CN104611426B - Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch - Google Patents
Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch Download PDFInfo
- Publication number
- CN104611426B CN104611426B CN201510024044.2A CN201510024044A CN104611426B CN 104611426 B CN104611426 B CN 104611426B CN 201510024044 A CN201510024044 A CN 201510024044A CN 104611426 B CN104611426 B CN 104611426B
- Authority
- CN
- China
- Prior art keywords
- branch
- misaki
- eightfold
- red
- rain condition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a pair of the high Flowering Cherry Cultivars of specificity " the red branch of eightfold hangs down ", " Misaki Ji " and " rain condition branch hangs down " molecular specificity labeled primers, and one kind can be to Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji " and " rain condition branch is vertical " progress Rapid identification method.The primer sequence is as follows：Sense primer：5′‑AGCGGCCGCCGCTAGATGAG‑3′；Anti-sense primer：5′‑AGCGGCCGCCGAGACAAAGA‑3′.Molecular specificity labeled primers of the present invention can be to Flowering Cherry Cultivars " the red branch of eightfold is a vertical ", " Misaki Ji " and the quick Early Identification of " rain condition is hung down " progress, method is that appearance features distinguish the irreplaceable Molecular tools of Flowering Cherry Cultivars simply, fast, accurately.
Description
(1) technical field
The present invention relates to Flowering Cherry Cultivars " the red branch of eightfold a hang down ", " Misaki Ji " and the molecular specificity marker of " rain condition branch is vertical " draw
The side of thing, and utilize the primer pair Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji " and " rain condition branch hangs down " progress Rapid identification
Method.
(2) background technology
Oriental cherry is under the jurisdiction of the rose family (Rosaceae) cherry category (Cerasus), is world-renowned ornamental plant.It is currently known
Flowering Cherry Cultivars have more than 300, because its plant type is graceful, pattern is gorgeous, whole florescence duration is long, there is great application on gardens
Value.In recent years, China various regions large-scale plantation oriental cherry and applied in the greenery patches such as park, school, street, garden, as morning
One of spring main ornamencal flower and tree.The cities such as Beijing, Wuhan, Qingdao, Shanghai are held the Sacura Festival one after another every year, and oriental cherry industry obtains fast
Exhibition is hailed, this promotes increasing peasant income for building beautiful China, promotes Integrated Development of The Mountainous Region and building a New Socialist Countryside,
All tool is of great significance.
China's cherry platymiscium aboundresources, it is widely distributed, and cherry platymiscium phenotype has stronger plasticity, interspecific hybridization is held
Easily, kind is large number of, and Traits change is smaller between some kinds, and traditional form classification is difficult quick, accurate and effective evaluation and area
Point.Academia at present plantation Flowering Cherry Cultivars Name and Description it is all very chaotic, " synonym " or " homonym " phenomenon compared with
For serious, the title of shortage unified standard and the taxonomic hierarchies of scientific system, cultivar identification, popularization, exchange and new product are not easy to
Kind cultivation, therefore need badly and set up a scientific and reasonable Flowering Cherry Cultivars taxonomic identification system.
Flowering Cherry Cultivars investigation and classification just in the whole country is also merely by traditional morphological feature, peroxide at present
The method such as compound enzyme and Esterase Isoenzyme Technique, electron-microscope scanning pollen grain and Q type clusterings, these methods in spite of with, but
It is difficult to carry out correctly identifying and applying to Flowering Cherry Cultivars.And the DNA molecular mark being had been widely used in recent years in plant classification circle
Note technology is not yet applied in the researchs such as Flowering Cherry Cultivars classification, product Interspecific relationship and genetic diversity so far.Therefore,
It is necessary to utilize molecular marking technique means, Flowering Cherry Cultivars existing to China carry out science discriminating, not only facilitate oriental cherry product
The foundation of taxonomic identification system is planted, the also further research for cherry platymiscium resource provides molecule foundation.
It is domestic at present to introduce substantial amounts of Flowering Cherry Cultivars, transplanted extensively in each Grand Duchy such as Beijing, Qingdao, Wuhan, Shanghai,
Ornamental value is high, wherein in the majority with late cherry kind, generally with flower amount is big, pattern is gorgeous, petal is more, florescence length, resistance,
The features such as wide adaptability.We pass through long-term investigation work, it is found that 20 evening cherry kinds include red large bamboo hat with a conical crown and broad brim (Cerasus
Serrulata ' Benigasa '), red magnificent (C.serrulata ' Kouka '), a leaf (C.serrulata ' Hisakura '), good fortune
It is green longevity (C.serrulata ' Contorta '), Samantabhadra as (C.serrulata ' Albo-rosea '), Song Yue (C.serrulata
' Superba '), root tuber of aromatic turmeric (C.serrulata ' Grandifora '), red rich (Cerasus × sieboldii ' Beni-
Yutaka '), Yu Yihuang (C.serrulata ' Gioiko '), frontier passes and mountains (C.serrulata ' Kanzan '), big hand lamp
(C.serrulata ' Ojochin '), the red branch of eightfold hang down (C.spachiana ' Plena Rosea '), the former brave tail in city
(C.serrulata ' Albo Plena '), Misaki Ji (Cerasus × yedoensis ' Sakuyahime '), rosefinch
(C.serrulata ' Shujaku '), poplar highest-ranking imperial concubine (C.serrulata ' Mollis '), the vertical (C.spachiana ' Ujou- of rain condition branch
Shidare '), chrysanthemum hang down cherry (C.serrulata ' Plena-pendula '), open country younger sister the back of the body (C.serrulata ' Imose '), the rising sun
The application of mountain cherry (C.serrulata ' Asahiyama ') in gardens is extremely extensive, but " homonym " of these kinds, " same
Thing different name " phenomenon is also abnormal serious, is difficult to discriminate between in terms of phenotypic characteristic, gives the choosing of Landscape Plants Applied, popularization and new varieties
Educate and bring many difficulties, thus put forth effort to develop these stable varieties from molecular level, special DNA fingerprint mark is only reality
The Scientific Approaches of the accurate Rapid identification of existing Flowering Cherry Cultivars.
(3) content of the invention
It is an object of the present invention to provide Flowering Cherry Cultivars " the red branch of eightfold a hang down ", " Misaki Ji " and " rain condition branch is vertical " molecular specificity
Labeled primer, and one kind can be to Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji " and " rain condition branch hangs down " progress Rapid identification
Method.
The technical solution adopted by the present invention is：
Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji " and the molecular specificity labeled primers of " rain condition branch hangs down ", it is described to draw
Thing sequence is as follows：
Sense primer：5′-AGCGGCCGCCGCTAGATGAG-3′；
Anti-sense primer：5′-AGCGGCCGCCGAGACAAAGA-3′.
The primer pair is to use round pcr, and Flowering Cherry Cultivars " the red branch of eightfold hangs down ", " Misaki are obtained by a large amount of screening tests
After the DNA fragment specific of a Ji " and " rain condition branch hangs down ", the fragment cloning and sequencing is designed based on obtained DNA sequence dna
Flowering Cherry Cultivars are entered performing PCR amplification by specific primer with the specific primer, only " the red branch of eightfold hangs down ", " a Misaki Ji " and " rain condition
Branch hangs down " specific fragment of 519bp sizes can be obtained, other Flowering Cherry Cultivars can not obtain specific fragment.Need explanation
It is that the identification that molecular specificity labeled primers of the present invention are only limitted to Flowering Cherry Cultivars (identifies whether it is " the red branch of eightfold hangs down ", " Misaki
One of a Ji " or " rain condition branch hangs down ", are subsequently further identified again), i.e., testing sample is only limitted to oriental cherry.
The invention further relates to it is a kind of using described molecular specificity labeled primers to Flowering Cherry Cultivars " the red branch of eightfold hang down ",
The method that a " Misaki Ji " and " rain condition branch hang down " carry out Rapid identification, methods described is：Extract the gene of Flowering Cherry Cultivars blade to be measured
DNA is as template for group, using the molecular specificity labeled primers as amplimer, enters performing PCR amplification, amplified production is carried out
Electrophoresis detection, if 519bp specific DNA band occurs in electrophoresis result, Flowering Cherry Cultivars to be measured are Flowering Cherry Cultivars " the red branch of eightfold
Hang down " a, " Misaki Ji " or one of " rain condition branch hang down ", it is on the contrary then no；The molecular specificity labeled primers sequence is：
Sense primer：5′-AGCGGCCGCCGCTAGATGAG-3′；
Anti-sense primer：5′-AGCGGCCGCCGAGACAAAGA-3′.
The inventive method key is that the selection of amplimer, DNA are extracted, PCR reaction systems and reaction condition are determined, with
And electrophoresis detection, it can be carried out according to this area conventional method.
It is preferred that, PCR reaction systems composition of the present invention is as follows：
The PCR amplification conditions are as follows：95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 68 DEG C of annealing 40s, 72 DEG C of extensions
2min, totally 35 circulations；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
PCR Buffer final concentration of 1 ×, refer in PCR Buffer concentration of each component in reaction system with 1 ×
PCR Buffer are identical, generally from 10 × PCR Buffer that volume is reaction system volume 1/10.10×PCR Buffer
Composition is：100mM Tris-HCl(pH 8.5)、500mM KCl、25mM MgCl2And 1.0%Triton-X-100, solvent is
ddH2O。
Specifically, methods described is as follows：
(1) oriental cherry blade to be measured is taken, liquid feeding nitrogen is ground, the genomic DNA of oriental cherry blade to be measured is extracted with SDS-CTAB methods；
(2) genomic DNA using step (1) extraction is template, with the molecular specificity mark
Primer is remembered as amplimer, enters performing PCR amplification：
The every 25 μ L compositions of PCR amplification system are as follows：
PCR amplification conditions are as follows：
95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 40s, 68 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 35 circulations；Most after
72 DEG C of filling-in 7min, final temperature is 4 DEG C；
(3) the μ L of step (2) amplified production 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample is in 1.5% fine jade
On sepharose, the electrophoresis in 1 × TAE buffer solutions, under 5V/cm voltages, electrophoresis terminates rear EB dyeing, in automatic gel images point
Taken a picture in analyzer, if 519bp DNA bands occurs in electrophoresis result, Flowering Cherry Cultivars to be measured are " the red branch of eightfold a hangs down ", " Misaki Ji "
Or one of " rain condition branch hang down ", it is on the contrary then no.
Beneficial effect of the present invention is mainly reflected in：Molecular specificity labeled primers of the present invention can " eightfold be red to Flowering Cherry Cultivars
Branch hangs down " a, " Misaki Ji " and " rain condition branch hang down " carry out quick Early Identification, method is simple, quick, accurately, is that appearance features are distinguished
The other irreplaceable Molecular tools of Flowering Cherry Cultivars.
(4) illustrate
Fig. 1 is the result that Flowering Cherry Cultivars are entered with performing PCR amplification；M is DNA molecular amount standard；Numbering 12,14 and 17 is respectively
Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji " and " rain condition branch hangs down ", have amplified the specific DNA band that molecular weight is 519bp；
Remaining numbering is other Flowering Cherry Cultivars, and the specific DNA band that there are no many sizes of 519bp is produced.
(5) embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
Embodiment 1：
(1) extraction of Flowering Cherry Cultivars genomic DNA：
Flowering Cherry Cultivars young leaflet tablet 0.01g to be measured is taken, liquid feeding nitrogen is thoroughly ground, and the extraction of genomic DNA uses SDS-
CTAB methods, through repeatedly extracting, to extract the genomic DNA crude extract for obtaining Flowering Cherry Cultivars.DNA crude extracts are again through Magabio cores
Sour purification kit is purified after (rich day Bioer, Hangzhou, China), passes through 1.5% agarose gel electrophoresis and DNA/
RNA ultraviolet specrophotometers (GeneQuant Pro, GE Healthcare) detect integrality, purity and concentration.OD260/
OD280>1.8 DNA sample is used for subsequent PCR amplification.DNA extracts are standby in -20 DEG C of refrigerator storages.
(2) specific PCR amplification primer is designed, the sequence of primer pair is：
Sense primer：5 '-AGCGGCCGCCGCTAGATGAG-3 ' and anti-sense primer：5′-
AGCGGCCGCCGAGACAAAGA-3 ', by Shanghai, biotechnology Co., Ltd synthesizes.
(4) PCR is expanded：
PCR reaction solutions are constituted：10 × PCR Buffer, 2.5 μ L, 10mmol/L dNTPs 2.5 μ L, 25mmol/L
MgCl2μ L, the 10mM special primers of 2.5 μ L, 5U/ μ L Taq DNA enzymatics 0.2 are to each 1 μ L, 20ng/ μ L template DNAs 3 μ L, ddH2O is mended
Enough to 25 μ L.
Amplified reaction is carried out on TC-XP type amplification instruments.Amplification condition：95 DEG C of pre-degeneration 3min；95 DEG C are denatured 40s, 68
DEG C annealing 40s, 72 DEG C extension 2min, totally 35 circulation；Most after 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
(4) electrophoresis detection：The μ L of step (3) pcr amplification product 5 are taken, are mixed with the bromjophenol blue buffer solutions of 1 μ L 0.25%, point sample
In on 1.5% Ago-Gel, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, after electrophoresis terminates, containing 0.5 μ g/
Dyed in the mL EB aqueous solution 30 minutes, then train and taken a picture on the clear automatic gel image analysis instrument of JS-380A in Shanghai.
According to the method described above, to 20 Flowering Cherry Cultivars, (numbering 1~20 represents Flowering Cherry Cultivars and is followed successively by respectively：1st, red large bamboo hat with a conical crown and broad brim
(C.serrulata ' Benigasa '), 2, red magnificent (C.serrulata ' Kouka '), 3, one leaf (C.serrulata
' Hisakura '), 4, the good fortune green longevity (C.serrulata ' Contorta '), 5, it is Samantabhadra as (C.serrulata ' Albo-
Rosea '), 6, Song Yue (C.serrulata ' Superba '), 7, root tuber of aromatic turmeric (C.serrulata ' Grandifora '), 8, Hong Feng
(Cerasus × sieboldii ' Beni-yutaka '), 9, Yu Yihuang (C.serrulata ' Gioiko '), 10, frontier passes and mountains
(C.serrulata ' Kanzan '), 11, big hand lamp (C.serrulata ' Ojochin '), 12, the red branch of eightfold hang down
(C.spachiana ' Plena Rosea '), 13, the former brave tail (C.serrulata ' Albo Plena ') in city, a 14, Misaki Ji
(Cerasus × yedoensis ' Sakuyahime '), 15, rosefinch (C.serrulata ' Shujaku '), 16, poplar highest-ranking imperial concubine
(C.serrulata ' Mollis '), 17, rain condition branch vertical (C.spachiana ' Ujou-shidare '), 18, the vertical cherry of chrysanthemum
(C.serrulata ' Plena-pendula '), 19, the open country younger sister back of the body (C.serrulata ' Imose '), 20, rising sun mountain cherry
The PCR AFLP systems of (C.serrulata ' Asahiyama ') carry out electrophoresis detection, as a result see Fig. 1.
It is respectively 12,14 and 17 Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji wherein only from numbering " and " rain condition branch
Hang down " in respectively amplified the specific DNA band that a clear bright, stable molecular weight is about many sizes of 500bp, and remaining is compiled
Number Flowering Cherry Cultivars, the special DNA bands that there are no many sizes of 500bp produce, and also do not have other non-purpose bands to produce, it is seen that
The molecular specificity labeled primers that the present invention is developed are used for Flowering Cherry Cultivars " the red branch of eightfold a hangs down ", " Misaki Ji " and " rain condition branch hangs down "
Early stage identification, its stability, specificity it is very high.
Claims (1)
- Flowering Cherry Cultivars 1. " the red branch of eightfold a hangs down ", " Misaki Ji " and the molecular specificity labeled primers of " rain condition branch hangs down ", the primer Sequence is as follows：Sense primer：5′-AGCGGCCGCCGCTAGATGAG-3′；Anti-sense primer：5′-AGCGGCCGCCGAGACAAAGA-3′.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510024044.2A CN104611426B (en) | 2015-01-16 | 2015-01-16 | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510024044.2A CN104611426B (en) | 2015-01-16 | 2015-01-16 | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611426A CN104611426A (en) | 2015-05-13 |
| CN104611426B true CN104611426B (en) | 2017-09-22 |
Family
ID=53146073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510024044.2A Active CN104611426B (en) | 2015-01-16 | 2015-01-16 | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611426B (en) |
-
2015
- 2015-01-16 CN CN201510024044.2A patent/CN104611426B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| RAPD、SRAP和ISSR标记在香菇种质资源的应用及其SCAR标记的建立;应正河;《中国优秀硕士学位论文全文数据库》;20061215;摘要，第58页-75页第六章 * |
| 樱属观赏品种资源调查及部分种与品种SSR分析;张琼;《中国优秀硕士学位论文全文数据库》;20131101;第77页3.1.3至第79页3.1.4，第80页表格1-3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611426A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103233065B (en) | Molecular specific marker primers for No. 4 and No.32 of an improved variety Changlin of Camellia oleifera and an identification method | |
| CN108660136A (en) | Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis | |
| CN108034754B (en) | Method for identifying new variety of purple tea trees by SSR fingerprint | |
| CN107557369A (en) | Thin shell mountain pecan Peach cultivars Nacono characteristic sequence, labeled primer and authentication method | |
| CN103966210B (en) | The mark combination of peach SSAP molecular labeling primer sets splitting or integrating and the application on Peach cultivars analysis of genetic diversity thereof | |
| CN109868328A (en) | Identify the SSR molecular marker and application of Cultivar | |
| CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
| CN104611329B (en) | Flowering Cherry Cultivars " Song Yue " and the molecular specificity labeled primers of " root tuber of aromatic turmeric " | |
| CN108796119A (en) | Specific molecular marker PCMI-M001 for Cathay poplar male seedling Rapid identification | |
| CN104560977B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the open country younger sister back of the body " | |
| CN104593367B (en) | The specificity labeled primers of red rich, the former brave tail in city of Flowering Cherry Cultivars and the open country younger sister back of the body | |
| CN104611426B (en) | Red branch Chui, Misaki Ji of oriental cherry eightfold and the vertical specificity labeled primers of rain condition branch | |
| CN104762384B (en) | The red branch of Flowering Cherry Cultivars eightfold hangs down and the vertical molecular specificity labeled primers of rain condition branch | |
| CN104694636B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " frontier passes and mountains " | |
| CN104593366B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " chrysanthemum hang down cherry " | |
| CN104673913B (en) | The molecular specificity labeled primers and detection method of a Flowering Cherry Cultivars " Misaki Ji " | |
| CN104593364B (en) | The molecular specificity labeled primers and detection method of Flowering Cherry Cultivars " the former brave tail in city " | |
| CN108754015A (en) | Specific molecular marker PCMI-F001 for Cathay poplar female seedling Rapid identification | |
| CN104611330B (en) | The molecular specificity labeled primers of Flowering Cherry Cultivars " red rich " and " the former brave tail in city " | |
| CN104593368B (en) | The molecular specificity labeled primers that the red branch of Flowering Cherry Cultivars eightfold hangs down and rain condition branch hangs down | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| CN107354222A (en) | For identifying STR primers, PCR kit and the method for Eucalyptus clone | |
| CN110241246B (en) | Primer pair for amplifying DNA bar code of liriodendron, and identification method of liriodendron and seed source thereof | |
| CN104278025B (en) | Cabbage type rape full-length genome SCAR molecular labelings and preparation method and application | |
| CN108410967B (en) | A kind of method of Rapid identification river camellia tradition famous-object |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |