CN104762384B - The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch - Google Patents
The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch Download PDFInfo
- Publication number
- CN104762384B CN104762384B CN201510145815.3A CN201510145815A CN104762384B CN 104762384 B CN104762384 B CN 104762384B CN 201510145815 A CN201510145815 A CN 201510145815A CN 104762384 B CN104762384 B CN 104762384B
- Authority
- CN
- China
- Prior art keywords
- branch
- hangs down
- eightfold
- flowering cherry
- cherry cultivars
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to the high Flowering Cherry Cultivars of a pair of specificity " the red branch of eightfold hangs down " and the molecular specificity labeled primers of " rain condition branch hangs down ", and the method that one kind can carry out Rapid identification to Flowering Cherry Cultivars " the red branch of eightfold hangs down " and " rain condition branch hangs down ".The primer sequence is as follows：Sense primer：5′‑TGAGTCCAAACCGGATACTATTC‑3′；Anti-sense primer：5′‑GACTGCGTACGAATTGACATAGTA‑3′.Molecular specificity labeled primers of the present invention can carry out quick Early Identification to Flowering Cherry Cultivars " the red branch of eightfold hangs down " and " rain condition branch hangs down ", and method is simple, quick, accurate, is that appearance features distinguish the irreplaceable Molecular tools of Flowering Cherry Cultivars.
Description
(1) technical field
The present invention relates to Flowering Cherry Cultivars " the red branch of eightfold hangs down " and the molecular specificity labeled primers and profit of " rain condition branch hangs down "
The method that Rapid identification is carried out to Flowering Cherry Cultivars " the red branch of eightfold hangs down " and " rain condition branch hangs down " with the molecular specificity labeled primers.
(2) background technology
Oriental cherry is under the jurisdiction of the rose family (Rosaceae) cherry category (Cerasus), is world-renowned ornamental plant.It is currently known
Flowering Cherry Cultivars have more than 300, because its plant type is graceful, pattern is gorgeous, whole florescence duration is long, there is great application on gardens
Value.In recent years, China various regions large-scale plantation oriental cherry and applied in the greenery patches such as park, school, street, garden, as morning
One of spring main ornamencal flower and tree.The cities such as Beijing, Wuhan, Qingdao, Shanghai are held the Sacura Festival one after another every year, and oriental cherry industry obtains fast
Exhibition is hailed, this promotes increasing peasant income for building beautiful China, promotes Integrated Development of The Mountainous Region and building a New Socialist Countryside,
All tool is of great significance.
China's cherry platymiscium aboundresources, it is widely distributed, and cherry platymiscium phenotype has stronger plasticity, interspecific hybridization is held
Easily, kind is large number of, and Traits change is smaller between some kinds, and traditional form classification is difficult quick, accurate and effective evaluation and area
Point.Academia at present plantation Flowering Cherry Cultivars Name and Description it is all very chaotic, " synonym " or " homonym " phenomenon compared with
For serious, the title of shortage unified standard and the taxonomic hierarchies of scientific system, cultivar identification, popularization, exchange and new product are not easy to
Kind cultivation, therefore need badly and set up a scientific and reasonable Flowering Cherry Cultivars taxonomic identification system.
Flowering Cherry Cultivars investigation and classification just in the whole country is also merely by traditional morphological feature, peroxide at present
The method such as compound enzyme and Esterase Isoenzyme Technique, electron-microscope scanning pollen grain and Q type clusterings, these methods in spite of with, but
It is difficult to carry out correctly identifying and applying to Flowering Cherry Cultivars.And the DNA molecular mark being had been widely used in recent years in plant classification circle
Note technology is not yet applied in the researchs such as Flowering Cherry Cultivars classification, product Interspecific relationship and genetic diversity so far.Therefore,
It is necessary to utilize molecular marking technique means, Flowering Cherry Cultivars existing to China carry out science discriminating, not only facilitate oriental cherry product
The foundation of taxonomic identification system is planted, the also further research for cherry platymiscium resource provides molecule foundation.
It is domestic at present to introduce substantial amounts of Flowering Cherry Cultivars, transplanted extensively in each Grand Duchy such as Beijing, Qingdao, Wuhan, Shanghai,
Ornamental value is high, wherein in the majority with late cherry kind, generally with flower amount is big, pattern is gorgeous, petal is more, florescence length, resistance,
The features such as wide adaptability.We pass through long-term investigation work, it is found that 20 evening cherry kinds include red large bamboo hat with a conical crown and broad brim (Cerasus
Serrulata ' Benigasa '), red magnificent (C.serrulata ' Kouka '), a leaf (C.serrulata ' Hisakura '), good fortune
It is green longevity (C.serrulata ' Contorta '), Samantabhadra as (C.serrulata ' Albo-rosea '), Song Yue (C.serrulata
' Superba '), root tuber of aromatic turmeric (C.serrulata ' Grandifora '), red rich (Cerasus × sieboldii ' Beni-
Yutaka '), Yu Yihuang (C.serrulata ' Gioiko '), frontier passes and mountains (C.serrulata ' Kanzan '), big hand lamp
(C.serrulata ' Ojochin '), the red branch of eightfold hang down (C.spachiana ' Plena Rosea '), the former brave tail in city
(C.serrulata ' Albo Plena '), Misaki Ji (Cerasus × yedoensis ' Sakuyahime '), rosefinch
(C.serrulata ' Shujaku '), poplar highest-ranking imperial concubine (C.serrulata ' Mollis '), the vertical (C.spachiana ' Ujou- of rain condition branch
Shidare '), chrysanthemum hang down cherry (C.serrulata ' Plena-pendula '), open country younger sister the back of the body (C.serrulata ' Imose '), the rising sun
The application of mountain cherry (C.serrulata ' Asahiyama ') in gardens is extremely extensive, but " homonym " of these kinds, " same
Thing different name " phenomenon is also abnormal serious, is difficult to discriminate between in terms of phenotypic characteristic, gives the choosing of Landscape Plants Applied, popularization and new varieties
Educate and bring many difficulties, thus put forth effort to develop these stable varieties from molecular level, special DNA fingerprint mark is only reality
The Scientific Approaches of the accurate Rapid identification of existing Flowering Cherry Cultivars.
(3) content of the invention
It is an object of the present invention to provide Flowering Cherry Cultivars " the red branch of eightfold hangs down " and the molecular specificity labeled primers of " rain condition branch hangs down ",
And utilize this pair of primer pair Flowering Cherry Cultivars " the red branch of eightfold hangs down " and the method for " rain condition branch hangs down " progress Rapid identification.
The technical solution adopted by the present invention is：
Flowering Cherry Cultivars " the red branch of eightfold hang down " and the molecular specificity labeled primers of " rain condition branch is vertical ", the primer sequence is：
Sense primer：5′-TGAGTCCAAACCGGATACTATTC-3′；
Anti-sense primer：5′-GACTGCGTACGAATTGACATAGTA-3′.
The primer pair is to use round pcr, and Flowering Cherry Cultivars " the red branch of eightfold hangs down " and " rain condition are obtained by a large amount of screening tests
Branch hang down " DNA fragment specific after, by the fragment cloning and sequencing, based on obtained DNA sequence dna design specificity draw
Flowering Cherry Cultivars are entered performing PCR amplification by thing with the specific primer, and only " the red branch of eightfold hangs down " and " rain condition branch hangs down " can obtain 640bp
The specific fragment of size, other Flowering Cherry Cultivars can not obtain specific fragment.It should be noted that molecular specific of the present invention
Property labeled primer be only limitted to the identifications of Flowering Cherry Cultivars and (identify whether it is one of " the red branch of eightfold hang down " or " rain condition branch hangs down ", subsequently
Further identified again), i.e., testing sample is only limitted to oriental cherry.
The invention further relates to it is a kind of using described molecular specificity labeled primers to Flowering Cherry Cultivars " the red branch of eightfold hang down " and
The method that " rain condition branch hang down " carries out Rapid identification, methods described is：The genomic DNA of Flowering Cherry Cultivars blade to be measured is extracted as mould
Plate, using the molecular specificity labeled primers as amplimer, enters performing PCR amplification, electrophoresis detection is carried out to amplified production, if
There are the DNA bands of 640bp sizes in electrophoresis result, then Flowering Cherry Cultivars to be measured are Flowering Cherry Cultivars " the red branch of eightfold hangs down " or " rain condition branch
Hang down ", it is on the contrary then no；The molecular specificity labeled primers sequence is：
Sense primer：5′-TGAGTCCAAACCGGATACTATTC-3′；
Anti-sense primer：5′-GACTGCGTACGAATTGACATAGTA-3′.
The inventive method key is that the selection of amplimer, DNA are extracted, PCR reaction systems and reaction condition are determined, with
And electrophoresis detection, it can be carried out according to this area conventional method.
It is preferred that, PCR amplification system composition of the present invention is as follows：
The PCR amplification conditions are as follows：95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 55 DEG C of annealing 40s, 72 DEG C of extensions
2min, totally 35 circulations；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
PCR Buffer final concentration of 1 ×, refer in PCR Buffer concentration of each component in reaction system with 1 ×
PCR Buffer are identical, generally from 10 × PCR Buffer that volume is reaction system volume 1/10.10×PCR Buffer
Composition is：100mM Tris-HCl(pH 8.5)、500mM KCl、25mM MgCl2And 1.0%Triton-X-100, solvent is
ddH2O。
Specifically, methods described is as follows：
(1) oriental cherry blade to be measured is taken, liquid feeding nitrogen is ground, oriental cherry to be measured is extracted with SDS-CTAB methods
The genomic DNA of blade；
(2) genomic DNA using step (1) extraction is template, with the molecular specificity mark
Primer is remembered as amplimer, enters performing PCR amplification：
The every 25 μ L compositions of PCR reaction systems are as follows：
PCR reaction conditions are as follows：
95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 55 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 35 circulations；Most after
72 DEG C of filling-in 7min, final temperature is 4 DEG C；；
(3) the μ L of step (2) amplified production 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample is in 1.5% fine jade
On sepharose, the electrophoresis in 1 × TAE buffer solutions, under 5V/cm voltages, electrophoresis terminates rear EB dyeing, in automatic gel images point
Taken a picture in analyzer, if 640bp DNA bands occurs in electrophoresis result, Flowering Cherry Cultivars to be measured are " the red branch of eightfold hangs down " or " rain condition branch
Hang down "；It is on the contrary then no.
Beneficial effect of the present invention is mainly reflected in：Molecular specificity labeled primers of the present invention can " eightfold be red to Flowering Cherry Cultivars
Branch hangs down " and " rain condition branch hang down " carry out quick discriminating, method is simple, quick, accurate, is that appearance features discrimination Flowering Cherry Cultivars can not
The Molecular tools of replacement.
(4) illustrate
Fig. 1 is the result that 20 kinds of Flowering Cherry Cultivars are entered with performing PCR amplification；M is DNA molecular amount standard；Numbering 12 and 17 is distinguished
For Flowering Cherry Cultivars " the red branch of eightfold hangs down " and " rain condition branch hangs down ", the specific DNA band that molecular weight is 640bp has been amplified；Remaining is compiled
Number for other Flowering Cherry Cultivars, the specific DNA band that there are no many sizes of 600bp is produced.
(5) embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
Embodiment 1：
(1) extraction of Flowering Cherry Cultivars genomic DNA：
Flowering Cherry Cultivars young leaflet tablet 0.01g to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses SDS-
CTAB methods, through repeatedly extracting, to extract the genomic DNA crude extract for obtaining Flowering Cherry Cultivars.DNA crude extracts are again through Magabio cores
Sour purification kit is purified after (rich day Bioer, Hangzhou, China), passes through 1.5% agarose gel electrophoresis and DNA/
RNA ultraviolet specrophotometers (GeneQuant Pro, GE Healthcare) detect integrality, purity and concentration.OD260/
OD280>1.8 DNA sample is used for subsequent PCR amplification.DNA extracts are standby in -20 DEG C of refrigerator storages.
(2) specific PCR amplification primer is designed, the sequence of primer pair is：
Sense primer：5 '-TGAGTCCAAACCGGATACTATTC-3 ' and anti-sense primer：5′-
GACTGCGTACGAATTGACATAGTA-3 ', by Shanghai, biotechnology Co., Ltd synthesizes.
(3) PCR is expanded：
PCR reaction solutions are constituted：10 × PCR Buffer, 2.5 μ L, 10mmol/L dNTPs 2.5 μ L, 25mmol/L
MgCl2μ L, the 10mM special primers of 2.5 μ L, 5U/ μ L Taq DNA enzymatics 0.2 are to each 1 μ L, 20ng/ μ L template DNAs 3 μ L, ddH2O is mended
Enough to 25 μ L.
Amplified reaction is carried out on TC-XP type amplification instruments.Amplification condition：95 DEG C of pre-degeneration 3min；95 DEG C are denatured 40s, 55
DEG C annealing 40s, 72 DEG C extension 2min, totally 35 circulation；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
(4) electrophoresis detection：The μ L of step (3) pcr amplification product 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample
In on 1.5% Ago-Gel, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, after electrophoresis terminates, containing 0.5 μ g/
Dyed in the mL EB aqueous solution 30 minutes, then train and taken a picture on the clear automatic gel image analysis instrument of JS-380A in Shanghai.
According to the method described above, to 20 Flowering Cherry Cultivars, (numbering 1~20 represents Flowering Cherry Cultivars and is followed successively by respectively：1st, red large bamboo hat with a conical crown and broad brim
(C.serrulata ' Benigasa '), 2, red magnificent (C.serrulata ' Kouka '), 3, one leaf (C.serrulata
' Hisakura '), 4, the good fortune green longevity (C.serrulata ' Contorta '), 5, it is Samantabhadra as (C.serrulata ' Albo-
Rosea '), 6, Song Yue (C.serrulata ' Superba '), 7, root tuber of aromatic turmeric (C.serrulata ' Grandifora '), 8, Hong Feng
(Cerasus × sieboldii ' Beni-yutaka '), 9, Yu Yihuang (C.serrulata ' Gioiko '), 10, frontier passes and mountains
(C.serrulata ' Kanzan '), 11, big hand lamp (C.serrulata ' Ojochin '), 12, the red branch of eightfold hang down
(C.spachiana ' Plena Rosea '), 13, the former brave tail (C.serrulata ' Albo Plena ') in city, a 14, Misaki Ji
(Cerasus × yedoensis ' Sakuyahime '), 15, rosefinch (C.serrulata ' Shujaku '), 16, poplar highest-ranking imperial concubine
(C.serrulata ' Mollis '), 17, rain condition branch vertical (C.spachiana ' Ujou-shidare '), 18, the vertical cherry of chrysanthemum
(C.serrulata ' Plena-pendula '), 19, the open country younger sister back of the body (C.serrulata ' Imose '), 20, rising sun mountain cherry
The PCR AFLP systems of (C.serrulata ' Asahiyama ') carry out electrophoresis detection, as a result see Fig. 1.
Wherein only respectively amplified from the Flowering Cherry Cultivars " the red branch of eightfold hangs down " of numbering respectively 12 and 17 and " rain condition branch hangs down "
The specific DNA band that one clear bright, stable molecular weight is about 640bp, and the Flowering Cherry Cultivars of remaining numbering, there are no
The special DNA bands of many sizes of 600bp are produced, and also do not have other non-purpose bands to produce, it is seen that the molecule that the present invention is developed
Specificity labeled primers are used for the identification of Flowering Cherry Cultivars " the red branch of eightfold hangs down " and " rain condition branch hangs down ", and its stability, specificity are very
It is high.
Claims (1)
1. Flowering Cherry Cultivars " the red branch of eightfold hangs down " and the molecular specificity labeled primers of " rain condition branch hangs down ", the primer sequence are as follows：
Sense primer：5′-AGCGGCCGCAACTAGCTATAATG-3′；
Anti-sense primer：5′-AGCGGCCGCAAGAGAACG-3′.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510145815.3A CN104762384B (en) | 2015-03-31 | 2015-03-31 | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510145815.3A CN104762384B (en) | 2015-03-31 | 2015-03-31 | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104762384A CN104762384A (en) | 2015-07-08 |
| CN104762384B true CN104762384B (en) | 2017-08-22 |
Family
ID=53644474
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510145815.3A Active CN104762384B (en) | 2015-03-31 | 2015-03-31 | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104762384B (en) |
-
2015
- 2015-03-31 CN CN201510145815.3A patent/CN104762384B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Detection and quantification of the antioxidant melatonin in montmor;Burkhardt s et.al;《J Aqric Food Chem》;20011031;4898-4902 * |
| 樱属观赏品种资源调查及部分种与品种SSR分析;张琼;;《 中国优秀硕士学位论文全文数据库》;20131101;第77页3.1.3至第79页3.1.4，表格3-1 * |
| 福建山樱花及其近缘物种的杂交试验及分子鉴定;林霜霜;《中国优秀硕士学位论文全文数据库》;20110928;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104762384A (en) | 2015-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103233065B (en) | Molecular specific marker primers for No. 4 and No.32 of an improved variety Changlin of Camellia oleifera and an identification method | |
| CN104099414B (en) | Utilize the method for SSR molecular marker identification apricot cultivars | |
| CN108034754B (en) | Method for identifying new variety of purple tea trees by SSR fingerprint | |
| CN108660136A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN109868328B (en) | SSR molecular marker for identifying paeonia rockii varieties and application | |
| CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
| CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN104762384B (en) | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch | |
| CN104694636B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " | |
| CN104611426B (en) | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch | |
| CN104593366B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " chrysanthemum hang down cherry " | |
| CN104673913B (en) | The molecular specificity labeled primers and detection method of a Flowering Cherry Cultivars " Misaki Ji " | |
| CN104593364B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " | |
| CN104611330B (en) | The molecular specificity labeled primers of Flowering Cherry Cultivars " red rich " and " the former brave tail in city " | |
| CN104593368B (en) | The molecular specificity labeled primers that the red branch of Flowering Cherry Cultivars eightfold hangs down and rain condition branch hangs down | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
| CN103757114B (en) | Method for building nucleotide formula to identify plant variety by using ribosome deoxyribonucleic acid (DNA) | |
| CN108410967B (en) | A kind of method of Rapid identification river camellia tradition famous-object | |
| CN101899505B (en) | Molecular specificity marker primer for identifying cunninghamia lanceolata clonal Kaitian III and method thereof | |
| CN110343778A (en) | The polymorphism mark primer and camellia cultivar identification method of camellia kind spring Jiang Hongxia | |
| CN104278025A (en) | SCAR molecular markers of Brassica napus whole genomes and preparation method and application of SCAR molecular markers | |
| CN107130034A (en) | A kind of method that utilization SSR marker identifies flat Europe hybrid hazel kind |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |