CN110003337B

CN110003337B - IL17RA single domain antibody, nucleic acid and kit

Info

Publication number: CN110003337B
Application number: CN201910302018.XA
Authority: CN
Inventors: 李胜华; 包朝乐萌; 许莎莎; 李莹莹; 余祥
Original assignee: Shenzhen Prijin Biopharmaceutical Co ltd
Current assignee: Shenzhen Prijin Biopharmaceutical Co ltd
Priority date: 2019-04-12
Filing date: 2019-04-12
Publication date: 2023-05-09
Anticipated expiration: 2039-04-12
Also published as: CN110003337A

Abstract

The invention discloses an IL17RA single domain antibody, a nucleotide sequence and a kit, wherein the polypeptide comprises 4 framework regions, 3 variable regions, four framework regions FR1, FR2, R3 and FR4, and three variable regions CDR1, CDR2 and CDR3. According to the technical scheme, the single-domain antibody specifically binding the IL17A/F protein is obtained by combining a genetic engineering method, and the antibody has high activity of specifically binding the IL17RA protein, high expression quantity, low cost and easy transformation.

Description

IL17RA single domain antibody, nucleic acid and kit

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an IL17RA single domain antibody, a nucleic acid sequence and a kit.

Background

Interleukin 17 receptor a (IL-17 RA) is a type i transmembrane glycoprotein, and is widely distributed on the surface of various cells, for example, non-hematopoietic epithelial cells, fibroblasts, chondrocytes, hematopoietic macrophages, neutrophils, T cells, and the like, and plays an important role in inflammatory reactions. IL-17RA acts as an important inflammatory regulatory receptor, which, upon binding to IL-17A, activates the IL-17RA signaling pathway, and is highly involved in the pathogenesis of autoimmune diseases and cancer. Studies have shown that IL-17RA pathway antagonists, such as IL-17RA specific antibodies, can block IL-17 family cytokines from binding to receptors by binding to IL-17RA, inhibiting inflammatory responses.

However, the existing interleukin 17 receptor A system has low expression level, low antibody affinity, large molecular weight, high production cost and difficult transformation.

Disclosure of Invention

The main purpose of the invention is to provide a polypeptide sequence, which aims to solve the problem of low affinity of the existing IL17RA antibody.

To achieve the above object, the present invention provides an IL17RA single domain antibody (as shown in SEQ ID NO: 7) comprising four framework regions FR1, FR2, R3, FR4 and three complementarity determining regions CDR1, CDR2, CDR3,

FR1：Gln Val Lys LeuGluGluSerGlyGlyGlyLeu Val Gln Pro GlyGluSerLeu Lys LeuSerCysAlaAlaSerGlyGlyThrPheSer；

CDR1：Glu Tyr AlaLeuGly；

FR2：Trp TyrArgGlnAla Pro GlyAsnGlnGln Asp TrpVal Ala；

CDR2：Ser Ile AsnSerLeuGly Asp ProThr Tyr AlaGluSer Val Lys；

FR3：GlyArgPheThr Ile SerArg Asp AsnAla Lys SerThrLeu Tyr LeuGln Met AsnSerLeu Lys ProGlu Asp ThrAlaAsn Tyr Tyr；

CDR3：CysAsn IlePro ArgLeuAsn；

FR4：LeuTrpGlyGlnGlyThrGln Val Thr Val SerSer。

the invention also provides a nucleic acid sequence encoding an IL17RA single domain antibody comprising four framework regions FR1, FR2, R3, FR4, and three complementarity determining regions CDR1, CDR2, CDR3, wherein,

CDR1：Glu Tyr AlaLeuGly；

FR2：Trp TyrArgGlnAla Pro GlyAsnGlnGln Asp TrpVal Ala；

CDR2：Ser Ile AsnSerLeuGly Asp ProThr Tyr AlaGluSer Val Lys；

CDR3：CysAsn IlePro ArgLeuAsn；

FR4：LeuTrpGlyGlnGlyThrGln Val Thr Val SerSer。

in one embodiment, the nucleic acid sequence is as follows:

CAGGTAAAGCTGGAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGAGTCACTGAAACTCTCCTGTGCAGCCTCTGGAGGGACCTTCAGCGAATATGCCCTGGGTTGGTACCGCCAGGCTCCAGGGAACCAGCAGGACTGGGTCGCATCCATTAATAGTTTAGGTGATCCAACCTATGCAGAGTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAGCACGCTCTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCAATTATTACTGTAATATTCCCCGCCTTAATTTATGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

the invention also provides a kit comprising an IL17RA single domain antibody, or a nucleic acid; the IL17RA single domain antibody comprises four framework regions FR1, FR2, R3, FR4, and three complementarity determining regions CDR1, CDR2, CDR3, wherein,

CDR1：Glu Tyr AlaLeuGly；

FR2：Trp TyrArgGlnAla Pro GlyAsnGlnGln Asp TrpVal Ala；

CDR2：Ser Ile AsnSerLeuGly Asp ProThr Tyr AlaGluSer Val Lys；

CDR3：CysAsn IlePro ArgLeuAsn；

FR4: leuTrpGlyGlnGlyThrGln Val Thr Val SerSer; the nucleic acid sequence is as follows:

according to the technical scheme, the single-domain antibody specifically binding the IL17A/F protein is obtained by combining a genetic engineering method, and the antibody has high activity of specifically binding the IL17RA protein, high expression quantity and low cost, so that the antibody is modified.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a first round of PCR single domain antibody gene electrophoresis;

FIG. 2 is a diagram showing the second round of PCR single domain antibody gene electrophoresis after recovery of 750bp-500bp, 2-lane and 3-lane DNA in lane 1 of FIG. 1;

FIG. 3 is a diagram of purification of protein expression;

FIG. 4 is a graph showing the binding activity of IL17RA single domain antibodies of the present invention to IL17RA antigen.

FIG. 5 is a graph showing the affinity detection process of IL17RA single domain antibodies of the present invention;

FIG. 6 is a comparison of the affinity detection process of IL17RA single domain antibodies of the present invention with a linear fit.

The achievement of the objects, functional features and advantages of the present invention will be further described with reference to the accompanying drawings, in conjunction with the embodiments.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The invention provides an IL17RA single domain antibody, a nucleic acid sequence and a kit. The following will describe the polypeptides and their screening process in detail.

First, the polypeptide of the invention has four framework regions and three complementarity determining regions:

CDR1：Glu Tyr AlaLeuGly；

FR2：Trp TyrArgGlnAla Pro GlyAsnGlnGln Asp TrpVal Ala；

CDR2：Ser Ile AsnSerLeuGly Asp ProThr Tyr AlaGluSer Val Lys；

CDR3：CysAsn IlePro ArgLeuAsn；

FR4：LeuTrpGlyGlnGlyThrGln Val Thr Val SerSer。

aiming at the IL17RA single domain antibody, the construction mode of the invention is divided into construction of an antibody library, screening of specific phage, screening of specific positive monoclonal and expression and purification of the IL17RA single domain antibody in host escherichia coli. The following will be described in detail for each step.

1. Construction of antibody libraries

IL17RA antigen: manufacturer Beijing Yiqiao Shenzhou, product number 11958-H08H1.

1mg of the antigen was mixed with an equal volume of Freund's adjuvant. Adult healthy alpaca is selected, the antigen is injected, 6 times of immunization are carried out, alpaca serum is adopted after the 4 th immunization, and antigen immune titer is measured by a chemiluminescence method.

a ₀ Lymphocytes are isolated. When the immunization titer was 1 ten thousand times or more, 150ml of whole blood was collected, and lymphocytes were isolated using QIAGEN kit (QIAamp RNA Blood Mini Kit (50), cat# 52304).

b ₀ Cracking. The isolated lymphocytes were lysed, and then RNA was purified and assayed for RNA concentration using the QIAGEN kit (QIAamp RNA Blood Mini Kit (50), cat# 52304).

c ₀ : nested PCR amplification. Two rounds of PCR amplification of the antibody heavy chain variable region VHH gene fragment were performed using cDNA synthesis kit (MiniBESTAgarose Gel DNAExtraction Kit Ver.4.0, TAKARA Co.) using nested PCR method;

the first PCR amplification can obtain a common antibody gene fragment of more than 800bp, a heavy chain antibody gene fragment of 800-500 bp with a deletion light chain, and a heavy chain antibody variable region fragment VHH of 500bp, and the 800-500 bp gene fragment and the 500bp gene fragment are screened out by electrophoresis.

d ₀ : and (3) cutting and recycling, namely cutting and recycling the gene fragments of 800-500 bp in the step c 0. Referring specifically to FIG. 1, the number 1 bands are common antibody DNA and heavy chain antibody DNA, two bright bands can be seen, and the two bright bands are largeThe strip of 750bp to 500bp in the figure is cut and recovered at 800bp (common antibody DNA) and 500bp to 750bp (heavy chain antibody DNA); band 2 and band 3 are heavy chain antibody variable region fragments VHH, with a size of 500bp; the destination strips of the No. 2 strip and the No. 3 strip are also recovered.

e ₀ : amplification of the VHH gene of interest. The gene fragment of the recovered complete heavy chain antibody and the heavy chain variable region thereof is used as a template, and VHH specific primers are used for carrying out second PCR amplification to obtain the VHH target gene (500 bp). Referring to FIG. 2, a bright band is seen in which the VHH target gene is about 500bp, i.e., the bright band is mixed with a plurality of VHH target genes of about 500 bp.

The first round PCR primer comprises SEQ ID NO: 1. SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.

Wherein SEQ ID NO:1 and SEQ ID NO:2, performing pairing, and amplifying to obtain two bands shown in lane 1 in FIG. 1; SEQ ID NO:2 and SEQ ID NO:3, and amplifying to obtain one band shown in lane 2 of FIG. 1.

The second round PCR primers include SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence. SEQ ID NO:4 and SEQ ID NO:5, and obtaining the 500bp target gene shown in figure 2.

f ₀ : transferring into TG1 competent cells. The VHH fragment obtained above was ligated to pHEN6 phage display vector plasmid (by BamHI, xhoI double cleavage), followed by ligation of the VHH fragment and pHEN6 vector (ZL 20111028003.1) via ligase, electrotransformation into TG1 competent cells, followed by plating of the competent cells with plates and verification of VHH gene insertion rate by colony PCR.

After verifying that VHH gene insertion was successful, clone efficiency detection was performed on the recombinant gene: the electrotransformation bacterial liquid is coated on an LB/Amp plate, cultured at 32 ℃ overnight, and the connection efficiency of the antibody is verified by a colony PCR method on the next day.

The colony PCR method is as follows: 1. individual colonies were picked with autoclaved toothpicks or tips, spot-kept (marked) on resistant plates and then stirred in 20ul Triton-x100 (or deionized water). 2. An EP tube containing 20ul Triton x-100 was boiled at 100℃for 2 minutes. 3.1 ul of supernatant is taken as a template, and a PCR system, which can be 20ul, is added for PCR reaction. 4. The results were observed by agarose gel electrophoresis.

When the connection efficiency of the phage antibody library is lower than 90%, the experimental process is required to be repeated in case of misoperation; when the phage antibody library efficiency reached 90%, the next operation was performed.

g ₀ : and (5) performing expansion culture and preserving. The electrotransformation bacteria liquid is coated on LB/Amp plates, the overnight culture is washed by a 2YT culture medium, the expansion culture is carried out in the 2YT culture medium according to the proportion of 1:1000, helper phage M13K07 (Invitrogen) is added for infection, the overnight culture is carried out, centrifugation is carried out, 20% PEG-2.5M NaCl is added after supernatant is collected for uniform mixing (phage in supernatant), sediment is collected after centrifugation, PBS and glycerol are added for resuspension, and the sediment is preserved at-80 ℃ for standby.

2. Screening of specific phages

Because there are several VHH fragments amplified by nested PCR, not all of these gene fragments are target fragments, and after the VHH fragments are transferred into phage, the target phage needs to be purified, and the following steps are used for purifying the target phage:

a ₁ CPBS solution preparation. Adding a small amount of non-fat milk into the PBS solution, wherein the non-fat milk accounts for 1% -5% (blocking effect); diluting IL17RA protein dissolved in CPBS solution to 150 μg/ml;

b ₁ : after IL17RA protein dilution, 150 μl/well was coated;

c ₁ : standing, removing the coating liquid, adding a sealing liquid (1% CPBS) 300 μl/hole, and sealing at 37deg.C for 2 hr;

d ₁ : adding the selected phage into the micropores, and adding a sealing solution, and uniformly mixing until the volume of each hole is 150 mu l;

e ₁ : incubation for 2h at room temperature (antibody secreted on the outer shell of phage, antibody bound to IL17RA protein);

f ₁ : the mesh was washed 10 times with PBST (containing 0.05% Tween 20) and PBS, 2min each, and unbound phage were washed away;

g ₁ : adding TEA into the sieve holes to elute phage, blowing and sucking to suspend uniformly, and standing for 10min at room temperature;

h ₁ : blowing and sucking the suspension again, adding the suspension into precooled 1M Tris-HCl, mixing uniformly, and measuring the titer;

i ₁ amplifying and purifying the amplified phage.

Step a above ₁ To step i ₁ Repeating the steps three times and using the step i ₁ Phage as the next round of step d ₁ The phage added to the microwells (phage from the first round of phage were stored at-80℃as described above).

The screening results are detailed in the following table

Step a above ₁ To step i ₁ The coated IL17RA antigen is used as a target, 3 rounds of screening are carried out from a total phage antibody library by adopting a solid phase screening method, and the titer of the eluted phage is increased after three rounds of screening, namely the IL17RA specific phage is enriched with high efficiency.

3. Screening of specific positive monoclonal

Although the phages described above have been enriched efficiently, there is a small amount of nonspecific phage remaining, and the specific IL17RA single domain antibody gene will be further purified in the following. The method comprises the following specific steps:

a ₂ : by SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence, carrying out PCR amplification on the enriched IL17RA specific phage to obtain a specific IL17RA single domain antibody gene (PCR product with restriction enzyme BbsI and BamHI sites);

b ₂ : the PCR product and pSJF2 vector (ZL 201110280031) are treated by restriction endonucleases BbsI and BamHI respectively, and are recombined by T4 ligase connection to obtain plasmid sdAb-pSJF2 which can be efficiently expressed in escherichia coli;

c ₂ : multiple single colonies (e.g., 50 to 95) were randomly picked from an agar plate on which they were grown, and inoculated into 96-well deep-well plates containing Amp in 2YT liquid medium;

d ₂ : after 4 hours of culture, the monoclonal antibodies are inoculated on LB solid plates with numbers and separated by cells in a one-to-one correspondence manner, wherein the LB solid plates contain Amps;

e ₂ : adding IPTG to the deep-hole culture plate to a final concentration of 0.5mM for induction;

f ₂ : after overnight culture, the protein-expressing bacterial supernatant was harvested;

g ₂ : ELISA determination is carried out by IL17RA antigen, and the ELISA determination result of Anti-IL17RA positive clone is selected;

h ₂ : the selected IL17RA positive clone is subjected to DNA sequencing to identify a gene sequence SEQ ID NO:6.

SEQ ID NO: the sequence 6 is as follows:

4. IL17RA single domain antibody expressed and purified in host E.coli

After the positive monoclonal is obtained, the IL17RA antibody can be obtained by expressing the positive monoclonal, and the IL17RA single domain antibody can be obtained by expressing the positive monoclonal mainly through escherichia coli and purifying the positive monoclonal. The specific operation process is as follows:

a ₃ : inoculating the strain containing plasmid IL17RA on LB culture plate containing ampicillin, and standing overnight at 37deg.C. Because the pSJF2 vector has resistance to ampicillin, only escherichia coli containing the pSJF2 vector can grow on an LB culture plate containing ampicillin, so that the interference of other miscellaneous bacteria is avoided;

b ₃ : single colony is selected and inoculated in 5ml LB culture solution containing ampicillin, and shake culture is carried out at 37 ℃ for overnight;

c ₃ : 2mL of overnight culture was inoculated into 200mL of LB medium containing ampicillin;

d ₃ : shaking culture at 37 ℃ for 240 revolutions per minute, adding 0.5-1.0 mM IPTG when the OD value reaches 0.4-0.6, continuing to culture overnight, and centrifuging to obtain the strain.

e ₃ : lysing bacteria by a hypertonic method, centrifuging, and collecting soluble single-domain antibody proteins in supernatant;

f ₃ : obtaining the protein with purity of more than 95% through Ni+ ion affinity chromatography.

Referring to fig. 3, in fig. 3, M is a protein molecular standard, and band 1 is a crude total protein extract sample after bacterial disruption.

Strip 2 is a sample of total protein after crude extraction of the nickel column, indicating that only a small amount of sample was eluted and that a large amount of sample protein remained in the ni+ column.

Strip 3 is the sample remaining after passing through the nickel removal column with elution containing 40 millimoles of imidazole, indicating that most of the protein eluted after further elution.

Strip 4 is the sample remaining after passing through the nickel removal column with an eluent containing 100 mmol of imidazole, indicating that few impurities were not eluted in the ni+ column.

Strip 5 is the sample remaining after passing the nickel column with an eluent containing 400 mmol of imidazole, and it can be seen from this strip that almost all the proteins of the ni+ column are eluted, and the eluted target proteins are purer.

5. Single domain antibodies and IL17RA antigen binding Activity assay

The above procedure has been performed to screen and purify the target antibody, and in order to verify the activity of the target antibody, the experimental procedure is as follows:

a ₄ : IL17RA antigen was diluted to 2. Mu.g/ml, 100. Mu.l/well with 0.05M Na2CO3 NaHCO3 (pH 9.5), antigen coated 96 well plates and incubated overnight at 4 ℃;

b ₄ : plates were washed three times with PBS, blocked with 300 μl 2% bsa (or 1% cpbs) and incubated for 2 hours at 37 ℃;

c ₄ : purified IL17RA single domain antibodies with different dilution concentrations are added, and incubated for 1 hour at the temperature of 100 mu l/Kong Jiaru and 37 ℃;

d ₄ : plates were washed three times with 0.05% pbst;

e ₄ : adding 5000 times diluted antiMyctag antibody (HRP), and incubating for 1 hour at the temperature of 100 mu l/Kong Jiaru and 37 ℃;

f ₄ : plates were washed three times with 0.05% PBST, TMB100 μl/well was added, and the plates were allowed to stand at room temperature in the dark for 10 minutes. g4: the reaction was stopped by adding 2M H2SO4 at 50. Mu.l/well;

g ₄ : the OD of the sample at 450 nm wavelength was measured with a microplate reader.

As can be seen from FIG. 4, even at a concentration of 3.2ng/ml after binding of IL17RA single domain antibody to IL17RA antigen, higher activity was detected.

FIG. 5 shows the affinity assay process and measurement results. The four curves were obtained using different concentration gradient antibodies (line 1 corresponds to an antibody with a concentration of 235.3nM, line 2 corresponds to an antibody with a concentration of 470.6nM, line 3 corresponds to an antibody with a concentration of 941.2nM, and line 4 corresponds to an antibody with a concentration of 1882 nM). The abscissa is the time axis (0-900 seconds) and the ordinate is the machine-readable Response value (Response) during the experiment. According to the experimental design, 300 seconds is preceded by an antigen-antibody binding process, 300 seconds-900 seconds is a dissociation process, and reference is made to the split line in fig. 5. Based on the change of the machine reading value with time during the binding, the binding constant Kon (1/Ms) can be obtained. According to the change of the machine reading value with time in the dissociation process, the dissociation constant Kdis (1/s) can be obtained. According to the formula:

affinity constant kd=dissociation constant Kdis/binding constant Kon, IL17RA antibody affinity constant kd=2.99E-11M measured using different concentrations. Each of which is provided withThe detection results under the concentration gradient are consistent, and the experimental results are reliable (refer to the fitting curve and the following table in FIG. 6, R ² =0.997）。

The affinity test was performed on 4 kinds of commercially available IL17RA antibodies, and the test results showed that the affinities of the commercially available IL17RA antibodies were 7.73E-09M (R ² =0.992）、9.72 E-09M（R ² =0.995）、5.55 E-09M（R ² =0.989）、6.69 E-09M（R ² =0.997）。

Therefore, the affinity of the IL17RA antibody is 30.7-53.8 times that of the IL17RA antibody sold in the prior art, and is far higher than that of the IL17RA antibody in the prior art. Finally, because the IL17RA single domain antibody is a nanometer antibody, the production cost is low, the production efficiency is high, and the subsequent transformation of the antibody is facilitated.

For the production efficiency of the IL17RA antibody, the concentration of the IL17RA antibody obtained after purification is measured by using a spectrophotometer, and the total amount of the expressed, extracted and purified protein is 3.66mg. Since the expression system used in the examples was 200ml, the unit expression level of the IL17RA single domain antibody prokaryotic expression system constructed in the present example was 1.83. 1.83 mg/100ml.

The expression system used in the examples can demonstrate the expression efficiency of the protein, i.e., the amount of the protein available per unit expression volume, by analyzing and calculating the finally obtained expression amount. In general, the expression level reached 0.3mg/100ml, i.e., it was considered that a higher expression level (relative to the highest level in the prior art) was exhibited, and the expression level of the present IL17RA single domain antibody reached 1.83 mg/100ml, at a higher level.

The foregoing description is only of the preferred embodiments of the present invention and is not intended to limit the scope of the invention, and all equivalent structural changes made by the description of the present invention and the accompanying drawings or direct/indirect application in other related technical fields are included in the scope of the invention.

Sequence listing

<120> IL17RA single domain antibody, nucleotide sequence and kit

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

cgccatcaag gtaccagttg a 21

<210> 2

<211> 36

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

cgggatccca ggtacagctg gtggagtctg ggggag 36

<210> 3

<211> 36

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

ccgctcgagt acttcattcg ttcctgagga gacggt 36

<210> 4

<211> 28

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

ccgctcgagt gaggagacgg tgacctgg 28

<210> 5

<211> 36

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

cgggatccga ggtacagctg gtggagtctg ggggag 36

<210> 6

<211> 339

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

caggtaaagc tggaggagtc tgggggaggc ttggtgcagc ctggggagtc actgaaactc 60

tcctgtgcag cctctggagg gaccttcagc gaatatgccc tgggttggta ccgccaggct 120

ccagggaacc agcaggactg ggtcgcatcc attaatagtt taggtgatcc aacctatgca 180

gagtctgtga agggccgatt caccatctcc agagacaacg ccaagagcac gctctatctg 240

caaatgaaca gcctgaaacc tgaggacacg gccaattatt actgtaatat tccccgcctt 300

aatttatggg gccaggggac ccaggtcacc gtctcctca 339

<210> 7

<211> 114

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser Glu Tyr

20 25 30

Ala Leu Gly Trp Tyr Arg Gln Ala Pro Gly Asn Gln Gln Asp Trp Val

35 40 45

Ala Ser Ile Asn Ser Leu Gly Asp Pro Thr Tyr Ala Glu Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asn Tyr Tyr Cys Asn

85 90 95

Ile Pro Arg Leu Asn Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser

100 105 110

Ser Gly

Claims

1. An IL17RA single domain antibody, characterized in that it has the amino acid sequence as set forth in SEQ ID NO: shown at 7.

2. A nucleic acid encoding the IL17RA single domain antibody of claim 1.

3. The nucleic acid of claim 2, wherein the nucleic acid sequence is set forth in SEQ ID NO: shown at 6.

4. A kit comprising the IL17RA single domain antibody of claim 1, or the nucleic acid of claim 2 or 3.