper amount of pro-Der p1 into a phosphoric acid-sodium citrate buffer solution with the pH value of 5.5, wherein the total reaction volume is 3ml, the final concentration of the pro-Der p1 is 25ug/ml, and carrying out water bath at 37 ℃ for 30 minutes; if inhibition of the enzymatic activity of pro-Der p1 is desired, pro-Der p1 is reacted with E64 at 37 ℃ for 15 minutes in advance.
2. After 30 minutes of water bath, 2ul of Z-phe-arg-MCA substrate buffer (final concentration: 20umol/L) was added to the solution, and the reaction was continued at 37 ℃ for 30 minutes.
3. After the reaction, 100. mu.l of each reaction solution was placed in a 96-well plate, and the fluorescence intensity was measured at 370nm for excitation and 440nm for emission. Pro-Der p1 protease activity was proportional to the fluorescence intensity of this result.
As shown in FIG. 5, the fluorescence intensity of pro-Der p1 after hydrolysis of cysteine protease substrate Z-phe-arg-MCA was the highest compared to the other groups, demonstrating that recombinant Der p1 indeed has cysteine protease activity.
Example 3 use of the pro-Der p1 recombinant protein for the detection of sIgE antibodies by ELISA (TMB method)
(1) Coating: the recombinant pro-Der p1 protein is diluted to 5ug/ml by carbonate buffer solution, coated in a 96-well enzyme label plate according to 100 ul/well, and coated overnight at 4 ℃ by attaching a sealing film.
(2) Washing the plate: the coated plates were removed overnight, the existing liquid was spun off, PBST 300. mu.l/well added, shaken for 20 seconds, the wash solution spun off, the wash repeated 3 times, and the plates were patted dry the last time.
(3) And (3) sealing: add 200. mu.l of blocking solution to the wells and place the plates statically in an incubator at 37 ℃ for 2 hours.
(4) Washing the plate: and (5) washing the plate for 3 times in the same step (2).
(5) Sample adding: diluting clinical serum sample with sample diluent at a ratio of 1:20, adding into the wells at a ratio of 100 μ l/well, and adding into two pairs of wells; meanwhile, setting a PBS negative control group; incubate at 37 ℃ for 2 hours. Because the Der p1 sIgE standard substance does not exist in the market of China at present, high-grade sIgE serum multiple dilution detected by ImmunoCAP is selected as the standard substance.
(6) Washing the plate: and (5) washing the plate for 3 times in the same step (2).
(7) Detecting an antibody: diluted HRP-labeled anti-human IgE antibody was added at 100. mu.l/well and incubated at 37 ℃ for 1 hour.
(8) Washing the plate: and (5) washing the plate, and performing final plate drying in the same step (2).
(9) Adding a substrate: substrate TMB was added at 100. mu.l/well and reacted at 37 ℃ for about 5 minutes in the absence of light.
(10) Adding a stop solution: observing the color change in the hole, adding stop solution H2SO4(1mol/L) 50. mu.l/well.
(11) Reading a plate: the plate was placed in a microplate reader and read at a wavelength of 450nm to record the OD value.
(12) And (4) calculating a result: and establishing a standard curve according to the concentration of the standard substance and the corresponding OD value to obtain a calculation formula, and calculating the corresponding sIgE concentration according to the average OD value of the sample composite hole.
The results of the ImmunoCAP assay were used as controls by testing the Der p1 sIgE results (grade 0-6, 3 samples per grade) from 21 sera. As shown in Table 1 and FIG. 6, the OD values of Der P1 sIgE detected by ELISA and the converted concentration values thereof were significantly correlated with the concentrations of house dust mite sIgE detected by immunocAP, and the correlation coefficients were 0.938, P <0.001 and 0.927, and P <0.001, respectively.
TABLE 1 Pro-Der p1 results of detection of human serum Der p1 sIgE by ELISA (TMB method)
Example 4 use of the pro-Der p1 recombinant protein for the detection of sIgE antibodies by chemiluminescence enzyme immunoassay (CLEIA)
(1) The Derp 1 stock solution was diluted with the coating solution to a concentration of 5. mu.g/ml, 100. mu.l/well was added to a light-shielding microplate and coated overnight at 4 ℃.
(2) Washing the plate: plates that had been coated overnight were removed, washed 3 times with PBST 200. mu.l/well and the plate was tapped the last time.
(3) And (3) sealing: add blocking solution at 200. mu.l/well and incubate at 37 ℃ for 2 hours.
(4) And (5) washing the plate for 3 times in the same step (2).
(5) Sample adding: serum samples were diluted with sample dilutions at a rate of 1:20 dilution, 100u l/hole, each sample set two multiple holes, at the same time using the sample dilution as negative control, 37 degrees 2 hours stationary incubation.
(6) And (5) washing the plate for 3 times in the same step (2).
(7) Detecting an antibody: HRP-labeled anti-human IgE antibody was expressed as 1: incubate at 2000 dilution, 100. mu.l/well, 37 ℃ for 1 hour, with shaking at 200 rpm.
(8) And (5) washing the plate, and performing the same step (2).
(9) Adding a substrate: SuperSignal chemiluminescent substrate was prepared in advance, added at 50. mu.l/well, and incubated for 1 min with shaking in the dark.
(10) Reading a plate: the plate was placed in a microplate reader BIOTEK rotation 3 for relative light unit values at wavelength 425nm within 1-5 minutes after addition of the substrate.
(11) And (4) calculating a result: and establishing a standard curve according to the concentration of the standard substance and the corresponding RLU value to obtain a calculation formula, and calculating the corresponding sIgE concentration according to the average RLU value of the multiple wells of the sample.
The results of 14 sera tested for Der P1 sIgE with ImmunoCAP test results as a control are shown in table 2 and fig. 7, where CLEIA chemiluminescence values and their converted sIgE concentrations were significantly correlated with ImmunoCAP results with correlation coefficients of 0.921, P <0.001 and 0.929, and P <0.001, respectively.
TABLE 2Pro-Der p1 results of detection of human serum Der p1 sIgE by chemiluminescence enzyme immunoassay (CLEIA)
Example 5 use of pro-Der p1 recombinant protein for liquid chip detection of sIgE antibodies
1. Coupling pro-Der p1 to magnetic beads:
(1) resuspending and dispersing magnetic beads: the magnetic beads were vortexed at 1400rpm for about 30 seconds on a vortexer and then sonicated in a water bath for 15 seconds.
(2) And (3) cleaning magnetic beads: adding 100 mul of the resuspended magnetic beads into a sterile 1.5ml centrifuge tube, standing for 1 minute on a magnetic reaction frame to ensure that the magnetic beads are completely adsorbed, and carefully absorbing and discarding the supernatant; add 100. mu.l of bead wash, vortex for 30 seconds, place on magnetic stand, stand for 1 minute, and carefully aspirate the supernatant.
(3) Activating magnetic beads: resuspend the beads in 100. mu.l of bead activation solution, vortex for 30 seconds; adding 10 μ l of 50mg/ml S-NHS, mixing slightly, immediately adding 10 μ l of 50mg/ml EDC, and mixing slightly; resuspending at high speed shaking for at least 30 seconds; incubate 20 minutes with shaking at 1100rpm in the dark at 25 ℃.
(4) Washing: after the incubation was completed, 150. mu.l MES (0.05M pH 5.0) was added and washed with high speed shaking for 10 seconds; placing the centrifugal tube in a magnetic frame for 1 minute, and sucking and removing supernatant after magnetic bead precipitation; add 100. mu.l MES resuspended beads and shake at high speed for 30 seconds.
(5) Coupling protein: adding 4 mu g of rpro-Der p1 into the magnetic beads, adjusting the final volume to 500 mu l by MES, and dispersing the magnetic beads for 1 minute by high-speed oscillation; incubate 2 hours with shaking at 1200rpm in the dark at 25 ℃.
(6) Washing: the product is placed in a magnetic frame to stand for 1 minute, and the supernatant is carefully sucked and discarded; add 500. mu.l MES, vortex, shake wash for 30 seconds, place on magnetic stand for 1 minute, and aspirate the supernatant.
(7) And (3) sealing: adding 125 mul of magnetic bead sealing solution, performing vortex oscillation washing for 30 seconds, placing the mixture on a magnetic frame for 1 minute, and absorbing and removing the supernatant; adding 250 mul of magnetic bead sealing solution, whirling and shaking the resuspended magnetic beads, and shaking and incubating for 30 minutes at 25 ℃ in a dark place at 1200 rpm; the product was placed on a magnetic stand and allowed to stand for 1 minute, and the supernatant was carefully aspirated.
(8) Storing and counting: adding 500 mul of magnetic bead storage solution, performing vortex oscillation washing for 30 seconds, placing the magnetic frame for 1 minute, and absorbing and removing the supernatant; add 150. mu.l of magnetic bead stock solution, vortex and resuspend the magnetic beads, use cell counting plate, after completion, place at 4 ℃ in the dark.
2. Detection of Der p1 sIgE by Luminex platform
(1) And (3) counting magnetic beads: taking out 150 mu l of magnetic Beads (rpro-Der p 1-Beads) coupled with rpro-Der p1, shaking for 30 seconds, uniformly mixing, adding 19 mu l of PBS (phosphate buffer solution) into 1 mu l of magnetic Beads, uniformly mixing, and counting, wherein the density of the rpro-Der p 1-Beads is 10.35 multiplied by 106/ml; the coupled beads were diluted with low cross-reaction solution to a concentration of 6X 104/ml.
(2) The coupled beads were shaken at 1400rpm for 30 seconds (protected from light) and 50. mu.l/well of the beads were added to a 96-well reaction plate.
(3) Washing: the plate was placed on a magnetic plate washing station and washed three times automatically.
(4) Sample dilution: according to the results of the preliminary experiment, the sample is diluted by 20 times by using a low cross reaction solution, and the sample with the highest concentration of Der p1 sIgE detected by ImmunoCAP in the sample is used as a standard substance to carry out concentration gradient dilution: 1:10, 1:40, 1:160, 1:640, 1:2560, 1:10240, 1: 40960.
(5) Sample adding: 50 mul of diluted sample and standard are added into the wells of the existing magnetic beads, and the low cross reaction solution is added into the blank wells as a control.
(6) The cells were incubated at room temperature for 30 seconds with shaking at 1100rpm and for 1 hour with shaking at 700 rpm.
(7) Washing: the same as the step (3).
(8) Biotin-labeled anti-human IgE was diluted to 1 μ g/ml with sample diluent (1:750 dilution).
(9) 50 μ l of diluted detection antibody was added to each well.
(10) Shaking at 1100rpm for 30 seconds at room temperature and shaking at 700rpm for 30 minutes.
(11) Washing: the same as the step (3).
(12) The SA-PE (100X) was diluted to 1X concentration with the sample diluent, 50. mu.l of the diluted SA-PE was added to each well, and incubated at room temperature for 30 seconds with shaking at 1100rpm in the dark and for 15 minutes with shaking at 700 rpm.
(13) Washing: the same as the step (3).
(14) The beads were resuspended in 125. mu.l of sample diluent per well and the machine tested after shaking at 1100rpm on a plate shaker for 1 minute.
The results of detection of Der P1 sIgE from 19 sera, using the detection result of ImmunoCAP as a control, are shown in table 3 and fig. 8, where the fluorescence values of the liquid phase chip and the converted values of sIgE concentration were significantly correlated with the ImmunoCAP results, and the correlation coefficients were 0.939, P <0.001 and 0.800, and P <0.005, respectively.
TABLE 3 result of detecting human serum Der p1 sIgE by using Luminex liquid phase chip method for pro-Der p1
Sequence listing
<110> Guangzhou university of medical science
<120> dermatophagoides pteronyssinus I allergen pro-Der p1 recombinant protein, and preparation method and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 999
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctcgagatga agatcgtgct ggctatcgct agcttgttgg cgttgtccgc tgtgtacgct 60
cgcccttcct ccatcaagac cttcgaggag tacaagaagg ctttcaacaa gtcctacgct 120
accttcgagg acgaggaggc tgcccgtaaa aacttcctgg agtctgtgaa gtacgtgcaa 180
tccaacggtg gtgccatcaa ccacctgtcc gacctgtccc tggacgagtt caagaaccgc 240
ttcttgatgt ccgctgaggc tttcgagcac ctgaagacac agttcgacct gaacgctgag 300
accaacgctt gttccatcaa cggtaacgct cctgccgaaa tcgacctgag acagatgcgc 360
accgtgaccc ctattcgtat gcaaggcggc tgcggctcct gctgggcttt ctctggtgtg 420
gctgctactg agtccgcata cctggcttac cgtaaccagt ccttggacct ggccgagcag 480
gagttggtgg actgcgcgtc ccagcacggt tgtcacggtg ataccatccc tcgtggtatc 540
gagtacattc agcacaacgg tgtggtgcag gagagctact accgctacgt tgcacgcgag 600
cagagttgcc gtaggccaaa cgctcagagg ttcggtattt ccaactactg ccaaatctac 660
cctcccaacg tcaacaagat cagggaggca ctggcccaga cccactccgc tatcgcagtc 720
atcattggta tcaaggacct ggacgcattc cgccactacg acggtcgcac catcatccaa 780
cgcgacaacg gctaccagcc caactaccac gctgtgaaca tcgtgggtta cagtaacgcc 840
cagggtgtgg actactggat cgtgcgcaac tcctgggaca ccaactgggg tgacaacggt 900
tacggctact tcgccgctaa catcgacctg atgatgattg aggagtaccc atacgtggtg 960
attctgggtt ctcatcatca ccaccaccac taaggtacc 999
<210> 2
<211> 25
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atacggacct ttaattcaac ccaac 25
<210> 3
<211> 25
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
acccgtgcgt tttattctgt ctttt 25
<210> 4
<211> 24
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccggctcgta tgttgtgtgg aatt 24
<210> 5
<211> 25
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atgtggacaa aatacctggt taccc 25
Claims (9)
1. A house dust mite group I allergen pro-Der p1 recombinant protein is characterized in that the pro-Der p1 gene sequence has optimized insect codons and is coupled with a His protein sequence at the 3' end, and the sequence is shown as SEQ ID NO: 1 is shown.
2. A recombinant plasmid containing a P.dermatophagoides I allergen pro-Der p1 gene is characterized in that a pro-Der p1 recombinant gene sequence which has optimized insect codons and is 3' end coupled with a His protein sequence is inserted into a shuttle vector based pFastBac by utilizing Xho I and KpnI enzyme cleavage sitesTMIn Dual-engineered pFastBac-SCUVI, a pro-Der p1 recombinant plasmid was obtained.
3. A recombinant baculovirus plasmid comprising the recombinant plasmid of claim 2, wherein the pro-Der p1 recombinant plasmid is transformed into DH10Bac strain to obtain a recombinant baculovirus plasmid Bacmid-Der p 1.
4. An expression vector comprising the recombinant baculovirus plasmid of claim 3, wherein the recombinant baculovirus plasmid Bacmid-Der p1 is transfected into Sf9 cells to obtain a pro-Der p1 expression vector.
5. A preparation method of a dermatophagoides pteronyssinus I allergen pro-Der P1 recombinant protein is characterized by synthesizing a pro-Der P1 gene sequence which is provided with an optimized insect codon and is connected with a His protein gene sequence and is shown in SEQ ID NO.1, connecting the pro-Der P1 gene sequence to a shuttle vector pFastBacac-SCUVI through Xho I and KpnI enzyme cutting sites, obtaining Bacmid through transforming DH10Bac competent cells, then transfecting Sf9 insect cells to prepare recombinant baculovirus, infecting Sf9 cells with P4 generation recombinant baculovirus, and centrifuging to collect supernatant.
6. The method for preparing a recombinant protein pro-Der p1, a group I allergen of house dust mite, according to claim 5, wherein said collected supernatant is filtered through a 0.45um filter; loading the filtrate on a His chromatography column, eluting the filtrate with 50mM, 100mM and 200mM imidazole respectively; running SDS-PAGE gel on the eluate to obtain a pure pro-Der p1 band with a size of about 34 kD; and concentrating the eluent by using an ultrafiltration membrane package and performing PBS replacement to obtain the purified pro-Der p1 recombinant protein resuspended by PBS.
7. Use of the recombinant protein of the group I allergen pro-Der p1 of house dust mite, as defined in claim 1, for the preparation of a diagnostic agent or a desensitizing therapeutic biological product for the detection of allergic diseases caused by house dust mites.
8. Use of the recombinant protein of the group I allergen pro-Der p1 of house dust mite, according to claim 1, for the preparation of a diagnostic reagent or a biological product for the detection of house dust mites.
9. Use of the recombinant protein of the group I allergen pro-Der p1 of house dust mite, according to claim 1, in a method for the detection of house dust mites.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111121774.6A CN113846115B (en) | 2021-09-24 | 2021-09-24 | Recombinant protein of house dust mite I allergen pro-Der p1, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111121774.6A CN113846115B (en) | 2021-09-24 | 2021-09-24 | Recombinant protein of house dust mite I allergen pro-Der p1, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113846115A true CN113846115A (en) | 2021-12-28 |
| CN113846115B CN113846115B (en) | 2023-10-17 |
Family
ID=78979214
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111121774.6A Active CN113846115B (en) | 2021-09-24 | 2021-09-24 | Recombinant protein of house dust mite I allergen pro-Der p1, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113846115B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115724995A (en) * | 2022-08-24 | 2023-03-03 | 吉林大学第一医院 | Der p1 fusion protein and application thereof |
| CN117298297A (en) * | 2023-09-26 | 2023-12-29 | 广州医科大学附属第一医院（广州呼吸中心） | Dust mite nose excitation kit and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101318017A (en) * | 2007-06-05 | 2008-12-10 | 中国农业大学 | Vaccine for preventing and/or treating allergic asthma |
| CN108034006A (en) * | 2012-01-13 | 2018-05-15 | 乌利班-马克西姆利安大学 | The difunctional complementation of double antigen inductions |
| CN108265056A (en) * | 2016-12-31 | 2018-07-10 | 江苏众红生物工程创药研究院有限公司 | A kind of recombination 1 allergoid albumen of dermatophagoides pteronyssinus and its preparation method and application |
| CN110624101A (en) * | 2018-06-22 | 2019-12-31 | 江苏众红生物工程创药研究院有限公司 | Recombinant dermatophagoides farinae allergen protein medicine mixture and application thereof |
-
2021
- 2021-09-24 CN CN202111121774.6A patent/CN113846115B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101318017A (en) * | 2007-06-05 | 2008-12-10 | 中国农业大学 | Vaccine for preventing and/or treating allergic asthma |
| CN108034006A (en) * | 2012-01-13 | 2018-05-15 | 乌利班-马克西姆利安大学 | The difunctional complementation of double antigen inductions |
| CN108265056A (en) * | 2016-12-31 | 2018-07-10 | 江苏众红生物工程创药研究院有限公司 | A kind of recombination 1 allergoid albumen of dermatophagoides pteronyssinus and its preparation method and application |
| CN110624101A (en) * | 2018-06-22 | 2019-12-31 | 江苏众红生物工程创药研究院有限公司 | Recombinant dermatophagoides farinae allergen protein medicine mixture and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| YUBAO CUI 等: "Expression of recombinant allergen, Der f 1, Der f 2 and Der f 4 using baculovirus-insect cell systems", ARCH MED SCI, pages 1348 - 1354 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115724995A (en) * | 2022-08-24 | 2023-03-03 | 吉林大学第一医院 | Der p1 fusion protein and application thereof |
| CN115724995B (en) * | 2022-08-24 | 2024-02-13 | 吉林大学第一医院 | Der p 1 fusion proteins and uses thereof |
| CN117298297A (en) * | 2023-09-26 | 2023-12-29 | 广州医科大学附属第一医院（广州呼吸中心） | Dust mite nose excitation kit and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113846115B (en) | 2023-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113846115B (en) | Recombinant protein of house dust mite I allergen pro-Der p1, and preparation method and application thereof | |
| CN107543923B (en) | Kit for detecting avian leukosis virus A/B/J subgroup specific antibody and detection method thereof | |
| US10766949B2 (en) | Method for preparing whole bovine-derived broadly neutralizing antibody against serotype O foot-and-mouth disease virus | |
| CN108226494B (en) | Porcine reproductive and respiratory syndrome virus E L ISA antibody detection kit | |
| US11505834B2 (en) | Method for detecting Brucella infection and application thereof | |
| KR102136695B1 (en) | Method for pathogen enrichment and nucleic acid extract using device for point of care testing | |
| CN111574631A (en) | Antibodies, conjugates and detection kits for thioredoxin | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN110568178A (en) | Zika virus NS1 antigen and application thereof in preparation of fluorescent immunochromatography reagent | |
| CN111044728B (en) | IgM antibody colloidal gold test strip for rapidly detecting adenovirus and preparation method thereof | |
| CN111500780A (en) | Kit for detecting novel coronavirus and preparation method thereof | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| CN111518225B (en) | Application of lipopolysaccharide extracted from Brucella melitensis vaccine strain M5 in preparation of products for diagnosing human brucellosis | |
| CN110272898B (en) | Universal microbial pathogen lysate and application thereof | |
| CN112129952B (en) | Chemiluminescent kit for detecting human soluble CD14 | |
| CN107151672B (en) | Recombinant plasmid and application thereof | |
| CN113249335B (en) | Hybridoma cell strain secreting anti-Abeta 1-42 monoclonal antibody and application thereof | |
| CN114295829A (en) | Novel coronavirus antigen and total antibody combined detection kit and detection method | |
| CN113322268A (en) | African swine fever virus p72 recombinant protein and colloidal gold immunochromatographic test paper constructed by same | |
| CN113817032A (en) | Natural antigen P1 for detecting anti-mycoplasma pneumoniae antibody and preparation method and application thereof | |
| CN101086498A (en) | Immunological magnetic bead for melon bacterial fruit spot disease and its preparation method | |
| CN113391074A (en) | Up-converting luminescent particle detection card for cysticercosis cellulosae, preparation method and application thereof | |
| CN112941212A (en) | Universal primer group, kit and method for on-site detection of brucella | |
| CN111830263A (en) | Establishment method of mycoplasma ovipneumoniae indirect hemagglutination detection method | |
| CN110763838A (en) | Immunofluorescence reagent for detecting bovine parainfluenza virus type 3 and detection kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |