CN110004247A - A kind of SSR kit of Rapid identification opium poppy - Google Patents
A kind of SSR kit of Rapid identification opium poppy Download PDFInfo
- Publication number
- CN110004247A CN110004247A CN201910362343.5A CN201910362343A CN110004247A CN 110004247 A CN110004247 A CN 110004247A CN 201910362343 A CN201910362343 A CN 201910362343A CN 110004247 A CN110004247 A CN 110004247A
- Authority
- CN
- China
- Prior art keywords
- opium poppy
- primer
- species
- ssr
- poppy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SSR kits of Rapid identification opium poppy, are related to molecular identification technical field.This SSR kit includes a set of for detecting the molecular labeling, PCR amplification reagent and capillary electrophoresis detection reagent of opium poppy and its nearly edge species.Described is a set of for detecting the molecular labeling of opium poppy and its nearly edge species, including the public fluorescent primer of M13 and 3 specific primer groups；The PCR amplification reagent includes 2 × Taq PCR Master Mix, ddH2O；The capillary electrophoresis detection reagent includes HI-DI FORMAMIDE BOTTLE and LIZ500.It is of the same race to opium poppy using kit, belong to, equal and other species are identified.Compared with prior art, the present invention has higher species specificity and stronger accuracy rate in terms of identifying opium poppy and its sibling species plant.
Description
Technical field
The present invention relates to molecular identification technical field more particularly to a kind of SSR kits of Rapid identification opium poppy.
Background technique
Opium poppy (Papaver somniferum L.) is Papaveraceae (Papaveraceae) papaver (Papaver L.) one
Year raw herbaceous plant, is the primary raw material for producing opium, extract is morphine, thebaine, codeine, papaverine and coscopin
Etc. the source of a variety of sedatives.Opium poppy is classified as the big mother drug plants in the world three by the United Nations's anti-drug convention together with hemp, coca.
About 100 kinds of papaver, for main product in Central European, southern Europe to Asia temperate zone, a small number of kinds originate in America, Oceania and Africa south.China
There are 7 kind of 3 mutation and 3 modifications, is opium poppy (P.somniferum L.), terrible opium poppy (Papaver orientale L.), anxiety respectively
Beauty (Papaver rhoeas L.), black ring opium poppy (Papaver pavoninum Fisch.et Mey.), wild poppy
(Papaver nudicaule L.), Papaver canescens (Papavercanescens A.Tolm.), Changbai Mountain opium poppy (Papaver
Radicatum Rottb.), light fruit wild poppy (Papaver nudicaule var.aquilegioides), the black ring small-mouthed jar of white flower
Grain (Papaver pavoninum f.album X.J.), comospore wild poppy (Papaver nudicaule f.seticarpum
(P.Y.Fu) H.) and Heisui River opium poppy (Papaver nudicaule f.amurense (Busch) H.).It is distributed mainly on China
Northeast and northwestern.Poppy flower pattern is abundant, and pattern is gorgeous, frequently as cultivation ornamental plant.Seedling stage opium poppy and more
The nearly edge species of kind are all more similar, it is extremely difficult to differentiate.After seedling, flower pattern and the flower pattern of corn poppy and terrible opium poppy are the most similar.Nearly edge
The similitude of phenotype is that the identification of opium poppy and the detection of Related Cases bring difficulty between species.
Simple repeated sequence SSR (Simple Sequence Repeats) label is the core sequence series connection weight by 1-8bp
The multiple oligonucleotide sequence repeatedly formed is a kind of molecular labeling skill based on specific primer PCR for developing comparative maturity
Art.Based on opium poppy est sequence in NCBI and two generation sequencing technologies, the site SSR has obtained a large amount of exploitation in opium poppy genome, is
Application of the SSR marker in papaver research is laid a good foundation.In opium poppy kind and interracial genetic diversity is research shows that small-mouthed jar
There are hereditary variations abundant in grain kind, while the variation of pattern abundant, flower pattern and fruit pod number has also confirmed this in its phenotype
A bit.The otherness that the identification of opium poppy should show its inter-species takes into account the conservative in its kind again.With other molecular labeling phases
Have that rich polymorphism, the extensive covering gene group in site, segment be simple, amplification is easy than, SSR marker and stablize, detection it is automatic
The advantages that change, be very suitable to the identification of species, be widely applied at present forensic science practice in carry out individual identification and
Paternity test.
Summary of the invention:
The object of the present invention is to provide a kind of SSR kits of Rapid identification opium poppy.
The object of the present invention is achieved like this:
Opium poppy is detected using the public fluorescent primer of M13 and 3 specific primer groups, and finds the distinctive amplification piece of opium poppy
Differential fragment of the Duan Zuhe as opium poppy and other kindred plants, thus specific fragment combination is to distinguish opium poppy and its nearly edge object
Kind.The invention improves the accuracy of opium poppy species discrimination, avoids the interference of nearly edge species, is a kind of accurate, quick and reliable mirror
The method of other opium poppy and its nearly edge species.
Specifically:
One, the SSR kit of Rapid identification opium poppy
The SSR kit of Rapid identification opium poppy includes a set of for detecting molecular labeling, the PCR of opium poppy and its nearly edge species
Amplifing reagent and capillary electrophoresis detection reagent.
1, a set of for detecting the molecular labeling of opium poppy and its nearly edge species
Including the public fluorescent primer of M13 and 3 specific primer groups, primer sequence are as follows:
M13:GTAAAACGACGGCCAGT；
P1F:GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R:CTCTGCACGATGAAGCTGAC；
P2F:GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R:AATCCTCGGCTGAGCTTACA；
P3F:GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R:CAGGACCTCTCCTTGCAAAA；
The specific fragment combination for distinguishing opium poppy and its nearly edge species is respectively as follows:
Group unification is the segment of 166-168,256-258 and 318-320 comprising clip size；
Combination two is the segment of 166-168,256-258 and 321-323 including clip size；
The primer is sub-packed in kit, and 1:20 is mixed the primers F in primer pair in molar ratio with R；
2:2:3 is mixed in molar ratio by primer pair P1, primer pair P2 and primer pair P3 in the primer pair；
The molar ratio of R primer content summation is 3:5 in the public fluorescent primer of M13 and three primer pairs；
Primer M13 mark fluorescent group in the primer.
2, PCR amplification reagent
Including 2 × Taq PCR Master Mix, ddH2O。
3, capillary electrophoresis detection reagent
Including HI-DI FORMAMIDE BOTTLE and LIZ500.
Two, identification method of the SSR kit of Rapid identification opium poppy to opium poppy
Using 3 primer pairs and the public fluorescent primer of M13, Touchdown program is used: 94 DEG C of denaturation 30s, 65
DEG C annealing 30s, 72 DEG C of extensions 30s, carry out 15 circulations, 1 DEG C of each cycle annealing temperature reduction；94 DEG C of denaturation 30s, 50 DEG C are moved back
Fiery 30s, 72 DEG C of extension 30s carry out 18 circulations, 72 DEG C of extension 10min；To sample DNA carry out PCR amplification, according to it is following not
The identification of opium poppy species is carried out with the specific fragment combination of length, the different specific fragments combination of opium poppy is respectively as follows:
Group unification is the segment of 166-168,256-258 and 318-320 comprising clip size；
Combination two is the segment of 166-168,256-258 and 321-323 including clip size.
If be consistent with above-mentioned listed any combination segment, which is opium poppy；
If be not consistent with above-mentioned listed combine, which is not opium poppy.
In order to achieve the above object, the present invention takes following technical measures:
Applicant downloads opium poppy genome and EST full sequence from NCBI, excavates the site different repeat units SSR, if
Count primer；The primer synthesized using design carries out PCR amplification to opium poppy and its nearly edge species, and screening amplification stablizes, is specific
By force, clip size is between 100-350bp and clip size differs the site of 20-60bp, forms specific primer group；PCR expands
It is effectively reduced cost in increasing using the M13 connector of fluorescent marker, and carries out the optimization of reaction condition using Touch down program,
Improve PCR amplification efficiency.
Three, application of the SSR kit of Rapid identification opium poppy in the identification of opium poppy species specificity
It is of the same race to opium poppy using kit, belong to, equal and other species are identified.
Compared with prior art, the present invention has the advantages that:
1, the present invention fully takes into account that opium poppy is of the same race, belongs to, the abundant variation of equal species, in comprehensive collection opium poppy kind
Different patterns, flower pattern and the individual in the place of production, and belong to opium poppy, equal nearly edge species, compare and has screened in drugs opium poppy kind
The conservative but site SSR with inter-species, specificity among genus, these sites more can reflect the difference of opium poppy edge species close with its,
With higher specificity, the accuracy for identifying opium poppy is stronger.
2, the present invention uses the public fluorescent primer of M13, effectively reduces the testing cost of sample.
In short, the present invention has higher species specificity and stronger standard in terms of identifying opium poppy and its sibling species plant
True rate.
Detailed description of the invention
Fig. 1 is Rapid identification opium poppy SSR specific fragment combination peak figure.
Fig. 2 is segment peak figure comparison diagram before and after SSR amplified conditions optimization；
Segment peak figure before a:SSR amplified conditions optimization；
Segment peak figure after b:SSR amplified conditions optimization.
Fig. 3 is the nearly edge species SSR amplified fragments peak figure of opium poppy；
A: papaver ghost opium poppy SSR amplified fragments peak figure；
B: papaver corn poppy's SSR amplified fragments peak figure；
C: papaver Heisui River opium poppy SSR amplified fragments peak figure.
Fig. 4: the other species SSR amplified fragments peak figures of papaver；
A: papaver wild poppy SSR amplified fragments peak figure；
B: papaver comospore wild poppy SSR amplified fragments peak figure；
C: papaver Papaver canescens SSR amplified fragments peak figure；
D: the black ring opium poppy SSR amplified fragments peak figure of papaver；
E: papaver Changbai Mountain opium poppy SSR amplified fragments peak figure.
Specific embodiment
It is described in detail with reference to the accompanying drawings and examples:
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field；The reagent or material,
If not otherwise specified, business or disclosed channel are derived from.
One, embodiment 1
The screening of SSR specific molecular marker and optimization for opium poppy identification
1, applicant downloads opium poppy genome and EST full sequence from NCBI, excavates the site different repeat units SSR,
Design primer；The primer synthesized using design carries out PCR amplification to opium poppy and its nearly edge species, and screening amplification stablizes, is specific
By force, clip size is between 100-350bp and clip size differs the site of 20-60bp, forms specific primer group；PCR expands
It is effectively reduced cost in increasing using the M13 connector of fluorescent marker.
Screen the specific primer group sequence obtained are as follows:
M13:GTAAAACGACGGCCAGT；
P1F:GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R:CTCTGCACGATGAAGCTGAC；
P2F:GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R:AATCCTCGGCTGAGCTTACA；
P3F:GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R:CAGGACCTCTCCTTGCAAAA.
2, using the M13 connector of fluorescent marker, primer combination amplification is carried out, primer length differs greatly, and leads to Tm value difference
Different larger, the conventional reaction condition for setting single annealing temperature cannot be considered in terms of the specificity and amplification efficiency of amplification；Use Touch
The optimization of down program progress reaction condition；Reaction condition after optimization: 94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C extend
30s, carries out 15 circulations, and each cycle annealing temperature reduces by 1 DEG C；94 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 30s,
Carry out 18 circulations, 72 DEG C of extension 10min.
3, in primer combination amplification, different primer pairs causes amplification to be tied there are amplification efficiency and the difference of amplification advantage
Occurs the case where amplification inequality, amplification site is lost in fruit；Using opium poppy genomic DNA as template, to SSR amplimer group
Mixed proportion optimizes, and the mixed proportion of 3 SSR composite amplification primer pairs P1, P2 and P3 are 2:2:3 after optimization.
As shown in Fig. 2, before reaction condition and primer sets blend proportion optimization, appearance can not normally expand the comparison of optimization front and back
The problems such as increasing, amplification site are lost, and amplification efficiency is low；After optimization, amplification efficiency is improved, specific amplification and stability enhancing.
Two, embodiment 2
Application of the SSR specific primer group in the identification of opium poppy species specificity
1, opium poppy and its nearly edge species sample collection
In kind in level, opium poppy sample is by relevant units such as Wuhan Botanical Garden, Chinese Acadmey of Sciences, the First Research Institute of Ministry of Public Security
It provides, the place of production is respectively: Hubei Wuhan, Heilungkiang Dorbod Mongol Autonomous County, Heze City, Shandong Province, Shandong Changqing and Burma
Area；Meanwhile collected opium poppy sample is contained in pattern (red, pink colour, purple, white etc.), flower pattern (single-lobe and polyphyll)
And there is the individual of variation on fruit pod number (single and multiple).
In belonging on interspecies level, it is collected into the sample of 7 kinds of 2 modifications of papaver, each species acquire its point as far as possible
Multiple individuals of different populations in cloth area.
Between belonging in section in level, by Chinese Plants will, plant sample that is equal with opium poppy but not belonging to is selected --- flower
Water chestnut grass, greater celandine, japanese hylomecon root, C. incisa and Dicentra spectabilis.
Other materials selects rape, hemp, Herba Epimedii, tea, Kiwi berry, peppermint and white dead nettle.
The above material acquires blade, uses preservation in silica.Material and sample source are shown in Table 1.
1 opium poppy of table and its belong to nearly edge source of species
2, the extraction of genomic DNA
Extract the genomic DNA of above-mentioned plant leaf blade respectively using CTAB method.
3, pcr amplification reaction
DNA concentration is detected with ultraviolet specrophotometer (UV-VIS spectrophotometer (TU-1800)), last dilute
The DNA for being interpreted into final concentration of 1ng/ μ L is spare.
PCR amplification is carried out using following primer pair:
The public fluorescent primer of M13: GTAAAACGACGGCCAGT；
P1F:GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R:CTCTGCACGATGAAGCTGAC；
P2F:GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R:AATCCTCGGCTGAGCTTACA；
P3F:GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R:CAGGACCTCTCCTTGCAAAA.
The amplification system of PCR is 20 μ L systems, and system includes 3.0 μ L, 2 × Taq PCRMaster Mix 10.0 of total DNA
0.3 μ L of μ L, M13 primer；Total primers F 0.025 μ L, total primer R 0.5 μ L, ddH2O 6.2μL；Total primers F and R difference
Including the primers F and R in primer pair P1, primer pair P2 and primer pair P3, the ratio of three primer pairs is 2:2:3.
The amplification condition of PCR are as follows: 94 DEG C of denaturation 4min, 1 circulation；94 DEG C of denaturation 30s, 65 DEG C of annealing 30s, 72 DEG C extend
30s, carries out 15 circulations, and each cycle annealing temperature reduces by 1 DEG C；94 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 30s,
Carry out 18 circulations, 72 DEG C of extension 10min, 4 DEG C of preservations.
4, amplified production detects
After amplified production is diluted 1000 times, with HI-DI FORMAMIDE BOTTLE and LIZ500 with volume ratio 1:9:
0.03 ratio mixing, carries out capillary electrophoresis detection using 3730 genetic analyzers.
5, segment compares
The identification of opium poppy species, the not homospecificity piece of opium poppy are carried out according to the specific fragment combination of following different length
Duan Zuhe is respectively as follows:
Group unification is the segment of 166-168,256-258 and 318-320 comprising clip size；Combination two, including 166-
168, the segment of 256-258 and 321-323.Amplified fragments combination includes any combination in two combinations, is opium poppy sample (figure
1)。
Other nearly edge species amplified fragments combinations are as follows:
The amplified fragments of terrible opium poppy combine are as follows: 250-252,358-360,365-367 or 250-252,337-339,358-
360 (Fig. 3 a)；
The amplified fragments of corn poppy combine are as follows: 250-252,266-268,365-367 (Fig. 3 b)；
The amplified fragments of Heisui River opium poppy combine are as follows: 250-252,337-339,358-360 (Fig. 3 c)；
Other opium poppy species wild poppies, comospore wild poppy, Papaver canescens, black ring opium poppy, Changbai Mountain opium poppy (Fig. 4)；Small-mouthed jar
Grain section other species Eschscholtzia californica, greater celandine, japanese hylomecon root, C. incisa, Dicentra spectabilis；And other species rapes, hemp, excessive sheep
The leaves of pulse plants, tea, Kiwi berry, peppermint and white dead nettle there is no effective specific amplification segment.
The above results show: primer and method of the invention can be with specific detection opium poppy, and it is distinguished with nearly edge species
It opens.
Sequence table
<110>Wuhan Botanical Garden, Chinese Acadmey of Sciences
<120>a kind of SSR kit of Rapid identification opium poppy
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtaaaacgac ggccagt 17
<210> 2
<211> 37
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gtaaaacgac ggccagttgg tatcgatcct tgaagcc 37
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ctctgcacga tgaagctgac 20
<210> 4
<211> 37
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gtaaaacgac ggccagtcct tcgactaagg ttcacgc 37
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aatcctcggc tgagcttaca 20
<210> 6
<211> 37
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gtaaaacgac ggccagtaaa gggaaagaag ctccgtc 37
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
caggacctct ccttgcaaaa 20
Claims (6)
1. a kind of SSR kit of Rapid identification opium poppy, it is characterised in that:
Including a set of molecular labeling, PCR amplification reagent and capillary electrophoresis detection examination for detecting opium poppy and its nearly edge species
Agent.
2. a kind of SSR kit of Rapid identification opium poppy according to claim 1, it is characterised in that:
It is described a set of for detecting the molecular labeling of opium poppy and its nearly edge species, including the public fluorescent primer of M13 and 3 it is special
Property primer sets, primer sequence are as follows:
M13:GTAAAACGACGGCCAGT；
P1F:GTAAAACGACGGCCAGTTGGTATCGATCCTTGAAGCC；
P1R:CTCTGCACGATGAAGCTGAC；
P2F:GTAAAACGACGGCCAGTCCTTCGACTAAGGTTCACGC；
P2R:AATCCTCGGCTGAGCTTACA；
P3F:GTAAAACGACGGCCAGTAAAGGGAAAGAAGCTCCGTC；
P3R:CAGGACCTCTCCTTGCAAAA；
The specific fragment combination for distinguishing opium poppy and its nearly edge species is respectively as follows:
Group unification is the segment of 166-168,256-258 and 318-320 comprising clip size；
Combination two is the segment of 166-168,256-258 and 321-323 including clip size；
The primer is sub-packed in kit, and 1:20 is mixed the primers F in primer pair in molar ratio with R；In the primer pair
2:2:3 is mixed in molar ratio by primer pair P1, primer pair P2 and primer pair P3；The public fluorescent primer of M13 draws with R in three primer pairs
The molar ratio of object content summation is 3:5；
Primer M13 mark fluorescent group in the primer.
3. a kind of SSR kit of Rapid identification opium poppy according to claim 1, it is characterised in that:
The PCR amplification reagent includes 2 × Taq PCR Master Mix, ddH2O。
4. a kind of SSR kit of Rapid identification opium poppy according to claim 1, it is characterised in that:
The capillary electrophoresis detection reagent includes HI-DI FORMAMIDE BOTTLE and LIZ500.
5. the SSR kit based on a kind of Rapid identification opium poppy described in claim 1-4 exists to the identification method of opium poppy, feature
In:
Using 3 primer pairs and the public fluorescent primer of M13, use Touchdown program: 94 DEG C of denaturation 30s, 65 DEG C are moved back
Fiery 30s, 72 DEG C of extension 30s, carry out 15 circulations, and each cycle annealing temperature reduces by 1 DEG C；94 DEG C of denaturation 30s, 50 DEG C of annealing
30s, 72 DEG C of extension 30s carry out 18 circulations, 72 DEG C of extension 10min；PCR amplification is carried out to sample DNA, according to following difference
The specific fragment combination of length carries out the identification of opium poppy species, and the different specific fragments combination of opium poppy is respectively as follows:
Group unification is the segment of 166-168,256-258 and 318-320 comprising clip size；
Combination two is the segment of 166-168,256-258 and 321-323 including clip size；
If be consistent with above-mentioned listed any combination segment, which is opium poppy；
If be not consistent with above-mentioned listed combine, which is not opium poppy.
6. the SSR kit based on a kind of Rapid identification opium poppy described in claim 1-4 is in the identification of opium poppy species specificity
Using:
It is of the same race to opium poppy using kit, belong to, equal and other species are identified.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910362343.5A CN110004247B (en) | 2019-04-30 | 2019-04-30 | SSR kit for rapidly identifying poppy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910362343.5A CN110004247B (en) | 2019-04-30 | 2019-04-30 | SSR kit for rapidly identifying poppy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110004247A true CN110004247A (en) | 2019-07-12 |
| CN110004247B CN110004247B (en) | 2022-04-26 |
Family
ID=67175397
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910362343.5A Active CN110004247B (en) | 2019-04-30 | 2019-04-30 | SSR kit for rapidly identifying poppy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110004247B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005216A (en) * | 2021-03-23 | 2021-06-22 | 公安部物证鉴定中心 | Specific genetic marker composition for identifying poppy and 3 allied species thereof |
| CN113049661A (en) * | 2021-05-27 | 2021-06-29 | 广州市农业科学研究院 | Rice variety identification method and system |
| CN114292952A (en) * | 2022-01-22 | 2022-04-08 | 中国科学院武汉植物园 | SNP molecular marker for identifying poppy and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673930A (en) * | 2015-03-26 | 2015-06-03 | 湖南农业大学 | PCR detection method for poppy |
| KR20180057214A (en) * | 2016-11-22 | 2018-05-30 | 대한민국(관리부서: 행정안전부 국립과학수사연구원장) | Multiplex Primer Set for Simultaneous Identifying Narcotic Poppy Species and Uses Thereof |
| CN108754007A (en) * | 2018-06-01 | 2018-11-06 | 中国科学院昆明植物研究所 | Using SSR molecular marker to the identification method of opium poppy |
-
2019
- 2019-04-30 CN CN201910362343.5A patent/CN110004247B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673930A (en) * | 2015-03-26 | 2015-06-03 | 湖南农业大学 | PCR detection method for poppy |
| KR20180057214A (en) * | 2016-11-22 | 2018-05-30 | 대한민국(관리부서: 행정안전부 국립과학수사연구원장) | Multiplex Primer Set for Simultaneous Identifying Narcotic Poppy Species and Uses Thereof |
| CN108754007A (en) * | 2018-06-01 | 2018-11-06 | 中国科学院昆明植物研究所 | Using SSR molecular marker to the identification method of opium poppy |
Non-Patent Citations (4)
| Title |
|---|
| EUN JUNG LEE等: "Exploiting Expressed Sequence Tag Databases for the Development and Characterization of Gene-Derived Simple Sequence Repeat Markers in the Opium Poppy (Papaver somniferum L.) for Forensic Applications", 《JOURNAL OF FORENSIC SCIENCES》 * |
| MARKUS SCHUELKE: "An economic method for the fluorescent labeling of PCR fragments", 《NATURE BIOTECHNOLOGY》 * |
| 张燕君等: "毒品原植物罂粟与其近缘物种的形态学差异解析", 《刑事技术》 * |
| 王白石等: "罂粟分子遗传标记研究现状及开发前景", 《中国法医学杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005216A (en) * | 2021-03-23 | 2021-06-22 | 公安部物证鉴定中心 | Specific genetic marker composition for identifying poppy and 3 allied species thereof |
| CN113049661A (en) * | 2021-05-27 | 2021-06-29 | 广州市农业科学研究院 | Rice variety identification method and system |
| CN114292952A (en) * | 2022-01-22 | 2022-04-08 | 中国科学院武汉植物园 | SNP molecular marker for identifying poppy and application |
| CN114292952B (en) * | 2022-01-22 | 2023-05-26 | 中国科学院武汉植物园 | SNP molecular marker for identifying poppy and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110004247B (en) | 2022-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110004247A (en) | A kind of SSR kit of Rapid identification opium poppy | |
| CN105925668B (en) | Method for rapidly positioning of the cotton unit point mass gene in chromosome | |
| CN107385071A (en) | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN108660136A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN106011228A (en) | EST-SSR core primer group for identifying variety of Chinese wolfberry and identification method and application thereof | |
| CN109868328A (en) | Identify the SSR molecular marker and application of Cultivar | |
| CN101654709B (en) | Method for using sts primer to identify ginseng species | |
| CN104673790A (en) | Molecular-specificity labeling primer for oil-tea good-variety longlin 18 and identification method | |
| KR101286989B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| CN107574257B (en) | Core SSR primer and kit for identifying pea variety and purity | |
| CN109706262A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN105861711B (en) | Opium poppy species specificity genetic marker detection architecture | |
| CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
| CN105219848B (en) | For differentiating primer and its application of tapiscia sinensis gender | |
| CN107779521A (en) | A kind of DNA bar code and its purposes in muscat is identified | |
| CN113699266A (en) | Hemp SSR molecular marker and application thereof | |
| CN101139605A (en) | Nucleotides sequence, molecule probe and method for identifying zhejiang fritillary variant-dong fritillary | |
| CN102296124A (en) | Method for quickly differentiating Chinese date varieties by using random amplified polymorphic DNA (RAPD) | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN107130034A (en) | A kind of method that utilization SSR marker identifies flat Europe hybrid hazel kind | |
| CN108424975A (en) | Pueraria lobata SSR label primer pair based on the exploitation of transcript profile sequence and its application | |
| CN101457257B (en) | PCR fast identification and distinguish method of plum, apricot and golden plum | |
| CN104762384B (en) | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch | |
| CN111593133B (en) | Method, composition and kit for identifying four kinds of pollen by multiplex fluorescence PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |