CN110241246B - Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof - Google Patents
Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof Download PDFInfo
- Publication number
- CN110241246B CN110241246B CN201910624851.6A CN201910624851A CN110241246B CN 110241246 B CN110241246 B CN 110241246B CN 201910624851 A CN201910624851 A CN 201910624851A CN 110241246 B CN110241246 B CN 110241246B
- Authority
- CN
- China
- Prior art keywords
- liriodendron
- seq
- amplification
- primer
- dna barcode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer pair for amplifying a trembling poplar DNA bar code and an identification method of trembling poplar and a seed source thereof, belonging to the technical field of plant molecular identification, wherein the primer pair for amplifying the trembling poplar DNA bar code comprises an upstream amplification primer and a downstream amplification primer; the sequence of the upstream amplification primer is shown as SEQ ID No. 1; the sequence of the downstream amplification primer is shown as SEQ ID No. 2. The liriodendron identification method provided by the invention comprises the following steps: 1) extracting the whole genome DNA of a sample to be detected; 2) using the whole genome DNA as a template, and carrying out PCR amplification by using the DNA barcode primer pair to obtain an amplification product; 3) and sequencing the amplification product to obtain specific sequence information of the amplification product, comparing the specific sequence information with a DNA barcode standard sequence of the tulip tree to determine the tree species and the region seed source of the sample to be detected.
Description
Technical Field
The invention belongs to the technical field of plant molecular identification, and particularly relates to a primer pair for amplifying a DNA bar code of liriodendron, and an identification method of the liriodendron and a seed source thereof.
Background
Liriodendron chinense (Hemsl.) Sarg.) belongs to the family Magnoliaceae (Magnolia) of Liriodendron L, and is a perennial deciduous tree species. The flower and leaf of liriodendron are beautiful and have high ornamental value; fast growing, straight wood and fine material, and is a good tree species for wood and a potential energy plant. Plants of the genus liriodendron were once widely distributed in the temperate regions of the northern hemisphere, and later influenced by climatic swings starting at the end of the third era, and are currently distributed only in small parts of east asia and north america, and differentiated into liriodendron and liriodendron tulipifera (l. The liriodendron tulipifera is distributed in broadleaf forest regions in the eastern part of the United states, is a dominant species and a pioneer tree species in southern forest regions of Abalaya, and has strong ecological adaptability. The liriodendron is scattered in subtropical zones of China and extends to mountain areas in the northern part of Vietnam, is poor in natural renewal, and is listed as a second-grade rare or endangered protective plant in China.
The long-term geographical isolation of the northeast China of liriodendron tulipifera and the environmental difference of the northeast China (a few tropical zones and typical subtropical zones) lead to the formation of local adaptability and obvious genetic difference, so the identification, conservation and hybridization of liriodendron tulipifera all need to consider the problem of provenance source. The existing research results show that the liriodendron from the provenance in tropical regions has advantages in growth cycle and high growth; meanwhile, the heterosis of the hybrid liriodendron depends on the close relationship between the selected liriodendron source and the liriodendron tulipifera source, and genetic analysis shows that the east liriodendron source is closer to the liriodendron tulipifera source. However, as the demand for the liriodendron tulipifera increases and the radius of human activities increases in recent decades, cross-regional introduction and planting interfere with the judgment of liriodendron sources in the protection and utilization processes to a certain extent, so that the genetic identification of the liriodendron seed source place has great significance for the comprehensive preservation of liriodendron germplasm resources and the full utilization of hybrid vigor.
Traditional classification identification mostly depends on differences of phenotypic characteristics, but morphological marker variation is large, and an integral plant tissue part is generally required; in recent years, the emergence of SSR molecular markers has solved some of the problems of identification of liriodendron chinense, liriodendron tulipifera and hybrid liriodendron tulipifera to some extent, but the identification dimension in the liriodendron species is not sufficient, and a large number of primer pairs are required to be used in combination.
Disclosure of Invention
In view of the above, the present invention aims to provide a primer pair for amplifying a DNA barcode of a liriodendron, and an identification method of the liriodendron and its provenance, so as to be used for rapid and accurate molecular detection and identification of the liriodendron provenance, and solve the problems of unclear liriodendron source, blindness in hybridization breeding, and the like.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a primer pair for amplifying a trembling poplar DNA bar code, which comprises an upstream amplification primer and a downstream amplification primer; the sequence of the upstream amplification primer is shown as SEQ ID No. 1; the sequence of the downstream amplification primer is shown as SEQ ID No. 2.
The invention provides an identification method of Chinese tulip trees, which comprises the following steps:
1) extracting the whole genome DNA of a sample to be detected;
2) taking the whole genome DNA obtained in the step 1) as a template, and carrying out PCR amplification by using the DNA barcode primer pair to obtain an amplification product;
3) sequencing the amplification product to obtain specific sequence information of the amplification product,
comparing the specific sequence information of the amplification product with a trembling poplar DNA barcode standard sequence, wherein if the matched basic groups at 86bp, 166bp and 235bp of the amplification product and the trembling poplar DNA barcode standard sequence are consistent and are A, C, A respectively, the sample to be detected is trembling poplar;
if the matched bases of the amplification product and 86bp, 166bp and 235bp of the DNA barcode standard sequence of the liriodendron are G, T, C respectively, determining that the sample to be detected is the liriodendron;
if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are G, T, C respectively and the matched base of the amplification product and the 159bp position of the trembling poplar DNA barcode standard sequence is A, the sample to be detected is eastern trembling poplar seed source;
if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are respectively G, T, C, and the matched base of the amplification product and the 159bp position of the trembling poplar DNA barcode standard sequence is G, the sample to be detected is a trembling poplar western seed source;
if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are G, T, C respectively, the matched bases of the amplification product and 375 bp-382 bp positions of the trembling poplar DNA barcode standard sequence are continuous 8A, and the matched base of 383bp position is not A, the sample to be detected is a trembling poplar tropical provenance;
the DNA barcode standard sequence of the liriodendron tulipifera is shown as SEQ ID No. 3;
the DNA barcode standard sequence of the trembling poplar is shown as SEQ ID No.4, SEQ ID No.5 or SEQ ID No. 6.
Preferably, the PCR amplification system in the step 2) comprises 2 xTaq PCR Master Mix10 muL, 20-40 ng/L whole genome DNA2.0 muL, 10 mumol/L upstream amplification primer 0.6 muL, 10 mumol/L downstream amplification primer 0.6 muL, ddH by 20 muL2O 6.8μL。
Preferably, the procedure of PCR amplification in step 2) includes: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 40s, annealing at 59 ℃ for 40s, and extension at 72 ℃ for 40s, for 33 cycles; extension at 72 ℃ for 6 min.
Preferably, the sequence of the primer sequenced in the step 3) is shown as SEQ ID No. 1.
Preferably, the DNA barcode standard sequence of eastern liriodendron source is shown in SEQ ID No. 4.
Preferably, the DNA barcode standard sequence of the western liriodendron source is shown as SEQ ID No. 5.
Preferably, the DNA barcode standard sequence of the tropical trembling poplar seed source is shown as SEQ ID No. 6.
The invention has the beneficial effects that: the amplified trembling poplar DNA barcode primer pair provided by the invention can perform specific amplification on trembling poplar whole genome DNA, and the sequence obtained by amplifying the DNA barcode primer pair can distinguish the seed source of the trembling poplar; the method for identifying the liriodendron provided by the invention can accurately identify specific species of the liriodendron, including liriodendron tulipifera and liriodendron, and can identify eastern provenance, western provenance and tropical provenance in the liriodendron by amplifying the pair of DNA barcode primers. The liriodendron and the identification method provided by the invention are simple to operate and high in accuracy.
Drawings
FIG. 1 is an agarose electrophoresis pattern of PCR amplification products of samples No. 41 to 56 in example 1, wherein the leftmost and rightmost lanes are Takara DL2000 DNA markers, and the samples No. 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 and 56 are sequentially numbered from left to right from the second lane;
FIG. 2 is a sequence alignment chart of samples No. 10 to 15 in example 1 with DNA barcode sequences (SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5) in the region of 80 to 155bp (upper) and the region of 160 to 240bp (lower);
FIG. 3 is a sequence alignment chart of samples numbered 73 to 78 in example 2 with DNA barcode sequences (SEQ ID No.4 and SEQ ID No.5) in a region of 140 to 215 bp;
FIG. 4 is a sequence alignment chart of samples Nos. 24 to 26 and 100 to 102 in example 3 with DNA barcode sequences (SEQ ID Nos. 5 and 6) in the region of 320 to 395 bp.
Detailed Description
The invention provides a primer pair for amplifying a trembling poplar DNA bar code, which comprises an upstream amplification primer and a downstream amplification primer; the sequence of the upstream amplification primer is shown as SEQ ID No. 1; the sequence of the downstream amplification primer is shown as SEQ ID No. 2; the method comprises the following specific steps:
Liriodendron barcoding F：AGCGGATATAGGAAGTGTTGT；
Liriodendron barcoding R：TGGATAGAGCCCTAATGG。
in the invention, the amplified liriodendron DNA barcode primer pair is obtained by comparing a large amount of DNA sequence information of liriodendron, selecting a trnK5 '-matK region from a liriodendron chloroplast genome and designing by using Oligo6 software, wherein the trnK 5' -matK region of the liriodendron chloroplast genome has specific sequence information sites with species and seed source characteristics, and the amplified liriodendron DNA barcode primer pair is used as DNA barcodes for identifying the liriodendron and different seed sources.
The invention also provides an identification method of the liriodendron, which comprises the following steps: 1) extracting the whole genome DNA of a sample to be detected; 2) taking the whole genome DNA obtained in the step 1) as a template, and carrying out PCR amplification by using the DNA barcode primer pair to obtain an amplification product; 3) sequencing the amplification product to obtain specific sequence information of the amplification product, comparing the specific sequence information of the amplification product with a DNA barcode standard sequence of the liriodendron tulipifera, and if the matched basic groups at 86bp, 166bp and 235bp of the amplification product and the DNA barcode standard sequence of the liriodendron tulipifera are consistent and are A, C, A respectively, determining that the sample to be detected is the liriodendron tulipifera; if the matched bases of the amplification product and 86bp, 166bp and 235bp of the DNA barcode standard sequence of the liriodendron are G, T, C respectively, determining that the sample to be detected is the liriodendron; if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are G, T, C respectively and the matched base of the amplification product and the 159bp position of the trembling poplar DNA barcode standard sequence is A, the sample to be detected is eastern trembling poplar seed source; if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are respectively G, T, C, and the matched base of the amplification product and the 159bp position of the trembling poplar DNA barcode standard sequence is G, the sample to be detected is a trembling poplar western seed source; if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are G, T, C respectively, the matched bases of the amplification product and 375 bp-382 bp positions of the trembling poplar DNA barcode standard sequence are continuous 8A, and the matched base of 383bp position is not A, the sample to be detected is a trembling poplar tropical provenance; the DNA barcode standard sequence of the liriodendron tulipifera is shown as SEQ ID No. 3; the DNA barcode standard sequence of the trembling poplar is shown as SEQ ID No.4, SEQ ID No.5 or SEQ ID No. 6.
In the present invention, the whole genome DNA of a sample to be tested is first extracted. The whole genome extraction method has no special requirements, and a conventional whole genome DNA extraction method in the field can be adopted, and in the specific implementation process of the invention, the whole genome DNA extraction method is a CTAB method or a DNA kit. In the present invention, the sample source for whole genome DNA extraction includes but is not limited to fresh samples such as terminal bud, young leaf, old leaf, root, bark, etc. of Liriodendron, as well as ultra-low temperature preserved tissue and silica gel dried sample.
After the whole genome DNA is extracted and obtained, the purity and the concentration of the whole genome DNA are preferably detected; OD of the Whole genome DNA260/OD280The value is preferably 1.8-2.0, and the method has no special requirement on the concentration of the whole genome DNA and can meet the requirement of PCR amplification. The concentration and purity measurements described in the present invention are preferably performed using dropnap.
After the whole genome DNA is obtained, the obtained whole genome DNA is used as a template, and the DNA barcode primer pair is used for PCR amplification to obtain an amplification product. In the invention, the PCR amplification system is calculated by 20 mu L, preferably comprises 2 xTaq PCR Master Mix10 mu L, 20-40 ng/L whole genome DNA2.0 mu L, 10 mu mol/L upstream amplification primer 0.6 mu L, 10 mu mol/L downstream amplification primer 0.6 mu L, ddH2O6.8 mu L; the procedure for PCR amplification preferably comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 40s, annealing at 59 ℃ for 40s, and extension at 72 ℃ for 40s, for 33 cycles; extension at 72 ℃ for 6 min.
After the amplification product is obtained, the amplification product is sequenced to obtain the specific sequence information of the amplification product. In the invention, the sequencing is direct sequencing, and the sequence of a sequencing primer is shown as SEQ ID No. 1; in the present invention, the sequencing is preferably performed by a single-pass sequencing method by Biotechnology.
After the specific sequence information of the amplification product is obtained, the specific sequence information is compared with a DNA barcode sequence, the specific sequence information of the amplification product is compared with a DNA barcode standard sequence, and the tree species and the regional seed source of the sample to be detected are determined.
In the invention, the DNA barcode standard sequence of the liriodendron is preferably shown as SEQ ID No.4, SEQ ID No.5 or SEQ ID No. 6; the DNA barcode standard sequence of eastern liriodendron source is preferably shown in SEQ ID No. 4; the DNA barcode standard sequence of the western liriodendron source is preferably shown as SEQ ID No. 5; the DNA barcode standard sequence of the tropical liriodendron source is preferably shown as SEQ ID No. 6.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Liriodendron tulipifera and Liriodendron tulipifera were collected over the entire distribution area of Liriodendron, and 120 samples in total (sample No. 1-120) were collected. The information on the sample sources and the like is shown in Table 1.
These samples were identified using the DNA barcode primer pairs and methods of the invention.
The method comprises the following specific steps:
1) extracting the whole genome DNA of the tender leaf of the sample to be detected by using an improved CTAB method.
2) And carrying out PCR amplification by using the obtained whole genome DNA as a template and the DNA barcode primer pair to obtain an amplification product. The PCR amplification system is calculated by 20 mu L and comprises 2 XTaq PCR Master Mix10 mu L, 20-40 ng/L whole genome DNA2.0 mu L, 10 mu mol/L upstream amplification primer 0.6 mu L, 10 mu mol/L downstream amplification primer 0.6 mu L and ddH2O6.8 mu L; amplified by PCRThe program comprises the following steps: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 40s, annealing at 59 ℃ for 40s, and extension at 72 ℃ for 40s, for 33 cycles; extension at 72 ℃ for 6 min.
3) And (3) taking the sequence shown in SEQ ID No.1 as a sequencing primer, entrusting a biotechnology company to perform one-way sequencing, and obtaining a sequencing result of an amplification product.
The sequencing results were compared to the DNA barcode to identify Liriodendron and different seed sources.
As a result, the bases of the amplified product sequences of the samples No.1 to No. 12 at 86bp, 166bp and 235bp are respectively A, C and A, and the amplified product sequences are consistent with the standard sequence SEQ ID No.3 of the DNA barcode of the liriodendron tulipifera, so the samples No.1 to No. 12 are identified as the liriodendron tulipifera. The source of the comparative sample shows that the No.1 to No. 12 samples are all collected liriodendron tulipifera, and the identification accuracy rate of the DNA barcode provided by the invention is 100%. The bases of the sequence obtained by amplifying sample No. 13-120 at 86bp, 166bp and 235bp are G, T and C respectively, and all information sites are consistent with the standard sequence of the DNA barcode of the liriodendron provided by the invention, such as SEQ ID No.4 or SEQ ID No.5, so that the liriodendron is completely identified as the liriodendron. The source of the comparison sample shows that 13-120 samples are all liriodendron, and the identification accuracy of the bar code is 100%. FIG. 2 is a sequence alignment chart of the sample No. 10-15 and DNA barcode sequences (SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5) in the region of 80-155 bp (upper part) and the region of 160-240 bp (lower part); the bar code can be effectively used for distinguishing and identifying liriodendron tulipifera and liriodendron tulipifera, and the identification accuracy rate is 100%.
Example 2:
43 seed sources 153 individuals (sample numbers 13-164) in the total distribution area of the liriodendron are collected, the maximum distribution area range of the liriodendron is covered, and relevant information such as sample sources and the like are shown in table 1. All individuals collected young leaves and stored by drying on silica gel.
1) The total DNA extraction of the liriodendron is carried out by using an improved CTAB method.
2) And carrying out PCR amplification by using the obtained whole genome DNA as a template and the DNA barcode primer pair to obtain an amplification product. The PCR amplification system is calculated by 20 mu L and comprises 2 XTaq PCR Master Mix10 mu L, 2.0 mu L of 20-40 ng/L whole genome DNA and 10 mu m0.6 μ L of upstream amplification primer and 0.6 μ L of 10 μmol/L of downstream amplification primer, ddH2O6.8 mu L; the procedure for PCR amplification includes: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 40s, annealing at 59 ℃ for 40s, and extension at 72 ℃ for 40s, for 33 cycles; extension at 72 ℃ for 6 min.
3) And (3) taking the sequence shown in SEQ ID No.1 as a sequencing primer, entrusting a biotechnology company to perform one-way sequencing, and obtaining a sequencing result of an amplification product.
The sequencing results were compared to the DNA barcode to identify Liriodendron and different seed sources.
As a result, the 159bp bases of the 27-75 samples are all A and are consistent with the standard sequence SEQ ID No.4 of the east seed DNA barcode, so that the samples are identified as the east seed of the liriodendron. And all the bases G of the No. 13-26 samples and the No. 76-164 samples at 159bp are consistent with the standard sequence SEQ ID No.5 of the western seed source, so that the No. 13-26 samples and the No. 76-164 samples are all identified as the western seed source. The control sample sources show that the 27-75 samples are all from the eastern region of the liriodendron distribution area, and the 13-26 samples and the 76-164 samples are all from the western region of the liriodendron distribution area, so that the identification accuracy of the bar code is 100%. The sequence alignment of the sample No. 73-78 with DNA barcode sequences (SEQ ID No.4 and SEQ ID No.5) in the region of 140-215 bp is shown in FIG. 3.
Example 3:
the sample source and procedure were the same as in example 2.
Sequencing and sequence comparison results show that 8A base repeats appear in samples 13-26 from 375bp, the samples are consistent with the standard sequence SEQ ID No.6 of the tropical trelago tulip provenance of the invention and are identified as tropical provenance, and the rest samples are all 9A base repeats from 375 bp. The sequence alignment chart of the samples No. 24-26 and No. 100-102 and DNA barcode sequences (SEQ ID No.5 and SEQ ID No.6) in the region of 320-395 bp is shown in FIG. 4, the sources of the control samples show that the samples No. 13-26 are all from tropical regions, and the rest samples are all from subtropical regions. Thus, the identification accuracy of the bar code of the present invention was 100%.
From the above examples, it can be seen that the method for identifying trembling poplar and its seed source using the primer pair for amplifying trembling poplar DNA barcode and the identification method for trembling poplar of the present invention is 100% accurate. The invention provides powerful support for the preservation and conservation of the liriodendron and crossbreeding. The method for identifying the liriodendron source and the liriodendron source has the advantages of simple operation and high accuracy.
TABLE 1 sample sources and like information
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> institute of biological resources of academy of sciences of Jiangxi province
<120> primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and its seed source
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agcggatata ggaagtgttg t 21
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tggatagagc cctaatgg 18
<210> 3
<211> 534
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agcggatata ggaagtgttg ttgcctagat ctatctattt ctaaatatcc ttgtaattcc 60
tccatttgaa attatacaaa ggcacagggg atttcttggg ttatcaaatg atacatagtg 120
cgatacggtc agaacaaggt atatagtaag aaaagaatag ataccccgga gacagggagt 180
ccaatcaacg gatcctctct ctttccatcc aatttgtttg tgttcgttat agttacaaga 240
gatggttaga aatcctttat ttttgcaacc cgatcgctct tttgactttg gaataaattc 300
tctttatcag tataccgttt cttctacaca ttcgtctcca ctccataata gagaaagaat 360
agttaggatt catgaaaaaa aaaagaatcg atgatccact cacaggagaa ccctttcccg 420
catcaggcac taatctattt ttaacgtcta attagatcgg gtaatcattt gaattatgaa 480
ccgagctcgt tgcttttggt ttccttataa ttggagccat tagggctcta tcca 534
<210> 4
<211> 534
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agcggatata ggaagtgttg ttgcctagat ctatctattt ctaaatatcc ttgtaattcc 60
tccatttgaa attatacaaa ggcacggggg atttcttggg ttatcaaatg atacatagtg 120
cgatacggtc agaacaaggt atatagtaag aaaagaatag atacctcgga gacagggagt 180
ccaatcaacg gatcctctct ctttccatcc aatttgtttg tgttcgttat agttccaaga 240
gatggttaga aatcctttat ttttgcaacc cgatcgctct tttgactttg gaataaattc 300
tctttatcag tataccgttt cttctacaca ttcgtctcca ctccataata gagaaagaat 360
agttaggatt catgaaaaaa aaaggaatcg atgatccact cacaggagaa ccctttcccg 420
catcaggcac taatctattt ttaacgtcta attagatcgg gtaatcattc gaattatgaa 480
ccgagctcgt tgcttttggt ttccttataa ttggagccat tagggctcta tcca 534
<210> 5
<211> 525
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
agcggatata ggaagtgttg ttgcctagat ctatctattt ctaaatatcc ttgtaattcc 60
tccatttgaa attatacaaa ggcacggggg atttcttggg ttatcaaatg atacatagtg 120
cgatacggtc agaacaaggt atatagtaag aaaagaatgg atacctcgga gacagggagt 180
ccaatcaacg gatcctctct ctttccatcc aatttgtttg tgttcgttat agttccaaga 240
gatggttaga aatcctttat ttttgcaacc cgatcgctct tttgactttg gaataaattc 300
tctttatcag tataccgttt cttctacaca ttcgtctcca ctccataata gagaaagaat 360
agttaggatt catgaaaaaa aaaggaatcg atgatccaga accctttccc gcatcaggca 420
ctaatctatt tttaacgtct aattagatcg ggtaatcatt cgaattatga accgagctcg 480
ttgcttttgg tttccttata attggagcca ttagggctct atcca 525
<210> 6
<211> 524
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agcggatata ggaagtgttg ttgcctagat ctatctattt ctaaatatcc ttgtaattcc 60
tccatttgaa attatacaaa ggcacggggg atttcttggg ttatcaaatg atacatagtg 120
cgatacggtc agaacaaggt atatagtaag aaaagaatgg atacctcgga gacagggagt 180
ccaatcaacg gatcctctct ctttccatcc aatttgtttg tgttcgttat agttccaaga 240
gatggttaga aatcctttat ttttgcaacc cgatcgctct tttgactttg gaataaattc 300
tctttatcag tataccgttt cttctacaca ttcgtctcca ctccataata gagaaagaat 360
agttaggatt catgaaaaaa aaggaatcga tgatccagaa ccctttcccg catcaggcac 420
taatctattt ttaacgtcta attagatcgg gtaatcattc gaattatgaa ccgagctcgt 480
tgcttttggt ttccttataa ttggagccat tagggctcta tcca 524
Claims (5)
1. The application of an amplified DNA barcode primer pair in identifying the liriodendron, which is characterized in that the primer pair comprises an upstream amplification primer and a downstream amplification primer; the sequence of the upstream amplification primer is shown as SEQ ID No. 1; the sequence of the downstream amplification primer is shown as SEQ ID No. 2;
when the liriodendron tulipifera is liriodendron tulipifera, the standard sequence obtained by amplification of the primer is shown as SEQ ID No. 3;
when the liriodendron is an east-China liriodendron seed source, the standard sequence obtained by amplification of the primer is shown as SEQ ID No. 4;
when the trembling poplar is a western seed source of the trembling poplar, the standard sequence obtained by amplifying the primer is shown as SEQ ID No. 5;
when the trembling poplar is a tropical seed source of the trembling poplar, the standard sequence obtained by amplifying the primer is shown as SEQ ID No. 6.
2. A method for identifying trembling poplar and its seed source comprises the following steps:
1) extracting the whole genome DNA of a sample to be detected;
2) performing PCR amplification by using the whole genome DNA obtained in the step 1) as a template and using the DNA barcode primer pair described in claim 1 to obtain an amplification product;
3) sequencing the amplification product to obtain specific sequence information of the amplification product, comparing the specific sequence information of the amplification product with a DNA barcode standard sequence of the liriodendron tulipifera, and if the matched basic groups at 86bp, 166bp and 235bp of the amplification product and the DNA barcode standard sequence of the liriodendron tulipifera are consistent and are A, C, A respectively, determining that the sample to be detected is the liriodendron tulipifera;
if the matched bases of the amplification product and 86bp, 166bp and 235bp of the DNA barcode standard sequence of the Chinese tulip tree are G, T, C respectively, determining that the sample to be detected is the Chinese tulip tree;
if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the DNA barcode standard sequence of the liriodendron are G, T, C respectively and the matched base of the amplification product and the 159bp position of the DNA barcode standard sequence of the liriodendron is A, the sample to be detected is an eastern liriodendron provenance;
if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are respectively G, T, C, and the matched base of the amplification product and the 159bp position of the trembling poplar DNA barcode standard sequence is G, the sample to be detected is a western trembling poplar seed source;
if the matched bases of the amplification product and 86bp, 166bp and 235bp positions of the trembling poplar DNA barcode standard sequence are G, T, C respectively, the matched bases of the amplification product and 375 bp-382 bp positions of the trembling poplar DNA barcode standard sequence are continuous 8A, and the matched base of 383bp position is not A, the sample to be detected is a tropical provenance of the trembling poplar;
the DNA barcode standard sequence of the liriodendron tulipifera is shown as SEQ ID No. 3;
the DNA barcode standard sequence of the Chinese tulip tree is shown as SEQ ID No.4, SEQ ID No.5 or SEQ ID No. 6.
3. The method for identifying tulip tree and its seed source as claimed in claim 2, wherein the PCR amplification system in step 2) comprises 2 XTaq PCR Master Mix10 μ L, 20-40 ng/L whole genome DNA2.0 μ L, 10 μmol/L upstream amplification primer 0.6 μ L, 10 μmol/L downstream amplification primer 0.6 μ L, ddH2O 6.8 μ L in 20 μ L.
4. The method for identifying trembling poplar and its source as claimed in claim 2 or 3, wherein the PCR amplification process in step 2) comprises: pre-denaturation at 95 ℃ for 4 min; denaturation at 95 ℃ for 40s, annealing at 59 ℃ for 40s, and extension at 72 ℃ for 40s, for 33 cycles; extension at 72 ℃ for 6 min.
5. The method for identifying trembling poplar and its source as claimed in claim 2, wherein the sequence of the primer sequenced in step 3) is shown as SEQ ID No. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910624851.6A CN110241246B (en) | 2019-07-11 | 2019-07-11 | Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910624851.6A CN110241246B (en) | 2019-07-11 | 2019-07-11 | Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110241246A CN110241246A (en) | 2019-09-17 |
| CN110241246B true CN110241246B (en) | 2022-04-12 |
Family
ID=67891892
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910624851.6A Active CN110241246B (en) | 2019-07-11 | 2019-07-11 | Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110241246B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660196A (en) * | 2018-05-23 | 2018-10-16 | 南京林业大学 | A kind of identification method of hybridized Chinese tuliptree affiliation |
| CN108660250A (en) * | 2018-05-21 | 2018-10-16 | 南京林业大学 | A kind of identification method of Liriodendron standing forest offspring seeds type |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2876378B1 (en) * | 2004-10-08 | 2007-01-05 | Univ Joseph Fourier Etablissem | UNIVERSAL PRIMERS AND THEIR USE FOR THE DETECTION AND IDENTIFICATION OF PLANTS IN COMPLEX MIXTURES |
-
2019
- 2019-07-11 CN CN201910624851.6A patent/CN110241246B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108660250A (en) * | 2018-05-21 | 2018-10-16 | 南京林业大学 | A kind of identification method of Liriodendron standing forest offspring seeds type |
| CN108660196A (en) * | 2018-05-23 | 2018-10-16 | 南京林业大学 | A kind of identification method of hybridized Chinese tuliptree affiliation |
Non-Patent Citations (5)
| Title |
|---|
| and maturase K (matK) gene, partial cds * |
| chloroplast.《GenBank: MH717148.1》.2019, * |
| New insight into the phylogeographic pattern of Liriodendron chinense (Magnoliaceae) revealed by chloroplast DNA: east–west lineage split and genetic mixture within western subtropical China;Aihong Yang等;《Peer J》;20190201;摘要、表2 * |
| Phylogenetic relationships of the Magnoliaceae inferred from cpDNA matK sequences;S. Shi等;《Theor Appl Genet》;20001231;925–930 * |
| Yang,A.等.Liriodendron tulipifera isolate c6 tRNA-Lys (trnK) gene, partial sequence * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110241246A (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108034754B (en) | Method for identifying new variety of purple tea trees by SSR fingerprint | |
| CN112029894B (en) | SSR-labeled fingerprint of sabina pterata as well as construction method and application thereof | |
| CN110878376B (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| CN110241246B (en) | Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof | |
| CN108384885B (en) | Cinnamomum camphora SSR primer combination and variety identification method thereof | |
| CN110484648A (en) | A kind of Indel molecular labeling of the raw inflorescence of the novel single cluster of identification capsicum, primer and application | |
| CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
| CN112725521B (en) | Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof | |
| CN105543219B (en) | Molecular labeling with controlling cucumber epidermal hair/fruit thorniness initial gene Tril close linkages | |
| CN108410967B (en) | A kind of method of Rapid identification river camellia tradition famous-object | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN111733273A (en) | DNA barcode sequence and method for identifying lycium species by using same | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " | |
| CN107974509B (en) | The molecule labelling method of clematis heat resistance gene loci qHR3 | |
| CN106755288B (en) | Molecular identification method of lotus leaf of tongshan | |
| CN104593518B (en) | With Fructus Cucumidis sativi trichome development gene M ict be divided into from molecular marker | |
| CN104593517B (en) | The closely linked molecular labeling with cucumber trichome development gene M ict | |
| CN112159865B (en) | Indel mark related to red rose petals and molecular method for identifying red rose petals | |
| CN111334598B (en) | Molecular marker primer for identifying liquidambar plants, application and identification method thereof | |
| CN110669865B (en) | SSR molecular marker for identifying Thailand lotus germplasm and application | |
| CN104611330B (en) | The molecular specificity labeled primers of Flowering Cherry Cultivars " red rich " and " the former brave tail in city " | |
| CN104673913B (en) | The molecular specificity labeled primers and detection method of a Flowering Cherry Cultivars " Misaki Ji " | |
| CN104694636B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " | |
| CN104593364B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " | |
| CN104762384B (en) | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |