CN109942704B - HSA single domain antibodies, nucleic acids and kits - Google Patents
HSA single domain antibodies, nucleic acids and kits Download PDFInfo
- Publication number
- CN109942704B CN109942704B CN201910297997.4A CN201910297997A CN109942704B CN 109942704 B CN109942704 B CN 109942704B CN 201910297997 A CN201910297997 A CN 201910297997A CN 109942704 B CN109942704 B CN 109942704B
- Authority
- CN
- China
- Prior art keywords
- hsa
- gly
- tyr
- ala
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses an HSA single domain antibody, a nucleotide sequence and a kit, wherein the HSA single domain antibody comprises four framework regions and three complementarity determining regions CDR1, CDR2 and CDR3, wherein the CDR1: asp Tyr Ile Ile Gly; CDR2: cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Ala Glu Ser Val Lys; CDR3: ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp. The technical scheme of the invention obtains the single-domain antibody specifically binding to HSA protein by combining a genetic engineering method, and the antibody specifically binding to HSA protein has high activity, high expression level, low cost and easy modification.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to an HSA single-domain antibody, nucleic acid and a kit.
Background
Human Serum Albumin (HSA) serum albumin in human blood, which is the most abundant protein in human plasma, accounts for 55% of serum proteins. HSA is produced by the liver and plays a variety of roles in transporting hormones, fatty acids, and other hydrophobic compounds, buffering pH, maintaining osmotic pressure, and the like in vivo. The human serum albumin marker can be used as a detection mode for various diseases, for example, the detection of the albumin content in urine can be used as an important detection mode for nephropathy, and is a risk indicator for cardiovascular disease complications of diabetes patients. Human serum albumin can be detected and labeled using a variety of methods, with immunohistochemistry being the most sensitive and specific one. The principle is that the albumin specific antibody is combined with serum albumin, so that the albumin can be used for quantitative detection of albumin in urine and detection of albumin in other body fluids.
In the prior art, HAS antibody HAS low binding activity and poor specificity.
Disclosure of Invention
The main objective of the present invention is to provide an HSA single domain antibody, which aims to solve the problem of low binding activity of the HSA antibody.
In order to achieve the above object, the present invention provides an HSA single domain antibody comprising four framework regions and three complementarity determining regions CDR1, CDR2, CDR3, wherein,
CDR1：Asp Tyr Ile Ile Gly；
CDR2：Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu Ser Val Lys；
CDR3：Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp。
in one embodiment, the four framework regions are FR1, FR2, FR3, FR4, respectively, wherein,
FR1：Asp Val Gln Leu Gln Ala Ser Gly Gly Asp Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys His Ala Ser Gly Leu Asp
FR2：Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Leu Ser
FR3：Gly Arg Phe Thr Ile Ser Ser Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala
FR4：Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser。
the invention also provides a nucleotide sequence encoding an HSA single domain antibody comprising four framework regions and three complementarity determining regions CDR1, CDR2, CDR3,
CDR1：Asp Tyr Ile Ile Gly；
CDR2：Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu Ser Val Lys；
CDR3：Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp。
in one embodiment, the nucleotide sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGCCACGCCTCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGAGGGCCTCTCATGTATTAGTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCCAGTGACAACGCCAAGAACACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTGCAGCAGATCGATATCGGTCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
the invention also provides a kit comprising an HSA single domain antibody, or comprising a sequence such as a nucleotide sequence; the HSA single domain antibody comprises four framework regions and three complementarity determining regions CDR1, CDR2, CDR3, wherein CDR1: asp Tyr Ile Ile Gly; CDR2: cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Ala Glu Ser Val Lys; CDR3: ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp; the nucleotide sequence is as follows: <xnotran> GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGCCACGCCTCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGAGGGCCTCTCATGTATTAGTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCCAGTGACAACGCCAAGAACACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTGCAGCAGATCGATATCGGTCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA. </xnotran>
The technical scheme of the invention obtains the single-domain antibody specifically binding to HSA protein by combining a genetic engineering method, and the antibody specifically binding to HSA protein has high activity, high expression level, low cost and easy modification.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1 is a first round of PCR single domain antibody gene electrophoresis of the present invention;
FIG. 2 is a second round of PCR single domain antibody gene electrophoresis in the band 1 of FIG. 1 within the range of 750bp-500 bp;
FIG. 3 is a diagram of protein expression purification;
FIG. 4 is a diagram showing the binding activity of the HSA single domain antibody of the present invention to HSA antigen.
The implementation, functional features and advantages of the present invention will be further described with reference to the accompanying drawings.
Detailed Description
The technical solutions in the embodiments of the present invention will be described clearly and completely with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention provides an HSA single domain antibody, a nucleotide sequence and a kit. The following will describe the HSA single domain antibody and the screening process thereof in detail.
First, the HSA single domain antibody of the present invention has four framework regions and three complementarity determining regions. Wherein, the three complementarity determining regions have the following sequences:
CDR1：Ser Tyr Thr Met Gly；
CDR2：Gly Ile Ser Pro Ser Gly Ala Tyr Thr Ser Tyr Ala Asp Ser Val Lys；
CDR3：Ala Asp Arg Tyr Gly Leu Leu His Thr Ala Glu Asp Val Tyr Pro。
of course, there may be a plurality of sequences of the framework region of the HSA single domain antibody. The following four framework regions are described in detail as specific examples.
FR1：Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
FR2：Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Thr；
FR3：Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Phe Val Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Glu；
FR4：Cys Trp Gly Gly Gly Thr Gln Val Ala Val Ser Ser。
Aiming at the HSA single domain antibody, the construction mode of the invention is divided into the construction of an antibody library, the screening of specific phage, the screening of specific positive monoclonal, the expression and purification of the HSA single domain antibody in host escherichia coli. The following will be explained in detail for each step.
1. Construction of antibody libraries
HSA antigen: the manufacturer Beijing Yi Qiao Shenzhou, cat No. 11958-H08H1.
2mg of the above antigen was used in admixture with an equal volume of Freund's adjuvant. Adult healthy alpaca is selected, injected with the antigen and immunized for 7 times, after the 3 rd time of immunization, alpaca serum is adopted, and the antigen immunization titer is determined by a chemiluminescence method.
a 0 Lymphocytes were isolated. When the titer reached 1 ten thousand fold or more, 150ml of whole Blood was collected, and lymphocytes were isolated using QIAGEN Kit (QIAamp RNA Blood Mini Kit (50), cat # 52304).
b 0 Namely cracking. The isolated lymphocytes were lysed to obtain a CDNA library, and the CDNA concentration was measured using QIAGEN Kit (QIAamp RNA Blood Mini Kit (50), cat No. 52304).
c 0 : nested PCR amplification. Performing two rounds of PCR amplification on VHH gene fragment of antibody heavy chain variable region by using cDNA synthesis Kit (MiniBESTAgarose Gel DNAextraction Kit Ver.4.0, TAKARA) by using nested PCR method;
carrying out first round of PCR amplification to obtain a common antibody gene fragment of more than 800bp, a heavy chain antibody gene fragment of which the light chain is deleted between 800bp to 500bp and a heavy chain antibody variable region fragment VHH of 500bp, and screening the gene fragment of 800bp to 500bp and the gene fragment of 500bp through electrophoresis;
d 0 : and c, cutting and recovering the gene fragments of 800bp to 500bp in the step c 0. Specifically, referring to fig. 1, the bands 1 are ordinary antibody DNA and heavy chain antibody DNA, two bright bands of which are more than 800bp (ordinary antibody DNA) and between 5000 bp to 750bp (heavy chain antibody DNA) can be seen, and the bands located in 750bp to 5000 bp in the figure are cut and recovered; the No. 2 band is a heavy chain antibody variable region fragment VHH, and the size is 500bp; band No. 2 with mesh was also recovered.
e 0 : VHH target geneAnd (5) amplification. The gene fragment of the recovered complete heavy chain antibody and the heavy chain variable region thereof is used as a template, and VHH specific primers are used for second round PCR amplification to obtain a VHH target gene (500 bp). Referring to FIG. 2, a bright band with VHH target genes of about 500bp can be seen, i.e., the bright band contains several VHH target genes of about 500 bp.
The first round PCR primer comprises SEQ ID NO: 1. SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.
Wherein SEQ ID NO:1 and SEQ ID NO:2, using the pair, and amplifying to obtain two bands shown in a 1-channel in the figure 1; the amino acid sequence of SEQ ID NO:2 and SEQ ID NO:3 used in pairs, one band is shown in lane 2 in FIG. 1.
The second round PCR primers included SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence. The amino acid sequence of SEQ ID NO:4 and SEQ ID NO:5 were used in pairs to obtain 500bp of the desired gene shown in FIG. 2.
| Name of Gene sequence | Primer sequences |
| SEQ ID NO：1 | CGCCATCAAGGTACCAGTTGA |
| SEQ ID NO：2 | CGGGATCCCAGGTACAGCTGGTGGAGTCTGGGGGAG |
| SEQ ID NO：3 | CCGCTCGAGTACTTCATTCGTTCCTGAGGAGACGGT |
| SEQ ID NO：4 | CCGCTCGAGTGAGGAGACGGTGACCT GG |
| SEQ ID NO：5 | CGGGATCCGAGGTACAGCTGGTGGAGTCTGGGGGAG |
f 0 : transfer into TG1 competent cells. The VHH fragment obtained above was ligated to the pHEN6 phage display vector plasmid (double digested with BamHI, xhoI), after which the VHH fragment and the pHEN6 vector (ZL 20111028003.1) were ligated via ligase, electrotransformed into TG1 competent cells, which were then plated and verified for VHH gene insertion rate by colony PCR.
And when the VHH gene is successfully inserted, carrying out cloning efficiency detection on the recombinant gene: and (3) coating the obtained transformed bacterium liquid on an LB/Amp plate, culturing overnight at 32 ℃, and verifying the connection efficiency of the antibody by using a colony PCR method the next day.
The colony PCR method comprises the following steps: 1. individual colonies were picked with an autoclaved toothpick or gun tip, stored (labeled) monoclonally on resistant plates, and then stirred in 20ul Triton-x100 (or deionized water). 2. An EP tube containing 20ul Tritonx-100 was cooked at 100 ℃ for 2 minutes. 3. Taking 1ul of supernatant as a template, and adding a PCR system for PCR reaction, wherein the PCR system can be 20ul. 4. And (5) observing the result by agarose gel electrophoresis.
When the connection efficiency of the phage antibody library is lower than 90%, the operation error is indicated, and the experiment process needs to be repeated; when the efficiency of the phage antibody library reached 90%, the next procedure was performed.
g 0 : and (5) performing enlarged culture and preservation. Plating the electrotransformation bacteria solution on an LB/Amp plate, washing the overnight culture with 2YT medium at 32 ℃, performing amplification culture at a ratio of 1:1000 in 2YT medium, adding helper phage M13K07 (Invitrogen) for infection, performing overnight culture, centrifuging, collecting supernatant, adding 20% PEG-2.5M NaCl, mixing (phage supernatant), centrifuging, collecting precipitate, adding PBS and glycerol, resuspending, and storing at-80 ℃ for use.
2. Screening of specific phages
Since there are many VHH fragments amplified by nested PCR, and not all these gene fragments are target fragments, after these VHH fragments are transferred into phage, the target phage needs to be enriched, the following steps are included:
a 1 preparation of CPBS solution. Adding a small amount of fat-free milk into the PBS solution, wherein the proportion of the fat-free milk is 1-5% (playing a role in sealing); diluting the HSA protein dissolved in the CPBS solution to 150 mu g/ml;
b 1 : coating 150 mul/hole after HSA protein dilution;
c 1 : standing, removing coating solution, adding 300 μ l/hole of blocking solution (1% CPBS), and blocking at 37 deg.C for 2 hr;
d 1 : adding the screened phage into the micropores, adding a sealing solution, and uniformly mixing to 150 mu l per pore volume;
e 1 : incubation for 2h at room temperature (antibody secreted from the coat of phage, antibody bound to HSA protein);
f 1 : washing the mesh with PBST (containing 0.05% Tween 20) and PBS 10 times (2 min) respectively, and washing out the phage not bound;
g 1 : adding TEA into the sieve pores to elute phage, uniformly blowing and sucking the suspension, and standing for 10min at room temperature;
h 1 : blowing, sucking and suspending uniformly again, adding the suspension into precooled 1M Tris-HCl, mixing uniformly, and measuring the titer;
i 1 amplifying and purifying the amplified phage.
Step a above 1 To step i 1 Repeating three rounds, and performing step i 1 As a next round of step d 1 Phage added to microwells (first round of phage was derived from the above-80 ℃ storage, three rounds of selection were performed at a coating concentration of 10. Mu.g/ml, each 150. Mu.l/well).
The results of the screening are detailed in the following table
| Number of screens | Adding the total amount of phage antibody library | Eluent + Tris-HCl |
| First wheel | 5.60E+11 | 300ulTEA+200ulTris |
| Second wheel | 5.00E+11 | 150ul*5TEA+350ulTris |
| Third wheel | 5.00E+11 | 150ul*5TEA+350ulTris |
Step a above 1 To step i 1 The coated HSA antigen is used as a target, 3 rounds of screening are carried out from a total phage antibody library by a solid phase screening method, and the titer of the eluted phage is increased after three rounds of screening, namely HSA specific phage is efficiently enriched.
3. Screening of specific Positive monoclonals
Although the above phages have been enriched with high efficiency, there are still a few non-specific phages left, and in the following, specific HSA single domain antibody genes will be further screened. The method comprises the following specific steps:
a 2 : by SEQ ID NO:4 and SEQ ID NO:5 nucleotideA sequence, performing PCR amplification on the enriched HSA specific phage to obtain a specific HSA single domain antibody gene (PCR product with restriction endonuclease BbsI and BamHI sites);
b 2 : treating the PCR product and a pSJF2 vector (ZL 201110280031) with restriction endonucleases BbsI and BamHI respectively, and performing ligation recombination by T4 ligase to obtain a plasmid sdAb-pSJF2 capable of being efficiently expressed in Escherichia coli;
c 2 : randomly picking a plurality of single colonies from an agar plate for growing the colonies, and then inoculating the single colonies into a 96-hole deep-hole culture plate containing Amp 2YT liquid culture medium;
d 2 : after culturing for 4 hours, inoculating the single clones on numbered LB solid plates which are separated by small lattices and contain Amp in a one-to-one correspondence manner;
e 2 : adding IPTG to the deep-well culture plate until the final concentration is 0.5mM for induction;
f 2 : after overnight culture, harvesting the supernatant of the bacteria expressing the protein;
g 2 : performing ELISA determination by using HSA antigen, and selecting an Anti-HSA positive clone ELISA determination result;
h 2 : the HSA positive clone is selected and subjected to DNA sequencing to identify the gene sequence SEQ ID NO:6.
the amino acid sequence of SEQ ID NO:6 the sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGCCACGCCTCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGAGGGCCTCTCATGTATTAGTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCCAGTGACAACGCCAAGAACACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTGCAGCAGATCGATATCGGTCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
4. expression and purification of HSA single-domain antibody in host Escherichia coli
After the positive monoclonal is obtained, the HSA single-domain antibody can be obtained by the expression method, and the HSA single-domain antibody can be obtained by the subsequent expression mainly through escherichia coli and then purification. The specific operation process is as follows:
a 3 : the strain containing plasmid HSA was inoculated on LB plates containing ampicillin overnight at 37 ℃. Herein, since the pSJF2 vector itself has resistance to ampicillin, only Escherichia coli containing the pSJF2 vector can grow on LB culture plate containing ampicillin, and interference of other mixed bacteria is avoided;
b 3 : selecting a single colony, inoculating the single colony in 5ml of LB culture solution containing ampicillin, and culturing overnight at 37 ℃ by using a shaking table;
c 3 : transferring 2mL of overnight culture into 200mL of LB culture solution containing ampicillin;
d 3 : shaking-culturing at 37 ℃, culturing at 240 r/min until OD reaches 0.4-0.6, adding 0.5-1.0 mM IPTG, continuously culturing overnight, centrifuging, and collecting bacteria.
e 3 : bacteria are lysed by a hypertonic method, centrifuged, and soluble single domain antibody protein in supernatant is collected;
f 3 : obtaining the protein with the purity of more than 95 percent by Ni + ion affinity chromatography.
Referring to fig. 3, in fig. 3, M is the protein molecule standard, and the band 1 is the crude protein extract after the disruption.
The band 5 is the sample remaining after passing the eluent containing 400 mM imidazole through the Ni column, and it can be seen from this band that almost all of the proteins of the Ni + column are eluted, and the target protein is relatively pure.
5. Single domain antibody and HSA antigen binding Activity assay
The above process has screened and purified the target antibody, and in order to verify the activity of the target antibody, the experimental steps are as follows:
a 4 : diluting the HSA antigen to 2 mug/ml and 100 mul/well by 0.05M Na2CO3 & NaHCO3 (pH 9.5), coating the antigen on a 96-well plate, and incubating overnight at 4 ℃;
b 4 : washing the plate three times with PBS, 300. Mu.l 2% BSA (or 1% CPBS) blocking the 96-well plate, incubating for 2 hours at 37 ℃;
c 4 : adding purified HSA single-domain antibodies with different dilution concentrations, adding the purified HSA single-domain antibodies according to 100 mu l/hole, and incubating for 1 hour at 37 ℃;
d 4 : wash plates three times with 0.05% pbst;
e 4 : adding 5000-time diluted anti Myctag anti body (HRP), adding according to 100 mu l/hole, and incubating for 1 hour at 37 ℃;
f 4 : wash the plate three times with 0.05% PBST, add TMB100 μ l/well, and keep out of the sun and stand for 10 minutes at room temperature. g4: adding 2M H2SO4 50 mu l/hole to terminate the reaction;
g 4 : the OD value of the sample at a wavelength of 450 nm was measured by a microplate reader.
As can be seen from FIG. 4, even when the concentration of the HSA single domain antibody bound to the HSA antigen was 0.08 μ g/ml, a higher activity was detected.
In addition, the concentration of the purified protein was measured using a spectrophotometer, and the total amount of the expressed, extracted, and purified protein was 4.05mg. Since the expression system used in the examples was 200ml, the unit expression amount of the HSA single domain antibody prokaryotic expression system constructed in this example was 2.02 mg/100ml of bacterial solution
The expression efficiency of the expression system used in the examples on proteins, i.e., the protein mass obtainable per unit expression volume, can be demonstrated by analytically calculating the expression amount finally obtained. Under the general condition, the expression level reaches 0.5mg/100ml, namely the expression level is considered to be higher, and the expression level of the HSA single-domain antibody reaches 2.02 mg/100ml, which is four times of the existing higher industrial level.
Finally, in the invention, the HSA single domain antibody is a nano antibody, has small molecular weight and low production and manufacturing cost, and is beneficial to the subsequent modification of the HSA single domain antibody.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and all modifications and equivalents of the present invention, which are made by the contents of the present specification and the accompanying drawings, or directly/indirectly applied to other related technical fields, are included in the scope of the present invention.
Sequence listing
<120> HSA single domain antibody, nucleic acid and kit
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
cgccatcaag gtaccagttg a 21
<210> 2
<211> 36
<212> DNA
<213> Artificial sequence
<400> 2
cgggatccca ggtacagctg gtggagtctg ggggag 36
<210> 3
<211> 36
<212> DNA
<213> Artificial sequence
<400> 3
ccgctcgagt acttcattcg ttcctgagga gacggt 36
<210> 4
<211> 28
<212> DNA
<213> Artificial sequence
<400> 4
ccgctcgagt gaggagacgg tgacctgg 28
<210> 5
<211> 36
<212> DNA
<213> Artificial sequence
<400> 5
cgggatccga ggtacagctg gtggagtctg ggggag 36
<210> 6
<211> 369
<212> DNA
<213> Artificial sequence
<400> 6
gatgtgcagc tgcaggcgtc tgggggagac ctggtgcagg ctggagggtc tctgagactc 60
tcctgccacg cctctggttt ggatgattat atcattggct ggttccgcca ggccccaggg 120
aaggagcgcg agggcctctc atgtattagt agaagtgatg gtaacacata ctatgcagag 180
tccgtgaagg gccgattcac catttccagt gacaacgcca agaacacggt gtatctgcaa 240
atggacagcc tgaaacctga ggacacggct gtttattact gtgcagcaga tcgatatcgg 300
tcgggatttt tggggaatgg atatgagtat gactactggg gccaggggac ccaggtcacc 360
gtctcctca 369
<210> 7
<211> 123
<212> PRT
<213> Artificial sequence
<400> 7
Ala Val Gly Leu Gly Ala Ser Gly Gly Ala Leu Val Gly Ala Gly Gly
1 5 10 15
Ser Leu Ala Leu Ser Cys His Ala Ser Gly Leu Ala Ala Thr Ile Ile
20 25 30
Gly Thr Pro Ala Gly Ala Pro Gly Leu Gly Ala Gly Gly Leu Ser Cys
35 40 45
Ile Ser Ala Ser Ala Gly Ala Thr Thr Thr Ala Gly Ser Val Leu Gly
50 55 60
Ala Pro Thr Ile Ser Ser Ala Ala Ala Leu Ala Thr Val Thr Leu Gly
65 70 75 80
Met Ala Ser Leu Leu Pro Gly Ala Thr Ala Val Thr Thr Cys Ala Ala
85 90 95
Ala Ala Thr Ala Ser Gly Pro Leu Gly Ala Gly Thr Gly Thr Ala Thr
100 105 110
Thr Gly Gly Gly Thr Gly Val Thr Val Ser Ser
115 120
Claims (4)
1. An HSA single domain antibody having the amino acid sequence of SEQ ID NO: shown in fig. 7.
2. A nucleic acid encoding the HSA single domain antibody of claim 1.
3. The nucleic acid of claim 2, wherein the nucleic acid sequence is as set forth in SEQ ID NO: and 6, respectively.
4. A kit comprising the HSA single domain antibody of claim 1 or comprising the nucleic acid of claim 2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910297997.4A CN109942704B (en) | 2019-04-12 | 2019-04-12 | HSA single domain antibodies, nucleic acids and kits |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910297997.4A CN109942704B (en) | 2019-04-12 | 2019-04-12 | HSA single domain antibodies, nucleic acids and kits |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109942704A CN109942704A (en) | 2019-06-28 |
| CN109942704B true CN109942704B (en) | 2023-01-20 |
Family
ID=67015090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910297997.4A Active CN109942704B (en) | 2019-04-12 | 2019-04-12 | HSA single domain antibodies, nucleic acids and kits |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109942704B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111234015B (en) * | 2020-02-12 | 2021-04-06 | 康维众和(中山)生物药业有限公司 | Antibody for prolonging half life of medicine, fusion protein and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107674122A (en) * | 2016-12-28 | 2018-02-09 | 天津天锐生物科技有限公司 | A kind of single domain antibody for identifying human serum albumins |
| GB201818460D0 (en) * | 2018-11-13 | 2018-12-26 | Crescendo Biologics Ltd | Single domain antibodies that bind human serum albumin |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2010511397A (en) * | 2006-12-05 | 2010-04-15 | アブリンクス エン．ヴェー． | Peptides that can bind to serum proteins |
-
2019
- 2019-04-12 CN CN201910297997.4A patent/CN109942704B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107674122A (en) * | 2016-12-28 | 2018-02-09 | 天津天锐生物科技有限公司 | A kind of single domain antibody for identifying human serum albumins |
| GB201818460D0 (en) * | 2018-11-13 | 2018-12-26 | Crescendo Biologics Ltd | Single domain antibodies that bind human serum albumin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109942704A (en) | 2019-06-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109970858B (en) | CD22 single domain antibody, nucleotide sequence and kit | |
| JP6092486B2 (en) | Nanoantibody immunoadsorbent for aflatoxin, immunoaffinity column, preparation method thereof and application thereof | |
| CN110003333B (en) | Polypeptide, PD-L1 single domain antibody, nucleotide sequence and kit | |
| CN110003329B (en) | Polypeptide, IL17A/F single domain antibody, nucleotide sequence and kit | |
| CN108753792B (en) | Encoding gene of green fluorescent protein nano antibody and preparation method and application thereof | |
| CN110003336B (en) | PD-1 single domain antibody, nucleotide sequence and kit | |
| CN110003335A (en) | VHH chain of CD47 single domain antibody, CD47 single domain antibody, nucleotide sequence and kit | |
| CN111217908B (en) | CD22 single domain antibody, nucleotide sequence, kit, CAR-T viral vector and CAR-T cell | |
| Eteshola | Isolation of scFv fragments specific for monokine induced by interferon-gamma (MIG) using phage display | |
| CN113278074B (en) | anti-CEACAM 5 nano antibody | |
| CN110105450B (en) | VEGF single domain antibody, nucleotide sequence and kit | |
| US20080103055A1 (en) | Polypeptide | |
| CN110003337B (en) | IL17RA single domain antibody, nucleic acid and kit | |
| CN109942704B (en) | HSA single domain antibodies, nucleic acids and kits | |
| US20220228138A1 (en) | Method for preparing phage library | |
| CN110804096B (en) | CD123 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN110003334B (en) | Polypeptide, CD19 single domain antibody, preparation method thereof, nucleotide sequence and kit | |
| CN110003330B (en) | TNF-alpha single domain antibody, nucleic acid molecule and kit | |
| CN113461816A (en) | Nano antibody aiming at green fluorescent protein GFP and application thereof | |
| CN112250765A (en) | Nano antibody aiming at HER2 and application thereof | |
| CN110981959A (en) | CD47 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN114656557B (en) | Serum ferritin specific nano antibody and ELISA method thereof | |
| CN113683684B (en) | Anti-hepatitis B virus surface antigen antibody, antibody pair, detection reagent containing same and kit | |
| CN118027204A (en) | Anti-ProGRP nano antibody and application thereof | |
| CN114249820B (en) | Alpaca-derived nanobody combined with SARS-CoV-2RBD |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: Room 605, building 1, Shenzhen Biomedical Innovation Industrial Park, 14 Jinhui Road, Jinsha community, Kengzi street, Pingshan District, Shenzhen, Guangdong 518000 Applicant after: Shenzhen prijin biopharmaceutical Co.,Ltd. Address before: 518000 Building 402, Shenzhen Biomedical Innovation Industrial Park, No. 14 Jinhui Road, Kengzi Street, Pingshan District, Shenzhen City, Guangdong Province Applicant before: SHENZHEN PREGENE BIOPHARMA Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |