CN114292952B - SNP molecular marker for identifying poppy and application thereof - Google Patents
SNP molecular marker for identifying poppy and application thereof Download PDFInfo
- Publication number
- CN114292952B CN114292952B CN202210075708.8A CN202210075708A CN114292952B CN 114292952 B CN114292952 B CN 114292952B CN 202210075708 A CN202210075708 A CN 202210075708A CN 114292952 B CN114292952 B CN 114292952B
- Authority
- CN
- China
- Prior art keywords
- poppy
- species
- site
- locus
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular identification, and discloses SNP molecular markers for identifying poppy and application thereof. The applicant provides two SNP loci which can be identified independently, judges whether the material to be detected is poppy according to the base type of the specific SNP locus, if the SNP1 of the locus is G/G pure sum locus, the material to be detected is poppy, and if the SNP1 of the locus is A/A pure sum locus or C/C pure sum locus, the material to be detected is other species of poppy genus; if SNP2 at the site is C/C pure sum site, poppy is the species to be tested, and if A/A pure sum site or A/C heterozygous site, poppy is other species of poppy genus. Compared with the prior art, the method is simple to operate, and the accuracy and the efficiency of identification are effectively improved on the basis of reducing the identification cost.
Description
Technical Field
The invention relates to the technical field of molecular identification, in particular to SNP molecular markers for identifying poppy and application thereof.
Background
Papaver (Papaver somniferum L.) is annual herbaceous plant of Papaveraceae (Papaveraceae) Papaver genus (Papaver L.) and is listed as three major drug source plants in the world by the United nationally prohibited convention together with Cannabis sativa. About 100 species of poppy, 7 species of poppy in our country, respectively, poppy (p.somniferumm l.), podophyllum (papaverornitetalel l.), poppy (papaverrheeasl), black-ring poppy (papavervolinum fisher mey), wild poppy (papavernuous aulel), ash Mao Yingsu (papavercanenscens a.tolm.), and Changbai poppy (papaverradutumrottb). Papaver has rich flower shape and bright color, and is often used for ornamental plant cultivation. Because poppy is very similar to poppy of the same genus as corn poppy, ghost poppy and the like in flower, color and fruit, difficulties are brought to identification of the original drug plant poppy and detection of related cases. In forensic science, although poppy can be identified by a chemical analysis method, the method is limited by the growth period of plants, has long chemical detection period, complex operation, higher requirements on instruments and equipment and the like, and increases the difficulty of public security authorities in qualifying and detecting poppy cases.
In recent years EST-SSR markers have been developed and applied to the identification of poppy. In 2018, xu Xiaoyu and the like, 1 pair of self-designed poppy species-specific EST-SSR primers are applied to identify the detection materials of suspected poppy seeds in the case, and a material evidence basis is provided for the qualitative identification of the case. In 2011, lee et al developed 1 pair of EST-SSR marker primers that could be well applied to the identification of native poppy and its closely related species. In 2016 Pei Li et al disclose a poppy species-specific genetic marker detection system comprising 4 primer pair sets for identifying poppy, which simultaneously amplify the poppy 4 STR loci. In 2018, yang Zhiyun achieved identification of poppy SSR molecular markers by 4 pairs of specific primers. In 2019, the research team developed a set of primers containing 3 pairs of specific primers that could effectively identify poppy and its closely related species. However, there are few reports on single nucleotide polymorphism (single nucleotide polymorphisms, SNP) molecular markers in poppy identification.
SNPs refer mainly to DNA sequence polymorphisms at the genomic level due to variation of individual nucleotides. Compared with other molecular markers, SNP has the advantages of large number, wide distribution, stable inheritance, representativeness and the like, and is one of the molecular markers widely used at present. With the rapid development of sequencing technology, the genome sequence of poppy is published, the detection range of SNP molecular markers is enlarged, and a foundation is laid for the application of SNP markers in the research of poppy. Since there are abundant genetic variations in poppy species, identification of poppy should be compatible with both its species-to-species variability and its intra-species conservation. The SNP can accurately identify single nucleotide, and different individuals can be distinguished through slight differences among DNA sequences, and besides, the SNP has the advantages of high analysis speed, easy establishment of standardized operation, suitability for species identification, and wide application to forensic science practice for individual identification and parent identification.
Disclosure of Invention
The object of the present invention is to provide SNP molecular markers for identifying poppy.
It is another object of the present invention to provide the use of SNP molecular markers for the identification of poppy. The method improves accuracy of identification of original drug plant Papaver based on simplicity and high efficiency.
In order to achieve the above purpose, the present invention provides the following technical solutions:
twelve parts of plant material mixed sample DNA of the poppy and related species with morphological differences are sequenced by using GBS technology, and two drug origin plant poppy specific SNP loci are screened by strictly filtering and comparing sequencing data: SNP1 and SNP2;
the primers designed for SNP1 are:
SNP1F：gtacgataccctaggcagacattc
SNP1R：cagttccagctattttagatcg；
the primers designed for SNP2 are:
SNP2F：cagtaccgcctgtgaagact
SNP2R：aatgggatgatgacagaacg。
the two specific SNP molecular markers can be independently used for accurately identifying poppy and related species thereof, if the SNP1 of the species to be detected is G/G pure sum site, the species to be detected is a drug original plant poppy, and if the species to be detected is A/A pure sum site or C/C pure sum site, the species to be detected is other species of poppy genus; if SNP2 at the site is C/C pure sum site, poppy is the species to be tested, and if A/A pure sum site or A/C hybrid sum site, poppy is other species of poppy genus.
The protection of the present invention includes the use of a reagent for detecting the base of poppy genome NC_039359.1_9533221, preferably a primer, in particular SNP1F, in poppy identification: GTACGATACCCTAGGCAGACATTC and SNP1R: CAGTTCCAGCTATTTTAGATCG.
Use of a reagent for detecting the nucleotide sequence nc_029434.1_19785 of the genome of poppy, preferably a primer, in particular SNP2F: CAGTACCGCCTGTGAAGACT and SNP2R: AATGGGATGATGACAGAACG.
The genomic version of poppy described above is Papaver somniferum (asembly ASM357369v 1).
Compared with the prior art, the invention has the following advantages:
the invention fully considers the abundant variation of poppy species of the same species and the same genus, comprehensively collects individuals with different flower colors, flower patterns and producing places in the poppy species, and other species of poppy species distributed in China, compares and screens two poppy specificity SNP loci, and has higher species specificity and higher accuracy in the aspect of identifying the plants of the poppy species and the closely related species thereof.
According to the method, a SNP molecular marker method is used, two pairs of self-designed specific primers are used for respectively carrying out PCR amplification on plant sample DNA to be detected, and sequencing is carried out on the amplified products, so that an identification result can be directly obtained through the genotype of SNP loci in a sequencing result. The method has simple operation and short period, and can effectively improve the identification efficiency and accuracy of original drug plant poppy in drug-arresting work.
Drawings
FIG. 1 poppy specific SNP site identification results.
FIG. 2 specific site SNP1 multiple sequence alignment.
FIG. 3 specific site SNP2 multiple sequence alignment.
Detailed Description
The following detailed description is made with reference to the accompanying drawings and examples:
the technical scheme of the invention is a conventional scheme in the field unless specifically stated; the reagents or materials, unless otherwise specified, are all commercially or publicly available. The genomic version of poppy used in the present invention is Papaver somni ferum (asembly ASM357369v 1).
Sample collection of poppy and related species plants used in the examples:
at intraspecies level, poppy samples are provided by relevant units such as the first institute of public security, the university of China, the Wuhan plantations, and the places of production are respectively: the regions of Hubei Wuhan, heilongjiang Dubert Mongolian county, shandong lotus, shandong Changqing, hubei Xiaozhen and Burmese; and the poppy samples collected contained individuals with variations in flower color (red, pink, purple, white, etc.), flower shape (single and double petals), pod number (single and multiple). At the intrageneric level, samples of 7 species 2 variants of poppy were collected, each species collecting as many individuals as possible in different communities within its distribution area. The leaves were collected from the above materials and stored in silica gel. The materials and sample sources are shown in table 1.
Table 1 poppy and its congeneric closely related species sources
Example 1:
SNP-specific molecular marker screening for poppy identification
1. Extraction of genomic DNA
The DNA of the collected poppy plant sample is extracted by adopting an improved CTAB method, the concentration of the DNA is detected by using an ultraviolet spectrophotometer, and the DNA is diluted into DNA with the final concentration of 1 ng/mu L and is preserved at the temperature of minus 20 ℃ for standby.
2. Digging specific SNP locus of poppy
Part of the individual DNA with the same sample number is selected for mixing, each mixed DNA sample comprising ten different individuals. GBS simplified genome sequencing was performed on 12 poppy and closely related species plant mixed DNA samples (ZWYYS, YS2, MD, YMR, DF, YYS, MGY, HS, CBS, HH, HH2, HM), high quality data was obtained by filtering the sequenced raw data, which was aligned to the poppy genome and mutation detected and annotated. The applicant screens out a large number of SNP loci, but finds that most of the loci have identification falsity, so that the identification result is inaccurate.
Finally, two poppy specific SNP loci are dug, namely SNP1 and SNP2 are respectively named, 250bp upstream and downstream of the SNP loci are selected as candidate sequences, and primers are designed;
the primers designed for SNP1 are:
SNP1F：GTACGATACCCTAGGCAGACATTC
SNP1R：CAGTTCCAGCTATTTTAGATCG
the primers designed for SNP2 are:
SNP2F：CAGTACCGCCTGTGAAGACT
SNP2R：AATGGGATGATGACAGAACG
specific SNP site information:
the sequence containing SNP1 is:
>NC_039359.1_95133221 95132971-95133471
tagatgaccttttaagtgctgggatttcatggacaatcacagataagaagagagtacgataccctaggcagacattcatgaaccgttgtgtgtctctggacaaaggagctccaccacaaagcataaatctcatacggcctccaagaatagatcttatctttttgaaaacaatgacatccagaaaagtcttttccagtccccaagccccaaacaagcttccttctatagcagacaatcgacgtttgtatccgaggttgaaaagttttttggttaatccacccttctcattgacctatataaaaagatatggtccaaacaaaagacacttaacattaaccgcaaccacgcagtcacgaaaataagaaggcgataaaccaactgtaagccccactaaattgtagtcaactcaaacctttttcaacactccgtctcgaacacgatctaaaatagctggaactgctgccataagggtgggcttcaatgcagaggcatctcccaggg
the sequence containing SNP2 is:
>NC_029434.1_19785 19535-20035
caaacaggtctatataacatagaaaagcaggatgtccatgacgtgtacgtgtgggatgcaccaaatcttcattgaattttatttttccgttagaaggagctcgtacatgttctgcagtaccgcctgtgaagactccaccggtatgaaaagttcttaacgttagctgggtccccggttccccaatagattgacccgcaataatacctactgcttctcccaattcgaccagatcaccatgagtggaactccgcccataacataatcggcagatccaagatgtactcctgcaagtaaagggggttcgaatatatattggttgtgctcgaaaagttatgaatcggttgacaagtccaatacctatatcttgatttcgaatggcaatgcaacgcgaacccatatatatatcgtctgctaatacacgaccaattaatgtttggataaaaatacgttctgtcatcatcccatttcgagggctcacagaaataccgcggatggtgccac
the use method of the molecular marker primer is as follows:
(1) Extracting DNA of a sample to be detected;
(2) Specific primers were designed according to the target gene sequence as follows:
SNP1F：GTACGATACCCTAGGCAGACATTC
SNP1R：CAGTTCCAGCTATTTTAGATCGTG
SNP2F：CAGTACCGCCTGTGAAGACT
SNP2R：AATGGGATGATGACAGAACG
(3) Performing PCR amplification on Papaver plant DNA by using the designed primer;
(4) Sequencing the clear amplified product of the electrophoresis band by using an ABI3730XL sequencer;
(5) And comparing the sequencing result with the candidate sequence by using BioEdit software, and judging whether the sample to be tested is a drug original plant poppy according to the base type of the specific SNP locus. Both molecular marker loci can accurately judge poppy.
If SNP1 at the site is G/G pure sum site, the plant poppy is the original drug, and if A/A pure sum site or C/C pure sum site is other species of poppy genus;
if SNP2 at the site is C/C pure sum site, poppy is the species to be tested, and if A/A pure sum site or A/C hybrid sum site, poppy is other species of poppy genus.
Example 2:
application of SNP molecular marker in rapid identification of drug original plant poppy in poppy species identification
1. Extraction of DNA
Genomic DNA of the plant leaves listed in Table 1 above was extracted by CTAB method, wherein the total of 68 strains of poppy and the kindred 195 strains thereof were obtained.
2. PCR amplification
PCR amplification was performed using the DNA extracted in step 1 as a template, using the two pairs of specific primers developed in example 1, respectively. The PCR amplification system was a 30. Mu.L system comprising 1.5. Mu.L of total DNA, 2X Taq PCR Master Mix 15.0.0. Mu.L of SNP1F and SNP1R each 0.75. Mu.L (or 0.75. Mu.L of SNP2F and SNP2R each), ddH 2 O12.0. Mu.L. The amplification conditions for PCR were: denaturation at 94℃for 3min,1 cycle; denaturation at 94℃for 30s, annealing at 55℃for 30s, extension at 72℃for 30s, 30 cycles, extension at 72℃for 5min, and storage at 4 ℃.
3. Sequencing of amplified products
The clear amplified products were sequenced using ABI3730 XL.
4. Multiple sequence alignment
And (3) performing multi-sequence comparison on the sequencing result by using BioEdit software and using the candidate sequence as a reference sequence. Species identification is performed according to the genotype of the PCR amplification product of the species to be detected at SNP1 or SNP2 sites.
The experimental result shows that all samples are amplified by PCR by using primer pairs SNP1F and SNP1R, and sequencing of the amplified products shows that all poppy samples are homozygous G/G at the locus SNP1, and all poppy kindred species are homozygous A/A at the locus SNP 1.
PCR amplification is carried out on all samples by using primer pairs SNP2F and SNP2R, and the sequencing result of the amplified products shows that all poppy samples are homozygous for C/C at the locus SNP2, and all poppy kindred species are homozygous for A/A at the locus SNP 2.
The above results indicate that: the two specific SNP molecular markers can be independently used for accurately identifying poppy and related species, and if the SNP1 at the position is a G/G homozygote site or the SNP2 at the position is a C/C homozygote site, the species to be detected can be determined to be poppy.
Sequence listing
<110> Chinese academy of sciences Wuhan vegetable garden
<120> SNP molecular marker for identifying poppy and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 501
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
tagatgacct tttaagtgct gggatttcat ggacaatcac agataagaag agagtacgat 60
accctaggca gacattcatg aaccgttgtg tgtctctgga caaaggagct ccaccacaaa 120
gcataaatct catacggcct ccaagaatag atcttatctt tttgaaaaca atgacatcca 180
gaaaagtctt ttccagtccc caagccccaa acaagcttcc ttctatagca gacaatcgac 240
gtttgtatcc gaggttgaaa agttttttgg ttaatccacc cttctcattg acctatataa 300
aaagatatgg tccaaacaaa agacacttaa cattaaccgc aaccacgcag tcacgaaaat 360
aagaaggcga taaaccaact gtaagcccca ctaaattgta gtcaactcaa acctttttca 420
acactccgtc tcgaacacga tctaaaatag ctggaactgc tgccataagg gtgggcttca 480
atgcagaggc atctcccagg g 501
<210> 2
<211> 501
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
caaacaggtc tatataacat agaaaagcag gatgtccatg acgtgtacgt gtgggatgca 60
ccaaatcttc attgaatttt atttttccgt tagaaggagc tcgtacatgt tctgcagtac 120
cgcctgtgaa gactccaccg gtatgaaaag ttcttaacgt tagctgggtc cccggttccc 180
caatagattg acccgcaata atacctactg cttctcccaa ttcgaccaga tcaccatgag 240
tggaactccg cccataacat aatcggcaga tccaagatgt actcctgcaa gtaaaggggg 300
ttcgaatata tattggttgt gctcgaaaag ttatgaatcg gttgacaagt ccaataccta 360
tatcttgatt tcgaatggca atgcaacgcg aacccatata tatatcgtct gctaatacac 420
gaccaattaa tgtttggata aaaatacgtt ctgtcatcat cccatttcga gggctcacag 480
aaataccgcg gatggtgcca c 501
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gtacgatacc ctaggcagac attc 24
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cagttccagc tattttagat cg 22
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
Claims (5)
1. Use of a reagent for detecting the nucleotide sequence nc_029434.1_19785 of the genome of poppy, in the identification study of poppy species, said genome version of poppy being Papaver somniferum assembly ASM357369v1, poppy if the species to be detected is G/G pure sum at this site, poppy if it is a/a pure sum site or C/C pure sum site, other species of poppy genus.
2. The use according to claim 1, wherein the agent is a primer.
3. The use according to claim 2, wherein the primer is SNP2F: CAGTACCGCCTGTGAAGACT and SNP2R: AATGGGATGATGACAGAACG.
4. The use according to claim 1, wherein said reagent further comprises a reagent for detecting the nucleotide nc_039359.1_9533221 of the genome of poppy, poppy if the species to be detected is C/C pure and site, poppy if it is a/a pure and site or a/C hybrid site, and other species of poppy.
5. The use according to claim 4, wherein said reagent for detecting the poppy genome nc_039359.1_9533221 base is a primer: SNP1F: GTACGATACCCTAGGCAGACATTC and SNP1R: CAGTTCCAGCTATTTTAGATCG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210075708.8A CN114292952B (en) | 2022-01-22 | 2022-01-22 | SNP molecular marker for identifying poppy and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210075708.8A CN114292952B (en) | 2022-01-22 | 2022-01-22 | SNP molecular marker for identifying poppy and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114292952A CN114292952A (en) | 2022-04-08 |
| CN114292952B true CN114292952B (en) | 2023-05-26 |
Family
ID=80976741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210075708.8A Active CN114292952B (en) | 2022-01-22 | 2022-01-22 | SNP molecular marker for identifying poppy and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114292952B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110004247A (en) * | 2019-04-30 | 2019-07-12 | 中国科学院武汉植物园 | A kind of SSR kit of Rapid identification opium poppy |
| CN110205397A (en) * | 2019-05-23 | 2019-09-06 | 中国科学院武汉植物园 | The EST-SSR method for identifying molecules of E. wushanense T. S. Ying and its easily mixed species |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170159134A1 (en) * | 2015-12-03 | 2017-06-08 | Syracuse University | DNA-Based Method for Forensic Identification of Controlled Substances Using Plant DNA Markers |
-
2022
- 2022-01-22 CN CN202210075708.8A patent/CN114292952B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110004247A (en) * | 2019-04-30 | 2019-07-12 | 中国科学院武汉植物园 | A kind of SSR kit of Rapid identification opium poppy |
| CN110205397A (en) * | 2019-05-23 | 2019-09-06 | 中国科学院武汉植物园 | The EST-SSR method for identifying molecules of E. wushanense T. S. Ying and its easily mixed species |
Non-Patent Citations (3)
| Title |
|---|
| Development of SSR and SNP markers for identifying opium poppy;Yanjun Zhang;《Int J Legal Med》;第135卷(第5期);1261-1271 * |
| Insights into opium poppy (Papaver spp.) genetic diversity from genotyping-by-sequencing analysis.;Hong UVT等;《Sci Rep.》;第12卷(第1期);111 * |
| 罂粟分子遗传标记研究现状及开发前景;王白石等;《中国法医学杂志》;第33卷(第3期);273-275 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114292952A (en) | 2022-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108779459B (en) | Cotton whole genome SNP chip and application thereof | |
| CN113637789B (en) | Wheat stripe rust resistance gene YrTD121 linked KASP molecular marker, primer, kit and application | |
| Yu et al. | Filling gaps with construction of a genetic linkage map in tetraploid roses | |
| CN110241252A (en) | SNP marker for constructing peach DNA fingerprinting combines and application and method | |
| CN113122652A (en) | Application of SNP molecular marker related to wheat grain weight | |
| CN109750118A (en) | SNP molecular marker related to capsicum annuum nuclear sterility and application thereof | |
| Pessoa-Filho et al. | A set of multiplex panels of microsatellite markers for rapid molecular characterization of rice accessions | |
| CN116814673A (en) | Genomic structural variation for regulating and controlling content of soluble solids in tomato fruits, related products and application | |
| Zhang et al. | Development of SSR and SNP markers for identifying opium poppy | |
| CN108220473B (en) | Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker | |
| CN115852022A (en) | Tobacco core SNP marker developed based on whole genome re-sequencing and KASP technology and application thereof | |
| CN117737279A (en) | Cadmium low-accumulation hybrid rice molecular marker, rice mutant OsNramp5 gene, and identification method, application and primer thereof | |
| CN109988863B (en) | EST-SSR (expressed sequence tag-simple sequence repeat) marker for distinguishing different ecotypes of clove and primers used by EST-SSR marker | |
| CN110423747B (en) | Cymbidium SSR primer and application thereof in population genetic diversity analysis | |
| CN115679012B (en) | Chilli whole genome SNP-Panel and application thereof | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN114292952B (en) | SNP molecular marker for identifying poppy and application thereof | |
| CN109022432B (en) | Method for identifying wheat tillering angle character and special primer group thereof | |
| CN115896331A (en) | SNP molecular marker and dCAPS molecular marker closely linked with eggplant peel color character and application thereof | |
| CN115141893A (en) | Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof | |
| CN113897457A (en) | KASP molecular marker linked with wheat stripe rust resistant QTL and application thereof | |
| CN111334597A (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| Ning et al. | The novel developed microsatellite markers revealed potential hybridization among Cymbidium species and the interspecies sub-division of C. goeringii and C. ensifolium | |
| CN117821650B (en) | Taro whole genome SNP-Panel and application thereof | |
| CN112342309B (en) | SNP molecular marker related to cotton flower basal leaf spot character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |