CN104593364B - The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " - Google Patents
The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " Download PDFInfo
- Publication number
- CN104593364B CN104593364B CN201510019011.9A CN201510019011A CN104593364B CN 104593364 B CN104593364 B CN 104593364B CN 201510019011 A CN201510019011 A CN 201510019011A CN 104593364 B CN104593364 B CN 104593364B
- Authority
- CN
- China
- Prior art keywords
- city
- flowering cherry
- cherry cultivars
- cultivars
- labeled primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to the molecular specificity labeled primers of the high Flowering Cherry Cultivars of a pair of specificity " the former brave tail in city ", and the method that one kind can carry out Rapid identification to Flowering Cherry Cultivars " the former brave tail in city ".The primer sequence is as follows：Sense primer：5′‑AGCGGCCGCCCCTAGATCAGTA‑3′；Anti-sense primer：5′‑CGGCCGCCCCGCAAAGAT‑3′.Molecular specificity labeled primers of the present invention can carry out quick Early Identification to Flowering Cherry Cultivars " the former brave tail in city ", and method is simple, quick, accurate, is that appearance features distinguish the irreplaceable Molecular tools of Flowering Cherry Cultivars.
Description
(1) technical field
The present invention relates to the molecular specificity labeled primers of Flowering Cherry Cultivars " city former brave tail " and utilize the molecular specificity
The method that labeled primer carries out Rapid identification to Flowering Cherry Cultivars " the former brave tail in city ".
(2) background technology
Oriental cherry is under the jurisdiction of the rose family (Rosaceae) cherry category (Cerasus), is world-renowned ornamental plant.It is currently known
Flowering Cherry Cultivars have more than 300, because its plant type is graceful, pattern is gorgeous, whole florescence duration is long, there is great application on gardens
Value.In recent years, China various regions large-scale plantation oriental cherry and applied in the greenery patches such as park, school, street, garden, as morning
One of spring main ornamencal flower and tree.The cities such as Beijing, Wuhan, Qingdao, Shanghai are held the Sacura Festival one after another every year, and oriental cherry industry obtains fast
Exhibition is hailed, this promotes increasing peasant income for building beautiful China, promotes Integrated Development of The Mountainous Region and building a New Socialist Countryside,
All tool is of great significance.
China's cherry platymiscium aboundresources, it is widely distributed, and cherry platymiscium phenotype has stronger plasticity, interspecific hybridization is held
Easily, kind is large number of, and Traits change is smaller between some kinds, and traditional form classification is difficult quick, accurate and effective evaluation and area
Point.Academia at present plantation Flowering Cherry Cultivars Name and Description it is all very chaotic, " synonym " or " homonym " phenomenon compared with
For serious, the title of shortage unified standard and the taxonomic hierarchies of scientific system, cultivar identification, popularization, exchange and new product are not easy to
Kind cultivation, therefore need badly and set up a scientific and reasonable Flowering Cherry Cultivars taxonomic identification system.
Flowering Cherry Cultivars investigation and classification just in the whole country is also merely by traditional morphological feature, peroxide at present
The method such as compound enzyme and Esterase Isoenzyme Technique, electron-microscope scanning pollen grain and Q type clusterings, these methods in spite of with, but
It is difficult to carry out correctly identifying and applying to Flowering Cherry Cultivars.And the DNA molecular mark being had been widely used in recent years in plant classification circle
Note technology is not yet applied in the researchs such as Flowering Cherry Cultivars classification, product Interspecific relationship and genetic diversity so far.Therefore,
It is necessary to utilize molecular marking technique means, Flowering Cherry Cultivars existing to China carry out science discriminating, not only facilitate oriental cherry product
The foundation of taxonomic identification system is planted, the also further research for cherry platymiscium resource provides molecule foundation.
It is domestic at present to introduce substantial amounts of Flowering Cherry Cultivars, transplanted extensively in each Grand Duchy such as Beijing, Qingdao, Wuhan, Shanghai,
Ornamental value is high, wherein in the majority with late cherry kind, generally with flower amount is big, pattern is gorgeous, petal is more, florescence length, resistance,
The features such as wide adaptability.We pass through long-term investigation work, it is found that 20 evening cherry kinds include red large bamboo hat with a conical crown and broad brim (Cerasus
Serrulata ' Benigasa '), red magnificent (C.serrulata ' Kouka '), a leaf (C.serrulata ' Hisakura '), good fortune
It is green longevity (C.serrulata ' Contorta '), Samantabhadra as (C.serrulata ' Albo-rosea '), Song Yue (C.serrulata
' Superba '), root tuber of aromatic turmeric (C.serrulata ' Grandifora '), red rich (Cerasus × sieboldii ' Beni-
Yutaka '), Yu Yihuang (C.serrulata ' Gioiko '), frontier passes and mountains (C.serrulata ' Kanzan '), big hand lamp
(C.serrulata ' Ojochin '), the red branch of eightfold hang down (C.spachiana ' Plena Rosea '), the former brave tail in city
(C.serrulata ' Albo Plena '), Misaki Ji (Cerasus × yedoensis ' Sakuyahime '), rosefinch
(C.serrulata ' Shujaku '), poplar highest-ranking imperial concubine (C.serrulata ' Mollis '), the vertical (C.spachiana ' Ujou- of rain condition branch
Shidare '), chrysanthemum hang down cherry (C.serrulata ' Plena-pendula '), open country younger sister the back of the body (C.serrulata ' Imose '), the rising sun
The application of mountain cherry (C.serrulata ' Asahiyama ') in gardens is extremely extensive, but " homonym " of these kinds, " same
Thing different name " phenomenon is also abnormal serious, is difficult to discriminate between in terms of phenotypic characteristic, gives the choosing of Landscape Plants Applied, popularization and new varieties
Educate and bring many difficulties, thus put forth effort to develop these stable varieties from molecular level, special DNA fingerprint mark is only reality
The Scientific Approaches of the accurate Rapid identification of existing Flowering Cherry Cultivars.
(3) content of the invention
The object of the invention provides the molecular specificity labeled primers of Flowering Cherry Cultivars " the former brave tail in city ", and utilizes this pair of primer
The method that Rapid identification is carried out to Flowering Cherry Cultivars " the former brave tail in city ".
The technical solution adopted by the present invention is：
The molecular specificity labeled primers of Flowering Cherry Cultivars " city former brave tail ", the primer sequence is：
Sense primer：5′-AGCGGCCGCCCCTAGATCAGTA-3′；
Anti-sense primer：5′-CGGCCGCCCCGCAAAGAT-3′.
The primer pair is to use round pcr, and the specificity of Flowering Cherry Cultivars " the former brave tail in city " is obtained by a large amount of screening tests
After DNA fragmentation, by the fragment cloning and sequencing, specific primer is designed based on obtained DNA sequence dna, is drawn with the specificity
Thing enters performing PCR amplification to Flowering Cherry Cultivars, and only " the former brave tail in city " can obtain the specific fragment of 310bp sizes, other Flowering Cherry Cultivars
Specific fragment can not be obtained.It should be noted that molecular specificity labeled primers of the present invention are only limitted to the mirror of Flowering Cherry Cultivars
Fixed (identifying whether it is " the former brave tail in city "), i.e., testing sample is only limitted to oriental cherry.
Flowering Cherry Cultivars " the former brave tail in city " are carried out using described molecular specificity labeled primers the invention further relates to a kind of
The method of Rapid identification, methods described is：The genomic DNA of Flowering Cherry Cultivars blade to be measured is extracted as template, with the molecule
Specificity labeled primers enter performing PCR amplification, electrophoresis detection are carried out to amplified production as amplimer, if electrophoresis result occurs
The DNA bands of 310bp sizes, then Flowering Cherry Cultivars to be measured are " city former brave tail ", on the contrary then no；The molecular specificity labeled primers
Sequence is：
Sense primer：5′-AGCGGCCGCCCCTAGATCAGTA-3′；
Anti-sense primer：5′-CGGCCGCCCCGCAAAGAT-3′.
The inventive method key is that the selection of amplimer, DNA are extracted, PCR reaction systems and reaction condition are determined, with
And electrophoresis detection, it can be carried out according to this area conventional method.
It is preferred that, PCR reaction systems composition of the present invention is as follows：
Surplus is ddH2O。
The PCR amplification conditions are as follows：95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 65 DEG C of annealing 40s, 72 DEG C of extensions
2min, totally 35 circulations；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
PCR Buffer final concentration of 1 ×, refer in PCR Buffer concentration of each component in reaction system with 1 ×
PCR Buffer are identical, generally from 10 × PCRBuffer that volume is reaction system volume 1/10.10 × PCR Buffer into
It is divided into：100mM Tris-HCl(pH 8.5)、500mM KCl、25mM MgCl2And 1.0%Triton-X-100, solvent is
ddH2O。
Specifically, methods described is as follows：
(1) oriental cherry blade to be measured is taken, liquid feeding nitrogen is ground, the genomic DNA of oriental cherry blade to be measured is extracted with SDS-CTAB methods；
(2) genomic DNA using step (1) extraction is drawn as template using the molecular specificity labeled primers as amplification
Thing, enters performing PCR amplification：
The every 25 μ L compositions of pcr amplification reaction system are as follows：
ddH2O complements to 25 μ L；
PCR amplification conditions are as follows：
95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 65 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 35 circulations；Most after
72 DEG C of filling-in 7min, final temperature is 4 DEG C；；
(3) the μ L of step (2) amplified production 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample is in 1.5% fine jade
On sepharose, the electrophoresis in 1 × TAE buffer solutions, under 5V/cm voltages, electrophoresis terminates rear EB dyeing, in automatic gel images point
Taken a picture in analyzer, if 310bp DNA bands occurs in electrophoresis result, Flowering Cherry Cultivars to be measured are " the former brave tail in city "；It is on the contrary then no.
Beneficial effect of the present invention is mainly reflected in：Molecular specificity labeled primers of the present invention can be to Flowering Cherry Cultivars " the former tiger in city
Tail " carries out quick discriminating, and method is simple, quick, accurate, is that appearance features distinguish the irreplaceable molecule hand of Flowering Cherry Cultivars
Section.
(1) illustrate
Fig. 1 is the result that 20 kinds of Flowering Cherry Cultivars are entered with performing PCR amplification；M is DNA molecular amount standard；Numbering 13 is oriental cherry product
" the former brave tail in city " is planted, the specific DNA band that molecular weight is 310bp has been amplified；Remaining numbering is other Flowering Cherry Cultivars, is had no
The specific DNA band for having many sizes of 300bp is produced.
(2) embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
Embodiment 1：
(1) extraction of Flowering Cherry Cultivars genomic DNA：
Flowering Cherry Cultivars young leaflet tablet 0.01g to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses SDS-
CTAB methods, through repeatedly extracting, to extract the genomic DNA crude extract for obtaining Flowering Cherry Cultivars.DNA crude extracts are again through Magabio cores
Sour purification kit is purified after (rich day Bioer, Hangzhou, China), passes through 1.5% agarose gel electrophoresis and DNA/
RNA ultraviolet specrophotometers (GeneQuant Pro, GE Healthcare) detect integrality, purity and concentration.OD260/
OD280>1.8 DNA sample is used for subsequent PCR amplification.DNA extracts are standby in -20 DEG C of refrigerator storages.
(2) specific PCR amplification primer is designed, the sequence of primer pair is：
Sense primer：5 '-AGCGGCCGCCCCTAGATCAGTA-3 ' and anti-sense primer：5′-
CGGCCGCCCCGCAAAGAT-3 ', by Shanghai, biotechnology Co., Ltd synthesizes.
(4) PCR is expanded：
PCR reaction solutions are constituted：10 × PCR Buffer, 2.5 μ L, 10mmol/L dNTPs 2.5 μ L, 25mmol/L
MgCl2μ L, the 10mM special primers of 2.5 μ L, 5U/ μ L Taq DNA enzymatics 0.2 are to each 1 μ L, 20ng/ μ L template DNAs 3 μ L, ddH2O is mended
Enough to 25 μ L.
Amplified reaction is carried out on TC-XP type amplification instruments.Amplification condition：95 DEG C of pre-degeneration 3min；95 DEG C are denatured 40s, 65
DEG C annealing 40s, 72 DEG C extension 2min, totally 35 circulation；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
(4) electrophoresis detection：The μ L of step (3) pcr amplification product 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample
In on 1.5% Ago-Gel, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, after electrophoresis terminates, containing 0.5 μ g/
Dyed in the mL EB aqueous solution 30 minutes, then train and taken a picture on the clear automatic gel image analysis instrument of JS-380A in Shanghai.
According to the method described above, to 20 Flowering Cherry Cultivars, (numbering 1~20 represents Flowering Cherry Cultivars and is followed successively by respectively：1st, red large bamboo hat with a conical crown and broad brim
(C.serrulata ' Benigasa '), 2, red magnificent (C.serrulata ' Kouka '), 3, one leaf (C.serrulata
' Hisakura '), 4, the good fortune green longevity (C.serrulata ' Contorta '), 5, it is Samantabhadra as (C.serrulata ' Albo-
Rosea '), 6, Song Yue (C.serrulata ' Superba '), 7, root tuber of aromatic turmeric (C.serrulata ' Grandifora '), 8, Hong Feng
(Cerasus × sieboldii ' Beni-yutaka '), 9, Yu Yihuang (C.serrulata ' Gioiko '), 10, frontier passes and mountains
(C.serrulata ' Kanzan '), 11, big hand lamp (C.serrulata ' Ojochin '), 12, the red branch of eightfold hang down
(C.spachiana ' Plena Rosea '), 13, the former brave tail (C.serrulata ' Albo Plena ') in city, a 14, Misaki Ji
(Cerasus × yedoensis ' Sakuyahime '), 15, rosefinch (C.serrulata ' Shujaku '), 16, poplar highest-ranking imperial concubine
(C.serrulata ' Mollis '), 17, rain condition branch vertical (C.spachiana ' Ujou-shidare '), 18, the vertical cherry of chrysanthemum
(C.serrulata ' Plena-pendula '), 19, the open country younger sister back of the body (C.serrulata ' Imose '), 20, rising sun mountain cherry
The PCR AFLP systems of (C.serrulata ' Asahiyama ') carry out electrophoresis detection, as a result see Fig. 1.
A clear bright, stable molecule has been amplified in the Flowering Cherry Cultivars for being only wherein 13 from numbering " the former brave tail in city "
Amount is about the specific DNA band of many sizes of 300bp, and the Flowering Cherry Cultivars of remaining numbering, there are no the special of many sizes of 300bp
DNA bands are produced, and also do not have other non-purpose bands to produce, it is seen that the molecular specificity marker that the present invention is developed is used for oriental cherry
The identification of kind " the former brave tail in city ", its stability, specificity are very high.
Claims (3)
1. the molecular specificity labeled primers of Flowering Cherry Cultivars " the former brave tail in city ", the primer sequence is as follows：
Sense primer：5′-AGCGGCCGCCCCTAGATCAGTA-3′；
Anti-sense primer：5′-CGGCCGCCCCGCAAAGAT-3′.
2. a kind of molecular specificity labeled primers using described in claim 1 are quickly reflected to Flowering Cherry Cultivars " the former brave tail in city "
Fixed method, methods described is：The genomic DNA of Flowering Cherry Cultivars blade to be measured is extracted as template, with the molecular specificity
Labeled primer enters performing PCR amplification, electrophoresis detection is carried out to amplified production, if electrophoresis result occurs 310bp's as amplimer
Specific DNA band, then Flowering Cherry Cultivars to be measured are " city former brave tail ", on the contrary then no；The molecular specificity labeled primers sequence is：
Sense primer：5′-AGCGGCCGCCCCTAGATCAGTA-3′；
Anti-sense primer：5′-CGGCCGCCCCGCAAAGAT-3′；
The PCR amplification conditions are as follows：95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 65 DEG C of annealing 40s, 72 DEG C of extension 2min,
Totally 35 circulations；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
3. method as claimed in claim 2, it is characterised in that methods described is as follows：
(1) oriental cherry blade to be measured is taken, liquid feeding nitrogen is ground, the genomic DNA of oriental cherry blade to be measured is extracted with SDS-CTAB methods；
(2) genomic DNA using step (1) extraction, using the molecular specificity labeled primers as amplimer, enters as template
Performing PCR is expanded：
The every 25 μ L compositions of PCR amplification system are as follows：
PCR amplification conditions are as follows：
95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 65 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 35 circulations；Most after 72 DEG C
Filling-in 7min, final temperature is 4 DEG C；
(3) the μ L of step (2) amplified production 5 are taken, are mixed with 1 μ L0.25% bromjophenol blues buffer solution, point sample coagulates in 1.5% agarose
On glue, the electrophoresis in 1 × TAE buffer solutions, under 5V/cm voltages, electrophoresis terminates rear EB dyeing, on automatic gel image analysis instrument
Photograph, if 310bp DNA bands occurs in electrophoresis result, Flowering Cherry Cultivars to be measured are " the former brave tail in city ", on the contrary then no.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019011.9A CN104593364B (en) | 2015-01-14 | 2015-01-14 | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019011.9A CN104593364B (en) | 2015-01-14 | 2015-01-14 | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104593364A CN104593364A (en) | 2015-05-06 |
| CN104593364B true CN104593364B (en) | 2017-09-19 |
Family
ID=53119419
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510019011.9A Active CN104593364B (en) | 2015-01-14 | 2015-01-14 | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104593364B (en) |
-
2015
- 2015-01-14 CN CN201510019011.9A patent/CN104593364B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| RAPD、SRAP和ISSR标记在香菇种质资源的应用及其SCAR标记的建立;应正河;《中国优秀博硕士学位论文全文数据库（硕士） 农业科技辑》;20061215(第12期);摘要，第58页-75页第六章 * |
| 樱属观赏品种资源调查及部分种与品种SSR分析;张琼;《中国优秀硕士学位论文全文数据库》;20140215;第77页3.1.3至第79页3.1.4，第80页表格3-1，表3-2，第88页第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104593364A (en) | 2015-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108660136A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN108034754B (en) | Method for identifying new variety of purple tea trees by SSR fingerprint | |
| CN104099414B (en) | Utilize the method for SSR molecular marker identification apricot cultivars | |
| CN107557369A (en) | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method | |
| CN103966210B (en) | The mark combination of peach SSAP molecular labeling primer sets splitting or integrating and the application on Peach cultivars analysis of genetic diversity thereof | |
| CN109868328B (en) | SSR molecular marker for identifying paeonia rockii varieties and application | |
| CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
| CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN109706262A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN104593364B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " | |
| CN104673913B (en) | The molecular specificity labeled primers and detection method of a Flowering Cherry Cultivars " Misaki Ji " | |
| CN104593366B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " chrysanthemum hang down cherry " | |
| CN104694636B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " | |
| CN104762384B (en) | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch | |
| CN104611426B (en) | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch | |
| CN104611330B (en) | The molecular specificity labeled primers of Flowering Cherry Cultivars " red rich " and " the former brave tail in city " | |
| CN108754015A (en) | Specific molecular marker PCMI-F001 for Cathay poplar female seedling Rapid identification | |
| CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
| CN104593368B (en) | The molecular specificity labeled primers that the red branch of Flowering Cherry Cultivars eightfold hangs down and rain condition branch hangs down | |
| CN110241246B (en) | Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof | |
| CN107385052A (en) | For identifying STR primers and its application of Eucalyptus clone | |
| CN108410967B (en) | A kind of method of Rapid identification river camellia tradition famous-object | |
| CN108676908B (en) | Rose of Sharon kind Bu Like, promise Wood No.1, Sang Qiaoyue, promise Wood two molecular specificity labeled primers and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191225 Address after: 314413 No.9 Lianbao Road, Qianjiang Industrial Park, Dingqiao Town, Haining City, Jiaxing City, Zhejiang Province Patentee after: Haining Qianjiang Xingye Investment Development Co., Ltd Address before: 323000 Xueyuan Road, Liandu, Zhejiang, No. 1, Patentee before: Lishui University |
|
| TR01 | Transfer of patent right |