CN110004247B - SSR kit for rapidly identifying poppy - Google Patents
SSR kit for rapidly identifying poppy Download PDFInfo
- Publication number
- CN110004247B CN110004247B CN201910362343.5A CN201910362343A CN110004247B CN 110004247 B CN110004247 B CN 110004247B CN 201910362343 A CN201910362343 A CN 201910362343A CN 110004247 B CN110004247 B CN 110004247B
- Authority
- CN
- China
- Prior art keywords
- poppy
- primer
- species
- primers
- ssr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SSR kit for rapidly identifying poppy, and relates to the technical field of molecular identification. The SSR kit comprises a set of molecular markers for detecting poppy and related species thereof, a PCR amplification reagent and a capillary electrophoresis detection reagent. The set of molecular markers for detecting poppy and related species thereof comprises M13 common fluorescent primers and 3 specific primer groups; the PCR amplification reagent comprises 2 xTaq PCR Master Mix and ddH2O; the capillary electrophoresis detection reagent comprises HI-DI FORMAMIDE BOTTLE and LIZ 500. The kit is used for identifying the poppy plants of the same species, genus, family and other species. Compared with the prior art, the method has higher species specificity and higher accuracy in identifying the poppy and the kindred plants thereof.
Description
Technical Field
The invention relates to the technical field of molecular identification, in particular to an SSR kit for quickly identifying poppy.
Background
Poppy (Papaver somniferum L.) is an annual herb of the Papaveraceae (Papaveraceae) poppy genus (Papaver L.) and is the main raw material for the preparation of opium, the extract of which is the source of various sedatives such as morphine, thebaine, codeine, papaverine and narcotine. Poppy together with hemp and coca is listed as the three main drug plants in the world under the banned convention of the united nations. Poppy belongs to about 100 species, mainly produced in the temperate regions of central europe, south europe to asia, and a few species produced in america, oceania, and south africa. There are 7 varieties 3 and 3 variants in our country, which are poppy (p. somniferum L.), poppy (Papaver orientale L.), poppy (Papaver rhoeas L.), poppy (Papaver fisch. et. Mey.), poppy (Papaver nuciferum L.), poppy (Papaver glauces a. tome.), poppy (Papaver radiata rot. Rottb.), poppy (Papaver nuciferum bur. aquilegungi.), poppy (Papaver glauces. butterbur. X.J.), poppy (Papaver nuciferum. austral. X.J.), poppy (Papaver rup. pacifica. and Papaver. blackpy). It is mainly distributed in the northeast and northwest areas of China. Poppy plants are rich in flower types and bright in color, and are often used as ornamental plants. The poppy in the seedling stage is similar to various closely related species and is extremely difficult to distinguish. After the seedling is formed, the flower type is most similar to that of Yu Mei and ghost Papaver somniferum. The similarity of phenotype between closely related species presents difficulties in the identification of poppy and the detection of related cases.
The simple repeat Sequence SSR (simple Sequence repeats) marker is an oligonucleotide Sequence formed by the repeated series connection of 1-8bp core sequences, and is a molecular marker technology based on the development and the comparison of mature specific primer PCR. Based on the poppy EST sequence in NCBI and the second generation sequencing technology, the SSR sites in the poppy genome are developed in large quantities, and a foundation is laid for the application of SSR markers in the research of poppy. The study of genetic diversity in and among poppy species shows that there are abundant genetic variations in poppy species, and that the phenotypic variations of rich flower color, flower type and pod number are also evidence of this. The identification of poppy involves both interspecies variability and intraspecies conservation. Compared with other molecular markers, the SSR marker has the advantages of abundant polymorphism, wide site coverage of genome, simple fragment, easy and stable amplification, automatic detection and the like, is very suitable for identification of species, and is widely applied to individual identification and paternity identification in court scientific practice at present.
The invention content is as follows:
the invention aims to provide an SSR kit for rapidly identifying poppy.
The purpose of the invention is realized as follows:
the M13 common fluorescent primer and 3 specific primer sets were used to detect the poppy and the specific combination of amplified fragments unique to poppy was found as the differential fragments of poppy from other closely related plants, from which the specific combination of fragments distinguished poppy and its closely related species. The method improves the accuracy of identifying the poppy species, avoids the interference of closely related species, and is a method for accurately, quickly and reliably identifying the poppy and the closely related species thereof.
Specifically, the method comprises the following steps:
SSR kit for quickly identifying poppy
The SSR kit for rapidly identifying poppy comprises a set of molecular markers for detecting poppy and related species thereof, a PCR amplification reagent and a capillary electrophoresis detection reagent.
1. Set of molecular markers for detecting poppy and related species thereof
The primer comprises M13 public fluorescent primers and 3 specific primer groups, and the primer sequences are as follows:
M13：GTAAAACGACGGCCAGT；
P1F：GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R：CTCTGCACGATGAAGCTGAC；
P2F：GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R：AATCCTCGGCTGAGCTTACA；
P3F：GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R：CAGGACCTCTCCTTGCAAAA；
the specific fragment combinations for differentiating poppy and its related species are:
a combination of segments comprising segment sizes of 166-168, 256-258 and 318-320;
combination two, including the segment sizes of 166-;
the primers are subpackaged in a kit, and the primers F and R in the primer pair are mixed according to the molar ratio of 1: 20, mixing;
the primer pair P1, the primer pair P2 and the primer pair P3 in the primer pair are mixed according to a molar ratio of 2: 2: 3, mixing;
the molar ratio of the M13 public fluorescent primer to the sum of the contents of the R primers in the three primer pairs was 3: 5;
the primer M13 in the primer is marked with a fluorescent group.
2. PCR amplification reagent
Including 2 XTaq PCR Master Mix, ddH2O。
3. Capillary electrophoresis detection reagent
Including HI-DI FORMAMIDE BOTTLE and LIZ 500.
Second, identification method of poppy by SSR kit for rapidly identifying poppy
Using the 3 primer pairs and the M13 public fluorescent primer, Touchdown program was used: denaturation at 94 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 30s, and performing 15 cycles, wherein the annealing temperature is reduced by 1 ℃ in each cycle; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 72 ℃ for 30s, and performing 18 cycles of extension at 72 ℃ for 10 min; carrying out PCR amplification on sample DNA, and identifying the poppy species according to the following specific fragment combinations with different lengths, wherein the different specific fragment combinations of the poppy are respectively as follows:
a combination of segments comprising segment sizes of 166-168, 256-258 and 318-320;
and the second combination comprises the segments with the segment sizes of 166-.
If the combined fragment is consistent with any one of the combined fragments listed above, the sample to be detected is the poppy;
if the combinations do not match the combinations listed above, the sample to be tested is not poppy.
In order to achieve the purpose, the invention adopts the following technical measures:
the applicant downloads the whole sequence of poppy genome and EST from NCBI, excavates SSR sites of different repeat units and designs primers; carrying out PCR amplification on poppy and related species thereof by using a designed and synthesized primer, and screening sites with stable amplification, strong specificity, fragment size of between 100 and 350bp and fragment size difference of 20-60bp to form a specific primer group; the cost is effectively reduced by using the M13 joint of the fluorescent marker in the PCR amplification, and the reaction condition is optimized by using a Touch down program, so that the PCR amplification efficiency is improved.
Application of SSR kit for rapidly identifying poppy in poppy species specificity identification
The kit is used for identifying the poppy plants of the same species, genus, family and other species.
Compared with the prior art, the invention has the following advantages and positive effects:
1. the invention fully considers the abundant variation of the same species, the same genus and the same family of poppy, comprehensively collects individuals with different colors, patterns and production places in the poppy species and closely related species of the same genus and the same family of poppy, and compared with SSR sites which are conserved in the poppy species but have interspecific and intergeneric specificities, the SSR sites can reflect the difference of the poppy and the closely related species thereof, have higher specificity and ensure that the accuracy of identifying the poppy is stronger.
2. The invention uses the M13 public fluorescent primer, thereby effectively reducing the detection cost of the sample.
In conclusion, the present invention has higher species specificity and higher accuracy in identifying poppy and its closely related species.
Drawings
FIG. 1 is a combined peak diagram for rapid identification of SSR-specific fragments of poppy seeds.
FIG. 2 is a comparison graph of fragment peaks before and after optimization of SSR amplification conditions;
a: fragment peak diagram before SSR amplification condition optimization;
b: and (5) a fragment peak image after the SSR amplification condition is optimized.
FIG. 3 is a peak image of SSR-amplified fragment of a closely related species of opium poppy;
a: peak diagram of SSR amplified fragment of poppy;
b: poppy genus poppy SSR amplified fragment peak diagram;
c: and (3) a peak diagram of an SSR amplified fragment of the poppy papaver nigra of poppy.
FIG. 4: peak images of SSR amplified fragments of other species of Papavera;
a: peak diagram of SSR amplified fragment of wild opium poppy of poppy genus;
b: SSR amplified fragment peak diagram of poppy genus origanum maoshance;
c: peak diagram of SSR amplified fragment of Papaver ascyron of Papaver;
d: peak diagram of SSR amplified fragment of Papaveris genus Argemone nigromaculata;
e: and (3) a peak diagram of an SSR amplified fragment of the poppy genus Changbai mountain.
Detailed Description
The following detailed description is made with reference to the accompanying drawings and examples:
the technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, unless otherwise specified, are commercially or publicly available.
First, example 1
SSR specific molecular marker screening and optimization for poppy identification
1. The applicant downloads the whole sequence of poppy genome and EST from NCBI, excavates SSR sites of different repeat units and designs primers; carrying out PCR amplification on poppy and related species thereof by using a designed and synthesized primer, and screening sites with stable amplification, strong specificity, fragment size of between 100 and 350bp and fragment size difference of 20-60bp to form a specific primer group; the use of fluorescently labeled M13 linkers in PCR amplification is effective in reducing cost.
The sequence of the specific primer group obtained by screening is as follows:
M13：GTAAAACGACGGCCAGT；
P1F：GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R：CTCTGCACGATGAAGCTGAC；
P2F：GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R：AATCCTCGGCTGAGCTTACA；
P3F：GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R：CAGGACCTCTCCTTGCAAAA。
2. the primer combination amplification is carried out by using the M13 adaptor labeled by fluorescence, the difference of the lengths of the primers is large, so that the difference of Tm values is large, and the conventional reaction condition of setting single annealing temperature cannot take the amplification specificity and the amplification efficiency into consideration; optimizing reaction conditions by using a Touch down program; and (3) optimizing the reaction conditions: denaturation at 94 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 30s, and performing 15 cycles, wherein the annealing temperature is reduced by 1 ℃ in each cycle; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s, for 18 cycles, and extension at 72 ℃ for 10 min.
3. In the primer combination amplification, different primer pairs have differences of amplification efficiency and amplification advantages, so that the amplification results have the conditions of amplification imbalance and loss of amplification sites; and (2) optimizing the mixing proportion of the SSR amplification primer groups by taking poppy genome DNA as a template, wherein the mixing proportion of the optimized 3 SSR composite amplification primer pairs P1, P2 and P3 is 2: 2: 3.
before and after optimization, as shown in FIG. 2, the problems of abnormal amplification, loss of amplification sites, low amplification efficiency and the like occur before the reaction conditions and the primer set mixing ratio are optimized; after optimization, the amplification efficiency is improved, and the amplification specificity and stability are enhanced.
Second, example 2
Application of SSR specific primer group in poppy species specificity identification
1. Papaver somniferum and related species plant sample Collection
At an intra-species level, poppy samples were provided from relevant units such as Wuhan botanical garden, first institute of public Security department, academy of sciences of China, where the locations of origin were: wuhan Hubei, Dulbert Mongolian autonomous county, Lizee Shandong, Changqing Shandong and Burma; also, the poppy samples collected contained individuals with variations in flower color (red, pink, purple, white, etc.), flower type (single and double), and pod number (single and multiple).
At the interspecies level, samples of 7 and 2 variants of the poppy genus were collected, each species collecting as many individuals as possible in different populations within its distribution.
On the level of the internationary plants in the family, plant samples which are the same as the poppy but different from the genus are selected from the plants of the family consisting of Eschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschnik, Chelidonium majus, corydalis incisium and Paeonia suffruticosa.
Other materials selected from rape, hemp, herba Epimedii, tea, fructus Actinidiae chinensis, herba Menthae and wild sesame.
The leaves were collected from the above materials and stored in silica gel. Materials and sample sources are shown in table 1.
TABLE 1 sources of poppy and related species of the same genus
2. Extraction of genomic DNA
Genomic DNA of each of the plant leaves was extracted by the CTAB method.
3. PCR amplification reaction
The DNA concentration was measured by an ultraviolet spectrophotometer (UV-VIS spectrophotometer (TU-1800)), and the DNA was finally diluted to a final concentration of 1 ng/. mu.L for further use.
PCR amplification was performed using the following primer pairs:
m13 public fluorescent primer: GTAAAACGACGGCCAGT, respectively;
P1F：GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R：CTCTGCACGATGAAGCTGAC；
P2F：GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R：AATCCTCGGCTGAGCTTACA；
P3F：GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R：CAGGACCTCTCCTTGCAAAA。
the PCR amplification system is 20 μ L system, which comprises 3.0 μ L total DNA, 10.0 μ L2 XTaq PCRMaster Mix, and 0.3 μ L M13 primer; total primer F0.025. mu.L, total primer R0.5. mu.L, ddH2O6.2 μ L; the total primers F and R respectively comprise primers F and R in a primer pair P1, a primer pair P2 and a primer pair P3, and the ratio of the three primer pairs is 2: 2: 3.
the PCR amplification conditions were: denaturation at 94 ℃ for 4min, 1 cycle; denaturation at 94 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 30s, and performing 15 cycles, wherein the annealing temperature is reduced by 1 ℃ in each cycle; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 72 ℃ for 30s, 18 cycles, extension at 72 ℃ for 10min, and storage at 4 ℃.
4. Amplification product detection
After diluting the amplification product 1000-fold, the mixture was diluted with HI-DI FORMAMIDE BOTTLE and LIZ500 at a volume ratio of 1: 9: 0.03, and detected by capillary electrophoresis using a 3730 genetic analyzer.
5. Fragment alignment
Identifying the poppy species according to the following specific fragment combinations of different lengths, wherein the specific fragment combinations of poppy are respectively as follows:
a combination of segments comprising segment sizes of 166-168, 256-258 and 318-320; and the second combination comprises the segments of 166-. The amplified fragment combinations comprise either of two combinations, i.e., the poppy sample (FIG. 1).
Other closely related species amplified fragment combinations are as follows:
the amplified fragment combination of the poppy was: 250-252, 358-360, 365-367 or 250-252, 337-339, 358-360 (FIG. 3 a);
the amplified fragment combinations of corn poppy were: 250, 266, 268, 365, 367 (FIG. 3 b);
the amplified fragment combination of the black poppy comprises: 250-;
other Papaveris species such as wild poppy, wild poppy of origanum majorana, poppy of glaucescens, black cyclopoppy, and poppy of Changbai mountain (fig. 4); other species of Papaveraceae, such as Eschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschschscholtz, Chelidonium majus, Hepu peony; and no effective specific amplified fragment is obtained from rape, hemp, epimedium, tea, kiwi fruit, mint and wild sesame of other species.
The above results show that: the primers and method of the invention can specifically detect poppy and distinguish it from closely related species.
Sequence listing
<110> Wuhan plant garden of Chinese academy of sciences
<120> SSR kit for rapidly identifying poppy
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtaaaacgac ggccagt 17
<210> 2
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gtaaaacgac ggccagttgg tatcgatcct tgaagcc 37
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctctgcacga tgaagctgac 20
<210> 4
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gtaaaacgac ggccagtcct tcgactaagg ttcacgc 37
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aatcctcggc tgagcttaca 20
<210> 6
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtaaaacgac ggccagtaaa gggaaagaag ctccgtc 37
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
caggacctct ccttgcaaaa 20
Claims (2)
1. An SSR kit for rapidly identifying poppy comprises a set of molecular markers for detecting poppy and related species thereof;
the method is characterized in that:
the set of molecular markers for detecting poppy and its related species comprises M13 public fluorescent primers and 3 specific primer pairs, and the primer sequences are as follows:
M13：GTAAAACGACGGCCAGT；
P1F：GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R：CTCTGCACGATGAAGCTGAC；
P2F：GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R：AATCCTCGGCTGAGCTTACA；
P3F：GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R：CAGGACCTCTCCTTGCAAAA；
the specific fragment combinations for differentiating poppy and its related species are:
the combination of one, including the fragments with the sizes of 166-;
the second combination comprises fragments with the fragment sizes of 166-168bp, 256-258bp and 321-323 bp;
the primers are subpackaged in a kit, and the primers F and R in the primer pair are mixed according to the molar ratio of 1: 20, mixing; the primer F guide P1F, P2F, and P3F; the primer R guides P1R, P2R, and P3R; the primer pairs are P1F and P1R, P2F and P2R, P3F and P3R; the primer pair P1, the primer pair P2 and the primer pair P3 in the primer pair are mixed according to a molar ratio of 2: 2: 3, mixing; the primer pair P1 comprises primers P1F and P1R, the primer pair P2 comprises primers P2F and P2R, and the primer pair P3 comprises primers P3F and P3R; the molar ratio of the M13 public fluorescent primer to the sum of the contents of the R primers in the three primer pairs was 3: 5;
the primer M13 in the primer is marked with a fluorescent group.
2. The method for identifying poppy by using SSR kit for rapidly identifying poppy according to claim 1, which is characterized in that:
using the 3 primer pairs and the M13 public fluorescent primer, Touchdown program was used: denaturation at 94 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 30s, and performing 15 cycles, wherein the annealing temperature is reduced by 1 ℃ in each cycle; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 72 ℃ for 30s, and performing 18 cycles of extension at 72 ℃ for 10 min; carrying out PCR amplification on sample DNA, and identifying the poppy species according to the following specific fragment combinations with different lengths, wherein the different specific fragment combinations of the poppy are respectively as follows:
the combination of one, including the fragments with the sizes of 166-;
the second combination comprises fragments with the fragment sizes of 166-168bp, 256-258bp and 321-323 bp;
if the combined fragment is consistent with any one of the combined fragments listed above, the sample to be detected is the poppy;
if the combinations are not consistent with the combinations listed above, the sample to be tested is not poppy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910362343.5A CN110004247B (en) | 2019-04-30 | 2019-04-30 | SSR kit for rapidly identifying poppy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910362343.5A CN110004247B (en) | 2019-04-30 | 2019-04-30 | SSR kit for rapidly identifying poppy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110004247A CN110004247A (en) | 2019-07-12 |
| CN110004247B true CN110004247B (en) | 2022-04-26 |
Family
ID=67175397
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910362343.5A Active CN110004247B (en) | 2019-04-30 | 2019-04-30 | SSR kit for rapidly identifying poppy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110004247B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005216B (en) * | 2021-03-23 | 2023-04-11 | 公安部物证鉴定中心 | Specific genetic marker composition for identifying poppy and 3 allied species thereof |
| CN113049661B (en) * | 2021-05-27 | 2021-08-10 | 广州市农业科学研究院 | Rice variety identification method and system |
| CN114292952B (en) * | 2022-01-22 | 2023-05-26 | 中国科学院武汉植物园 | SNP molecular marker for identifying poppy and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673930A (en) * | 2015-03-26 | 2015-06-03 | 湖南农业大学 | PCR detection method for poppy |
| KR20180057214A (en) * | 2016-11-22 | 2018-05-30 | 대한민국(관리부서: 행정안전부 국립과학수사연구원장) | Multiplex Primer Set for Simultaneous Identifying Narcotic Poppy Species and Uses Thereof |
| CN108754007A (en) * | 2018-06-01 | 2018-11-06 | 中国科学院昆明植物研究所 | Using SSR molecular marker to the identification method of opium poppy |
-
2019
- 2019-04-30 CN CN201910362343.5A patent/CN110004247B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673930A (en) * | 2015-03-26 | 2015-06-03 | 湖南农业大学 | PCR detection method for poppy |
| KR20180057214A (en) * | 2016-11-22 | 2018-05-30 | 대한민국(관리부서: 행정안전부 국립과학수사연구원장) | Multiplex Primer Set for Simultaneous Identifying Narcotic Poppy Species and Uses Thereof |
| CN108754007A (en) * | 2018-06-01 | 2018-11-06 | 中国科学院昆明植物研究所 | Using SSR molecular marker to the identification method of opium poppy |
Non-Patent Citations (4)
| Title |
|---|
| An economic method for the fluorescent labeling of PCR fragments;Markus Schuelke;《Nature Biotechnology》;20000229;第18卷;第233-234页 * |
| Exploiting Expressed Sequence Tag Databases for the Development and Characterization of Gene-Derived Simple Sequence Repeat Markers in the Opium Poppy (Papaver somniferum L.) for Forensic Applications;Eun Jung Lee等;《Journal Of Forensic Sciences》;20110519;第56卷(第5期);第1131-1135页 * |
| 毒品原植物罂粟与其近缘物种的形态学差异解析;张燕君等;《刑事技术》;20211015;第46卷(第05期);第464-470页 * |
| 罂粟分子遗传标记研究现状及开发前景;王白石等;《中国法医学杂志》;20181231;第33卷(第3期);第273-275页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110004247A (en) | 2019-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110004247B (en) | SSR kit for rapidly identifying poppy | |
| CN108728573B (en) | Fluorescent PCR detection kit for identifying dendrobium officinale and application thereof | |
| CN101654709B (en) | Method for using sts primer to identify ginseng species | |
| CN105779574A (en) | HRM detection method of rice blast resistance gene Pi2 and application thereof | |
| CN110951911B (en) | Tilia EST-SSR primer based on transcriptome as well as screening method and application thereof | |
| CN102277444A (en) | Method for quickly distinguishing grape varieties by random amplified polymorphic deoxyribonucleic acid (RAPD) | |
| CN104450888B (en) | Hemp DNA fluorescent composite amplification systems | |
| KR101286989B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| CN113151567A (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN101440401B (en) | Method for identifying Rhizoma Corydalis Repentis | |
| CN116144819B (en) | SNP molecular marker closely linked with main effect QTL of pumpkin pulp carotenoid and application of SNP molecular marker | |
| KR20100061910A (en) | Specific primers for discriminating rice cultivars, and uses thereof | |
| CN107574257B (en) | Core SSR primer and kit for identifying pea variety and purity | |
| CN113699266B (en) | Hemp SSR molecular marker and application thereof | |
| CN115896331A (en) | SNP molecular marker and dCAPS molecular marker closely linked with eggplant peel color character and application thereof | |
| CN101139605B (en) | Nucleotides sequence, molecule probe and method for identifying zhejiang fritillary variant-dong fritillary | |
| CN105861711B (en) | Opium poppy species specificity genetic marker detection architecture | |
| CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
| CN107385052A (en) | For identifying STR primers and its application of Eucalyptus clone | |
| CN105219848B (en) | For differentiating primer and its application of tapiscia sinensis gender | |
| CN108977570B (en) | Method for identifying 28 good carrot varieties and special primer set thereof | |
| CN110923304B (en) | Molecular marker, primer pair and method for identifying sex of ginkgo biloba | |
| CN102296124B (en) | A kind of RAPD of utilization distinguishes the method for jujube kind fast | |
| CN110343778B (en) | Polymorphic marker primer of camellia variety spring Jiang Gongxia and camellia variety identification method | |
| CN110564886A (en) | Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |