CN104694636B - The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " - Google Patents
The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " Download PDFInfo
- Publication number
- CN104694636B CN104694636B CN201510079018.XA CN201510079018A CN104694636B CN 104694636 B CN104694636 B CN 104694636B CN 201510079018 A CN201510079018 A CN 201510079018A CN 104694636 B CN104694636 B CN 104694636B
- Authority
- CN
- China
- Prior art keywords
- mountains
- flowering cherry
- cherry cultivars
- cultivars
- serrulata
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the molecular specificity labeled primers of the high Flowering Cherry Cultivars " frontier passes and mountains " of a pair of specificity, and the method that one kind can carry out Rapid identification to Flowering Cherry Cultivars " frontier passes and mountains ".The primer sequence is as follows:Sense primer:5′‑TGAGTCCAAACCGGACCAAGTT‑3′;Anti-sense primer:5′‑GACTGCGTACGAATTTGAAAAGCT‑3′.Molecular specificity labeled primers of the present invention can carry out quick Early Identification to Flowering Cherry Cultivars " frontier passes and mountains ", and method is simple, quick, accurate, be that appearance features distinguish the irreplaceable Molecular tools of Flowering Cherry Cultivars.
Description
(1) technical field
The present invention relates to the molecular specificity labeled primers of Flowering Cherry Cultivars " frontier passes and mountains " and utilize the molecular specificity marker
The method that primer pair Flowering Cherry Cultivars " frontier passes and mountains " carry out Rapid identification.
(2) background technology
Oriental cherry is under the jurisdiction of the rose family (Rosaceae) cherry category (Cerasus), is world-renowned ornamental plant.It is currently known
Flowering Cherry Cultivars have more than 300, because its plant type is graceful, pattern is gorgeous, whole florescence duration is long, there is great application on gardens
Value.In recent years, China various regions large-scale plantation oriental cherry and applied in the greenery patches such as park, school, street, garden, as morning
One of spring main ornamencal flower and tree.The cities such as Beijing, Wuhan, Qingdao, Shanghai are held the Sacura Festival one after another every year, and oriental cherry industry obtains fast
Exhibition is hailed, this promotes increasing peasant income for building beautiful China, promotes Integrated Development of The Mountainous Region and building a New Socialist Countryside,
All tool is of great significance.
China's cherry platymiscium aboundresources, it is widely distributed, and cherry platymiscium phenotype has stronger plasticity, interspecific hybridization is held
Easily, kind is large number of, and Traits change is smaller between some kinds, and traditional form classification is difficult quick, accurate and effective evaluation and area
Point.Academia at present plantation Flowering Cherry Cultivars Name and Description it is all very chaotic, " synonym " or " homonym " phenomenon compared with
For serious, the title of shortage unified standard and the taxonomic hierarchies of scientific system, cultivar identification, popularization, exchange and new product are not easy to
Kind cultivation, therefore need badly and set up a scientific and reasonable Flowering Cherry Cultivars taxonomic identification system.
Flowering Cherry Cultivars investigation and classification just in the whole country is also merely by traditional morphological feature, peroxide at present
The method such as compound enzyme and Esterase Isoenzyme Technique, electron-microscope scanning pollen grain and Q type clusterings, these methods in spite of with, but
It is difficult to carry out correctly identifying and applying to Flowering Cherry Cultivars.And the DNA molecular mark being had been widely used in recent years in plant classification circle
Note technology is not yet applied in the researchs such as Flowering Cherry Cultivars classification, product Interspecific relationship and genetic diversity so far.Therefore,
It is necessary to utilize molecular marking technique means, Flowering Cherry Cultivars existing to China carry out science discriminating, not only facilitate oriental cherry product
The foundation of taxonomic identification system is planted, the also further research for cherry platymiscium resource provides molecule foundation.
It is domestic at present to introduce substantial amounts of Flowering Cherry Cultivars, transplanted extensively in each Grand Duchy such as Beijing, Qingdao, Wuhan, Shanghai,
Ornamental value is high, wherein in the majority with late cherry kind, generally with flower amount is big, pattern is gorgeous, petal is more, florescence length, resistance,
The features such as wide adaptability.We pass through long-term investigation work, it is found that 20 evening cherry kinds include red large bamboo hat with a conical crown and broad brim (Cerasus
Serrulata ' Benigasa '), red magnificent (C.serrulata ' Kouka '), a leaf (C.serrulata ' Hisakura '), good fortune
It is green longevity (C.serrulata ' Contorta '), Samantabhadra as (C.serrulata ' Albo-rosea '), Song Yue (C.serrulata
' Superba '), root tuber of aromatic turmeric (C.serrulata ' Grandifora '), red rich (Cerasus × sieboldii ' Beni-
Yutaka '), Yu Yihuang (C.serrulata ' Gioiko '), frontier passes and mountains (C.serrulata ' Kanzan '), big hand lamp
(C.serrulata ' Ojochin '), the red branch of eightfold hang down (C.spachiana ' Plena Rosea '), the former brave tail in city
(C.serrulata ' Albo Plena '), Misaki Ji (Cerasus × yedoensis ' Sakuyahime '), rosefinch
(C.serrulata ' Shujaku '), poplar highest-ranking imperial concubine (C.serrulata ' Mollis '), the vertical (C.spachiana ' Ujou- of rain condition branch
Shidare '), chrysanthemum hang down cherry (C.serrulata ' Plena-pendula '), open country younger sister the back of the body (C.serrulata ' Imose '), the rising sun
The application of mountain cherry (C.serrulata ' Asahiyama ') in gardens is extremely extensive, but " homonym " of these kinds, " same
Thing different name " phenomenon is also abnormal serious, is difficult to discriminate between in terms of phenotypic characteristic, gives the choosing of Landscape Plants Applied, popularization and new varieties
Educate and bring many difficulties, thus put forth effort to develop these stable varieties from molecular level, special DNA fingerprint mark is only reality
The Scientific Approaches of the accurate Rapid identification of existing Flowering Cherry Cultivars.
(3) content of the invention
It is an object of the present invention to provide the molecular specificity labeled primers in Flowering Cherry Cultivars " frontier passes and mountains ", and utilize this pair of primer pair
The method that Flowering Cherry Cultivars " frontier passes and mountains " carry out Rapid identification.
The technical solution adopted by the present invention is:
The molecular specificity labeled primers of Flowering Cherry Cultivars " frontier passes and mountains ", the primer sequence is:
Sense primer:5′-TGAGTCCAAACCGGACCAAGTT-3′;
Anti-sense primer:5′-GACTGCGTACGAATTTGAAAAGCT-3′.
The primer pair is to use round pcr, and the specific DNA piece of Flowering Cherry Cultivars " frontier passes and mountains " is obtained by a large amount of screening tests
After section, by the fragment cloning and sequencing, specific primer is designed based on obtained DNA sequence dna, with the specific primer pair
Flowering Cherry Cultivars enter performing PCR amplification, and only " frontier passes and mountains " can obtain the specific fragment of 838bp sizes, and other Flowering Cherry Cultivars can not be obtained
Obtain specific fragment.It should be noted that the identification that molecular specificity labeled primers of the present invention are only limitted to Flowering Cherry Cultivars (identifies it
Whether it is " frontier passes and mountains "), i.e., testing sample is only limitted to oriental cherry.
Flowering Cherry Cultivars " frontier passes and mountains " are carried out quickly using described molecular specificity labeled primers the invention further relates to a kind of
The method of identification, methods described is:The genomic DNA of Flowering Cherry Cultivars blade to be measured is extracted as template, with the molecular specific
Property labeled primer as amplimer, enter performing PCR amplification, to amplified production carry out electrophoresis detection, if there is 838bp in electrophoresis result
The DNA bands of size, then Flowering Cherry Cultivars to be measured are Flowering Cherry Cultivars " frontier passes and mountains ", on the contrary then no;The molecular specificity labeled primers
Sequence is:
Sense primer:5′-TGAGTCCAAACCGGACCAAGTT-3′;
Anti-sense primer:5′-GACTGCGTACGAATTTGAAAAGCT-3′.
The inventive method key is that the selection of amplimer, DNA are extracted, PCR reaction systems and reaction condition are determined, with
And electrophoresis detection, it can be carried out according to this area conventional method.
It is preferred that, PCR amplification system composition of the present invention is as follows:
The PCR amplification conditions are as follows:95 DEG C of pre-degeneration 3min;95 DEG C of denaturation 40s, 60 DEG C of annealing 40s, 72 DEG C of extensions
2min, totally 35 circulations;Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
PCR Buffer final concentration of 1 ×, refer in PCR Buffer concentration of each component in reaction system with 1 ×
PCR Buffer are identical, generally from 10 × PCR Buffer that volume is reaction system volume 1/10.10×PCR Buffer
Composition is:100mM Tris-HCl(pH 8.5)、500mM KCl、25mM MgCl2And 1.0%Triton-X-100, solvent is
ddH2O。
Specifically, methods described is as follows:
(1) oriental cherry blade to be measured is taken, liquid feeding nitrogen is ground, the genomic DNA of oriental cherry blade to be measured is extracted with SDS-CTAB methods;
(2) genomic DNA using step (1) extraction is drawn as template using the molecular specificity labeled primers as amplification
Thing, enters performing PCR amplification:
The every 25 μ L compositions of PCR reaction systems are as follows:
PCR reaction conditions are as follows:
95 DEG C of pre-degeneration 3min;95 DEG C of denaturation 40s, 60 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 35 circulations;Most after
72 DEG C of filling-in 7min, final temperature is 4 DEG C;
(3) the μ L of step (2) amplified production 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample is in 1.5% fine jade
On sepharose, the electrophoresis in 1 × TAE buffer solutions, under 5V/cm voltages, electrophoresis terminates rear EB dyeing, in automatic gel images point
Taken a picture in analyzer, if 838bp DNA bands occurs in electrophoresis result, Flowering Cherry Cultivars to be measured are " frontier passes and mountains ";It is on the contrary then no.
Beneficial effect of the present invention is mainly reflected in:Molecular specificity labeled primers of the present invention can enter to Flowering Cherry Cultivars " frontier passes and mountains "
Row quick discriminating, method is simple, quick, accurate, is that appearance features distinguish the irreplaceable Molecular tools of Flowering Cherry Cultivars.
(4) illustrate
Fig. 1 is the result that 20 kinds of Flowering Cherry Cultivars are entered with performing PCR amplification;M is DNA molecular amount standard;Numbering 10 is oriental cherry product
Plant in " frontier passes and mountains ", amplified the specific DNA band that molecular weight is 838bp;Remaining numbering is other Flowering Cherry Cultivars, be there are no
The specific DNA band of many sizes of 800bp is produced.
(5) embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This:
Embodiment 1:
(1) extraction of Flowering Cherry Cultivars genomic DNA:
Flowering Cherry Cultivars young leaflet tablet 0.01g to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses SDS-
CTAB methods, through repeatedly extracting, to extract the genomic DNA crude extract for obtaining Flowering Cherry Cultivars.DNA crude extracts are again through Magabio cores
Sour purification kit is purified after (rich day Bioer, Hangzhou, China), passes through 1.5% agarose gel electrophoresis and DNA/
RNA ultraviolet specrophotometers (GeneQuant Pro, GE Healthcare) detect integrality, purity and concentration.OD260/
OD280>1.8 DNA sample is used for subsequent PCR amplification.DNA extracts are standby in -20 DEG C of refrigerator storages.
(2) specific PCR amplification primer is designed, the sequence of primer pair is:
Sense primer:5 '-TGAGTCCAAACCGGACCAAGTT-3 ' and anti-sense primer:5′-
GACTGCGTACGAATTTGAAAAGCT-3 ', by Shanghai, biotechnology Co., Ltd synthesizes.
(4) PCR is expanded:
PCR reaction solutions are constituted:10 × PCR Buffer, 2.5 μ L, 10mmol/L dNTPs 2.5 μ L, 25mmol/L
MgCl2μ L, the 10mM special primers of 2.5 μ L, 5U/ μ L Taq DNA enzymatics 0.2 are to each 1 μ L, 20ng/ μ L template DNAs 3 μ L, ddH2O is mended
Enough to 25 μ L.
Amplified reaction is carried out on TC-XP type amplification instruments.Amplification condition:95 DEG C of pre-degeneration 3min;95 DEG C are denatured 40s, 60
DEG C annealing 40s, 72 DEG C extension 2min, totally 35 circulation;Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
(4) electrophoresis detection:The μ L of step (3) pcr amplification product 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample
In on 1.5% Ago-Gel, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, after electrophoresis terminates, containing 0.5 μ g/
Dyed in the mL EB aqueous solution 30 minutes, then train and taken a picture on the clear automatic gel image analysis instrument of JS-380A in Shanghai.
According to the method described above, to 20 Flowering Cherry Cultivars, (numbering 1~20 represents Flowering Cherry Cultivars and is followed successively by respectively:1st, red large bamboo hat with a conical crown and broad brim
(C.serrulata ' Benigasa '), 2, red magnificent (C.serrulata ' Kouka '), 3, one leaf (C.serrulata
' Hisakura '), 4, the good fortune green longevity (C.serrulata ' Contorta '), 5, it is Samantabhadra as (C.serrulata ' Albo-
Rosea '), 6, Song Yue (C.serrulata ' Superba '), 7, root tuber of aromatic turmeric (C.serrulata ' Grandifora '), 8, Hong Feng
(Cerasus × sieboldii ' Beni-yutaka '), 9, Yu Yihuang (C.serrulata ' Gioiko '), 10, frontier passes and mountains
(C.serrulata ' Kanzan '), 11, big hand lamp (C.serrulata ' Ojochin '), 12, the red branch of eightfold hang down
(C.spachiana ' Plena Rosea '), 13, the former brave tail (C.serrulata ' Albo Plena ') in city, a 14, Misaki Ji
(Cerasus × yedoensis ' Sakuyahime '), 15, rosefinch (C.serrulata ' Shujaku '), 16, poplar highest-ranking imperial concubine
(C.serrulata ' Mollis '), 17, rain condition branch vertical (C.spachiana ' Ujou-shidare '), 18, the vertical cherry of chrysanthemum
(C.serrulata ' Plena-pendula '), 19, the open country younger sister back of the body (C.serrulata ' Imose '), 20, rising sun mountain cherry
The PCR AFLP systems of (C.serrulata ' Asahiyama ') carry out electrophoresis detection, as a result see Fig. 1.
A clear bright, stable molecular weight has only wherein been amplified from the Flowering Cherry Cultivars " frontier passes and mountains " that numbering is 10 about
For 838bp specific DNA band, and the Flowering Cherry Cultivars of remaining numbering, the special DNA bands that there are no many sizes of 800bp are produced,
There are not other non-purpose bands to produce, it is seen that the molecular specificity marker that the present invention is developed is used for Flowering Cherry Cultivars " frontier passes and mountains " yet
Identification, its stability, specificity are very high.
Claims (1)
1. the molecular specificity labeled primers of Flowering Cherry Cultivars " frontier passes and mountains ", the primer sequence is as follows:
Sense primer:5′-TGAGTCCAAACCGGACCAAGTT-3′;
Anti-sense primer:5′-GACTGCGTACGAATTTGAAAAGCT-3′.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510079018.XA CN104694636B (en) | 2015-02-13 | 2015-02-13 | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510079018.XA CN104694636B (en) | 2015-02-13 | 2015-02-13 | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104694636A CN104694636A (en) | 2015-06-10 |
CN104694636B true CN104694636B (en) | 2017-08-25 |
Family
ID=53342184
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510079018.XA Active CN104694636B (en) | 2015-02-13 | 2015-02-13 | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104694636B (en) |
-
2015
- 2015-02-13 CN CN201510079018.XA patent/CN104694636B/en active Active
Non-Patent Citations (2)
Title |
---|
RAPD、SRAP和ISSR标记在香菇种质资源的应用及其SCAR标记的建立;应正河;《中国优秀硕士学位论文全文数据库》;20061215;第58页-75页第六章 * |
樱属观赏品种资源调查及部分种与品种SSR分析;张琼;《 中国优秀硕士学位论文全文数据库》;20131101;第77页3.1.3至第79页3.1.4,第80页表格1-3 * |
Also Published As
Publication number | Publication date |
---|---|
CN104694636A (en) | 2015-06-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108034754B (en) | Method for identifying new variety of purple tea trees by SSR fingerprint | |
CN103233065B (en) | Molecular specific marker primers for No. 4 and No.32 of an improved variety Changlin of Camellia oleifera and an identification method | |
CN104099414B (en) | Utilize the method for SSR molecular marker identification apricot cultivars | |
CN108660136A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
CN107557369A (en) | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method | |
CN109868328B (en) | SSR molecular marker for identifying paeonia rockii varieties and application | |
CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
CN108796119A (en) | Specific molecular marker PCMI-M001 for Cathay poplar male seedling Rapid identification | |
CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " | |
CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
CN104694636B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " | |
CN104762384B (en) | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch | |
CN104611426B (en) | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch | |
CN104593366B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " chrysanthemum hang down cherry " | |
CN104673913B (en) | The molecular specificity labeled primers and detection method of a Flowering Cherry Cultivars " Misaki Ji " | |
CN104593364B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " | |
CN104611330B (en) | The molecular specificity labeled primers of Flowering Cherry Cultivars " red rich " and " the former brave tail in city " | |
CN108754015A (en) | Specific molecular marker PCMI-F001 for Cathay poplar female seedling Rapid identification | |
CN104593368B (en) | The molecular specificity labeled primers that the red branch of Flowering Cherry Cultivars eightfold hangs down and rain condition branch hangs down | |
CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
CN106755526A (en) | A kind of related functional molecular marker and its authentication method of Chinese cymbidium " lip and petal sepalody " proterties | |
CN108410967B (en) | A kind of method of Rapid identification river camellia tradition famous-object | |
CN101899505B (en) | Molecular specificity marker primer for identifying cunninghamia lanceolata clonal Kaitian III and method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |