CN109970858B - CD22 single domain antibody, nucleotide sequence and kit - Google Patents
CD22 single domain antibody, nucleotide sequence and kit Download PDFInfo
- Publication number
- CN109970858B CN109970858B CN201910297462.7A CN201910297462A CN109970858B CN 109970858 B CN109970858 B CN 109970858B CN 201910297462 A CN201910297462 A CN 201910297462A CN 109970858 B CN109970858 B CN 109970858B
- Authority
- CN
- China
- Prior art keywords
- ser
- gly
- val
- ala
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Life Sciences & Earth Sciences (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a CD22 single domain antibody, a nucleotide sequence and a kit, wherein the single domain antibody comprises four framework regions FR1, FR2, FR3 and FR4, and three variable regions CDR1, CDR2 and CDR3. According to the technical scheme, the single-domain antibody specifically binding with the CD22 protein is obtained by a binding genetic engineering method, and the antibody has high expression of specifically binding with the CD22 protein and is easy to reconstruct.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a CD22 single domain antibody, a nucleotide sequence and a kit.
Background
The CD22 antigen, also known as sialic acid binding immunoglobulin-like lectin 2, is a type ii transmembrane glycoprotein of B cells, and exists in two distinct subtypes, α, β, with a molecular weight of approximately 135kD. CD22 is a member of the immunoglobulin superfamily, a B lymphocyte-restricted antigen. CD22 is expressed on the cell membrane of mature B cells and the amount of expression increases upon cell activation. In addition, CD22 is also expressed in B cell lymphoma cells in large quantities, and thus can be used as a novel target for B cell non-Hodgkin lymphoma treatment. Studies have shown that CD22 antibodies can block CD 22-mediated cell adhesion, cause changes in intracellular signaling systems, and promote apoptosis. The preparation has a certain treatment effect on non-Hodgkin's lymphoma, and also has good application prospects in organ transplantation and autoimmune disease treatment.
In the prior art, the expression level of the CD22 antibody is low, the binding activity is low, the molecular weight is large, the production cost is high, and the transformation is not easy.
Disclosure of Invention
The main objective of the present invention is to provide a polypeptide sequence, which aims at solving at least one technical problem of the CD22 antibody.
To achieve the above object, the present invention provides a CD22 single domain antibody (SEQ ID NO: 7) comprising four framework regions FR1, FR2, R3, FR4 and three complementarity determining regions CDR1, CDR2, CDR3, wherein,
FR1：Glu Val GlnLeu Val GluSerGlyGlyGlyLeu Val GlnAlaGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyGlyThrPheSer；
CDR1：Ser Tyr Thr Met Gly；
FR2：TrpPheArgGlnAlaPro Gly Lys GluArgGluPhe Val Thr；
CDR2：GlyIle Ser Pro SerGlyAla Tyr ThrSer TyrAla Asp Ser Val Lys；
FR3：GlyArgPheThr IleSerArg Asp AsnAla Lys AsnThr Met PheVal Gln Met AsnSerLeu Lys Pro Glu AspThrAla Val Tyr TyrCysGlu；
CDR3：Ala AspArg Tyr GlyLeuLeu His ThrAlaGluAsp Val Tyr Pro；
FR4：CysTrpGlyGlyGlyThrGln Val Ala Val SerSer。
the invention also provides a nucleotide sequence encoding a CD22 single domain antibody comprising four framework regions FR1, FR2, R3, FR4, and three complementarity determining regions CDR1, CDR2, CDR3, wherein,
FR1：Glu Val GlnLeu Val GluSerGlyGlyGlyLeu Val GlnAlaGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyGlyThrPheSer；
CDR1：Ser Tyr Thr Met Gly；
FR2：TrpPheArgGlnAlaPro Gly Lys GluArgGluPhe Val Thr；
CDR2：GlyIle Ser Pro SerGlyAla Tyr ThrSer TyrAla Asp Ser Val Lys；
FR3：GlyArgPheThr IleSerArg Asp AsnAla Lys AsnThr Met PheVal Gln Met AsnSerLeu Lys Pro Glu AspThrAla Val Tyr TyrCysGlu；
CDR3：Ala AspArg Tyr GlyLeuLeu His ThrAlaGluAsp Val Tyr Pro；
FR4：CysTrpGlyGlyGlyThrGln Val Ala Val SerSer。
in one embodiment, the nucleotide sequence is as follows:
GAGGTACAGCTGGTGGAATCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGAGGGACCTTTAGCTCATATACCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTGACAGGAATTAGTCCGAGTGGTGCTTACACCTCCTATGCAGACTCCGTGAAGGGCCGATTCACCATTTCCAGAGACAACGCCAAGAACACGATGTTTGTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGAAGCCGATCGATACGGTTTGCTGCACACTGCGGAGGATGTGTATCCTTGCTGGGGCGGGGGGACCCAGGTCGCCGTCTCCTCA。
the invention also provides a kit comprising a CD22 single domain antibody, or a nucleotide sequence; said single domain antibody said CD22 single domain antibody comprises four framework regions FR1, FR2, R3, FR4, and three complementarity determining regions CDR1, CDR2, CDR3, wherein,
FR1：Glu Val GlnLeu Val GluSerGlyGlyGlyLeu Val GlnAlaGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyGlyThrPheSer；
CDR1：Ser Tyr Thr Met Gly；
FR2：TrpPheArgGlnAlaPro Gly Lys GluArgGluPhe Val Thr；
CDR2：GlyIle Ser Pro SerGlyAla Tyr ThrSer TyrAla Asp Ser Val Lys；
FR3：GlyArgPheThr IleSerArg Asp AsnAla Lys AsnThr Met PheVal Gln Met AsnSerLeu Lys Pro Glu AspThrAla Val Tyr TyrCysGlu；
CDR3：Ala AspArg Tyr GlyLeuLeu His ThrAlaGluAsp Val Tyr Pro；
FR4: cysTrpGlyGlyGlyThrGln Val Ala Val SerSer; the nucleotide sequence is as follows:
GAGGTACAGCTGGTGGAATCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGAGGGACCTTTAGCTCATATACCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTGACAGGAATTAGTCCGAGTGGTGCTTACACCTCCTATGCAGACTCCGTGAAGGGCCGATTCACCATTTCCAGAGACAACGCCAAGAACACGATGTTTGTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGAAGCCGATCGATACGGTTTGCTGCACACTGCGGAGGATGTGTATCCTTGCTGGGGCGGGGGGACCCAGGTCGCCGTCTCCTCA。
according to the technical scheme, the single-domain antibody specifically binding with the CD22 protein is obtained by a genetic engineering binding method, and has the advantages of high activity of specifically binding with the CD22 protein, high expression level, low production cost and easy transformation.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1 is a first round of PCR single domain antibody gene electrophoresis;
FIG. 2 is a diagram showing the second round of PCR single domain antibody gene electrophoresis after recovery of 750bp-500bp, 2-lane and 3-lane DNA in lane 1 of FIG. 1;
FIG. 3 is a graph showing the binding activity of the CD22 single domain antibodies of the present invention to CD22 antigen.
The achievement of the objects, functional features and advantages of the present invention will be further described with reference to the accompanying drawings, in conjunction with the embodiments.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The invention provides a CD22 single domain antibody, a nucleotide sequence and a kit. The following will describe the polypeptides and their screening process in detail.
First, the polypeptide of the invention has four framework regions and three complementarity determining regions:
FR1：Glu Val GlnLeu Val GluSerGlyGlyGlyLeu Val GlnAlaGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyGlyThrPheSer；
CDR1：Ser Tyr Thr Met Gly；
FR2：TrpPheArgGlnAlaPro Gly Lys GluArgGluPhe Val Thr；
CDR2：GlyIle Ser Pro SerGlyAla Tyr ThrSer TyrAla Asp Ser Val Lys；
FR3：GlyArgPheThr IleSerArg Asp AsnAla Lys AsnThr Met PheVal Gln Met AsnSerLeu Lys Pro Glu AspThrAla Val Tyr TyrCysGlu；
CDR3：Ala AspArg Tyr GlyLeuLeu His ThrAlaGluAsp Val Tyr Pro；
FR4：CysTrpGlyGlyGlyThrGln Val Ala Val SerSer。
aiming at the CD22 single domain antibody, the construction mode of the invention is divided into construction of an antibody library, screening of specific phage, screening of specific positive monoclonal and expression and purification of the CD22 single domain antibody in host escherichia coli. The following will be described in detail for each step.
1. Construction of antibody libraries
CD22 antigen: manufacturer Beijing Yiqiao Shenzhou, product number 11958-H08H1.
2mg of the antigen was mixed with an equal volume of Freund's adjuvant. Adult healthy alpaca is selected, the antigen is injected, 6 times of immunization are carried out, alpaca serum is adopted after the 4 th immunization, and antigen immune titer is measured by a chemiluminescence method.
a 0 Lymphocytes are isolated. When the immunization titer was 1 ten thousand times or more, 150ml of whole blood was collected, and lymphocytes were isolated using QIAGEN kit (QIAamp RNA Blood Mini Kit (50), cat# 52304).
b 0 Cracking. The lymphocytes after isolation were lysed to obtain a cDNA library, and the concentration of cDNA was determined using QIAGEN kit (QIAamp RNA Blood Mini Kit (50), cat# 52304).
c 0 : nested PCR amplification. PCR amplification of the VHH gene fragment of the heavy chain variable region of the antibody was performed with two sets of primers using a cDNA synthesis kit (MiniBESTAgarose Gel DNAExtraction Kit Ver.4.0, TAKARA Co.) using a nested PCR method;
the first PCR amplification can obtain a common antibody gene fragment of more than 800bp, a heavy chain antibody gene fragment of 800-500 bp with a deletion light chain, and a heavy chain antibody variable region fragment VHH of 500bp, and the 800-500 bp gene fragment and the 500bp gene fragment are screened out by electrophoresis.
d 0 : cutting and recycling, and carrying out the step c 0 And (5) cutting and recycling the gene fragments of 800-500 bp. Referring specifically to FIG. 1, the number 1 band is a common antibody DNA, two bands of which are more than 800bp (common antibody DNA) and 500-750 bp (heavy chain antibody DNA) can be seen, and the band of 750-500 bp in the figure is cut and recovered. Bands 2 and 3 are heavy chain antibody variable region fragments VHH, with the size of 500bp; the target strips of the No. 2 and No. 3 bands are also recovered.
e 0 : amplification of the VHH gene of interest. The gene fragment of the recovered complete heavy chain antibody and the heavy chain variable region thereof is used as a template, and VHH specific primers are used for carrying out second PCR amplification to obtain the VHH target gene (500 bp). Referring to FIG. 2, a bright band is seen in which the VHH target gene is about 500bp, i.e., the bright band is mixed with a plurality of VHH target genes of about 500 bp.
The first round PCR primer comprises SEQ ID NO: 1. SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.
Wherein SEQ ID NO:1 and SEQ ID NO:2, performing pairing, and amplifying to obtain two bands shown in lane 1 in FIG. 1; SEQ ID NO:2 and SEQ ID NO:3, and amplifying to obtain one band shown in lane 2 of FIG. 1.
The second round PCR primers include SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence. SEQ ID NO:4 and SEQ ID NO:5, and obtaining the 500bp target gene shown in figure 2.
f 0 : transferring into TG1 competent cells. The VHH fragment obtained above was ligated to pHEN6 phage display vector plasmid (by BamHI, xhoI double cleavage), followed by ligation of the VHH fragment and pHEN6 vector (ZL 20111028003.1) via ligase, electrotransformation into TG1 competent cells, followed by plating of the competent cells with plates and verification of VHH gene insertion rate by colony PCR.
After verifying that VHH gene insertion was successful, clone efficiency detection was performed on the recombinant gene: the electrotransformation bacterial liquid is coated on an LB/Amp plate, cultured at 32 ℃ overnight, and the connection efficiency of the antibody is verified by a colony PCR method on the next day.
The colony PCR method is as follows: 1. individual colonies were picked with autoclaved toothpicks or tips, spot-kept (marked) on resistant plates and then stirred in 20ul Triton-x100 (or deionized water). 2. An EP tube containing 20ul Triton x-100 was boiled at 100℃for 2 minutes. 3.1 ul of supernatant is taken as a template, and a PCR system, which can be 20ul, is added for PCR reaction. 4. The results were observed by agarose gel electrophoresis.
When the connection efficiency of the phage antibody library is lower than 90%, the experimental process is required to be repeated in case of misoperation; when the phage antibody library efficiency reached 90%, the next operation was performed.
g 0 : and (5) performing expansion culture and preserving. The electrotransformation bacteria liquid is coated on LB/Amp plates, the overnight culture is washed by a 2YT culture medium, the expansion culture is carried out in the 2YT culture medium according to the proportion of 1:1000, helper phage M13K07 (Invitrogen) is added for infection, the overnight culture is carried out, centrifugation is carried out, 20% PEG-2.5M NaCl is added after supernatant is collected for uniform mixing (phage in supernatant), sediment is collected after centrifugation, PBS and glycerol are added for resuspension, and the sediment is preserved at-80 ℃ for standby.
2. Screening of specific phages
Because there are several VHH fragments amplified by nested PCR, not all of these gene fragments are target fragments, and after the VHH fragments are transferred into phage, the target phage needs to be enriched, and the following steps are as follows:
a 1 CPBS solution preparation. Adding a small amount of non-fat milk into the PBS solution, wherein the non-fat milk accounts for 1% -5% (blocking effect); diluting the CD22 protein dissolved in the CPBS solution to 150 μg/ml;
b 1 : after dilution of CD22 protein, 150 μl/well was coated;
c 1 : standing, removing the coating liquid, adding a sealing liquid (1% CPBS) 300 μl/hole, and sealing at 37deg.C for 2 hr;
d 1 : adding the selected phage into the micropores, and adding a sealing solution, and uniformly mixing until the volume of each hole is 150 mu l;
e 1 : incubation for 2h at room temperature (antibody secreted on the outer shell of phage, antibody bound to CD22 protein);
f 1 : the mesh was washed 10 times with PBST (containing 0.05% Tween 20) and PBS, 2min each, and unbound phage were washed away;
g 1 : adding TEA into the sieve holes to elute phage, blowing and sucking to suspend uniformly, and standing for 10min at room temperature;
h 1 : blowing and sucking the suspension again, adding the suspension into precooled 1M Tris-HCl, mixing uniformly, and measuring the titer;
i 1 amplifying and purifying the amplified phage.
Step a above 1 To step i 1 Repeating the steps three times and using the step i 1 Phage as the next round of step d 1 The phage added to the microwells (phage from the first round of phage were stored at-80℃as described above).
The screening results are detailed in the following table
Step a above 1 To step i 1 The coated CD22 antigen is used as a target, 3 rounds of screening are carried out from a total phage antibody library by adopting a solid phase screening method, and the titer of the phage eluted in each round is detected, and as the number of screening rounds is increased, the coating concentration is gradually reduced, but the titer of the phage eluted is increased, namely the CD22 specific phage is enriched efficiently.
3. Screening of specific positive monoclonal
The phage have been enriched efficiently and specific CD22 single domain antibody monoclonal will be further screened as follows. The method comprises the following specific steps:
a 2 : by SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence, carrying out PCR amplification on the enriched CD22 specific phage to obtain a specific CD22 single domain antibody gene (PCR product with restriction enzyme BbsI and BamHI sites);
b 2 : the PCR product and pSJF2 vector (ZL 201110280031) are treated by restriction endonucleases BbsI and BamHI respectively, and are recombined by T4 ligase connection to obtain plasmid sdAb-pSJF2 which can be efficiently expressed in escherichia coli;
c 2 : multiple single colonies (e.g., 50 to 95) were randomly picked from an agar plate on which they were grown, and inoculated into 96-well deep-well plates containing Amp in 2YT liquid medium;
d 2 : after 4 hours of culture, the monoclonal antibodies are inoculated on LB solid plates with numbers and separated by cells in a one-to-one correspondence manner, wherein the LB solid plates contain Amps;
e 2 : adding IPTG to the deep-hole culture plate to a final concentration of 0.5mM for induction;
f 2 : after overnight culture, the protein-expressing bacterial supernatant was harvested;
g 2 : ELISA determination is carried out by using CD22 antigen, and the ELISA determination result of Anti-CD22 positive clone is selected;
h 2 : the selected CD22 positive clones were DNA sequenced to identify the gene sequence of the anti-CD22 single domain antibody clone SEQ ID NO:6.
SEQ ID NO: the sequence 6 is as follows:
GAGGTACAGCTGGTGGAATCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGAGGGACCTTTAGCTCATATACCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTGACAGGAATTAGTCCGAGTGGTGCTTACACCTCCTATGCAGACTCCGTGAAGGGCCGATTCACCATTTCCAGAGACAACGCCAAGAACACGATGTTTGTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGAAGCCGATCGATACGGTTTGCTGCACACTGCGGAGGATGTGTATCCTTGCTGGGGCGGGGGGACCCAGGTCGCCGTCTCCTCA。
4. expression and purification of CD22 single domain antibodies in host E.coli
After the positive monoclonal is obtained, the CD22 antibody can be obtained by expressing the positive monoclonal, and the required CD22 single domain antibody can be obtained by expressing the positive monoclonal mainly through escherichia coli and purifying the positive monoclonal. The specific operation process is as follows:
a 3 : the above strain containing plasmid CD22 was inoculated on LB plate containing ampicillin at 37℃overnight. Because the pSJF2 vector has resistance to ampicillin, only escherichia coli containing the pSJF2 vector can grow on an LB culture plate containing ampicillin, so that the interference of other miscellaneous bacteria is avoided;
b 3 : single colony is selected and inoculated in 5ml LB culture solution containing ampicillin, and shake culture is carried out at 37 ℃ for overnight;
c 3 : 2mL of overnight culture was inoculated into 200mL of LB medium containing ampicillin;
d 3 : shaking culture at 37 ℃ for 240 revolutions per minute, adding 0.5-1.0 mM IPTG when the OD value reaches 0.4-0.6, continuing to culture overnight, and centrifuging to obtain the strain.
e 3 : lysing bacteria by a hypertonic method, centrifuging, and collecting soluble single-domain antibody proteins in supernatant;
f 3 : obtaining the protein with purity of more than 95% through Ni+ ion affinity chromatography.
5. Single domain antibody and CD22 antigen binding Activity assay
The above procedure has been performed to screen and purify the target antibody, and in order to verify the activity of the target antibody, the experimental procedure is as follows:
a 4 : diluting the CD22 antigen to 2 [ mu ] g/ml with 0.05M Na2CO3 NaHCO3 (pH 9.5), coating the antigen on a 96-well plate with 100 [ mu ] l/well, and incubating overnight at 4 ℃;
b 4 : plates were washed three times with PBS, blocked with 300 μl 2% bsa (or 1% cpbs) and incubated for 2 hours at 37 ℃;
c 4 : purified CD22 single domain antibodies with different dilution concentrations are added, and incubated for 1 hour at the temperature of 100 [ mu ] l/Kong Jiaru and 37 ℃;
d 4 : plates were washed three times with 0.05% pbst;
e 4 : adding 5000-fold diluted anti-His anti-ibody (HRP), and incubating for 1 hour at the temperature of 100 mu l/Kong Jiaru and 37 ℃;
f 4 : plates were washed three times with 0.05% PBST, TMB100 μl/well was added, and the plates were allowed to stand at room temperature in the dark for 10 minutes. g4: the reaction was stopped by adding 2M H2SO4 at 50. Mu.l/well;
g 4 : the OD of the sample at 450 nm wavelength was measured with a microplate reader.
As can be seen from fig. 3, even at a concentration of 2 μg/ml after binding of CD22 single domain antibody to CD22 antigen, a higher activity could be detected.
Further, the concentration of the purified protein was measured by using a spectrophotometer, and the total amount of the expressed, extracted and purified protein was found to be 4.55mg. Since the expression system used in the examples was 200ml, the unit expression level of the prokaryotic expression system for CD22 single-domain antibody constructed in the examples was 2.28 mg/100ml
The expression system used in the examples can demonstrate the expression efficiency of the protein, i.e., the amount of the protein available per unit expression volume, by analyzing and calculating the finally obtained expression amount. Under normal conditions, the expression level reaches 0.5mg/100ml, namely the expression level is considered to be higher, and the expression level of the CD22 single domain antibody reaches 2.28 mg/ml, which is far beyond the industry level.
Finally, because the CD22 single domain antibody is a nano antibody in the invention, the subsequent transformation of the nano antibody is facilitated.
The foregoing description is only of the preferred embodiments of the present invention and is not intended to limit the scope of the invention, and all equivalent structural changes made by the description of the present invention and the accompanying drawings or direct/indirect application in other related technical fields are included in the scope of the invention.
Sequence listing
<120> CD22 single domain antibody, nucleotide sequence and kit
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
cgccatcaag gtaccagttg a 21
<210> 2
<211> 36
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
cgggatccca ggtacagctg gtggagtctg ggggag 36
<210> 3
<211> 36
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
ccgctcgagt acttcattcg ttcctgagga gacggt 36
<210> 4
<211> 28
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
ccgctcgagt gaggagacgg tgacctgg 28
<210> 5
<211> 36
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 5
cgggatccga ggtacagctg gtggagtctg ggggag 36
<210> 6
<211> 372
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 6
gaggtacagc tggtggaatc tgggggagga ttggtgcagg ctgggggctc tctgagactc 60
tcctgtgcag cctctggagg gacctttagc tcatatacca tgggctggtt ccgccaggct 120
ccagggaagg agcgtgagtt tgtgacagga attagtccga gtggtgctta cacctcctat 180
gcagactccg tgaagggccg attcaccatt tccagagaca acgccaagaa cacgatgttt 240
gtgcaaatga acagcctgaa acctgaggac acggccgttt attactgtga agccgatcga 300
tacggtttgc tgcacactgc ggaggatgtg tatccttgct ggggcggggg gacccaggtc 360
gccgtctcct ca 372
<210> 7
<211> 124
<212> PRT
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 7
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val
35 40 45
Thr Gly Ile Ser Pro Ser Gly Ala Tyr Thr Ser Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Phe
65 70 75 80
Val Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Glu Ala Asp Arg Tyr Gly Leu Leu His Thr Ala Glu Asp Val Tyr Pro
100 105 110
Cys Trp Gly Gly Gly Thr Gln Val Ala Val Ser Ser
115 120
Claims (4)
1. A CD22 single domain antibody is characterized by comprising four framework regions FR1, FR2, R3 and FR4 and three complementarity determining regions CDR1, CDR2 and CDR3,
FR1：Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
CDR1：Ser Tyr Thr Met Gly；
FR2：Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Thr；
CDR2：Gly Ile Ser Pro Ser Gly Ala Tyr Thr Ser Tyr Ala Asp Ser Val Lys；
FR3：Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Phe Val Gln MetAsn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Glu；
CDR3：Ala Asp Arg Tyr Gly Leu Leu His Thr Ala Glu Asp Val Tyr Pro；
FR4：Cys Trp Gly Gly Gly Thr Gln Val Ala Val Ser Ser。
2. a nucleic acid encoding the CD22 single domain antibody of claim 1.
3. The nucleic acid of claim 2, wherein the nucleic acid sequence is as follows:
GAGGTACAGCTGGTGGAATCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGAGGGACCTTTAGCTCATATACCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTGACAGGAATTAGTCCGAGTGGTGCTTACACCTCCTATGCAGACTCCGTGAAGGGCCGATTCACCATTTCCAGAGACAACGCCAAGAACACGATGTTTGTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGAAGCCGATCGATACGGTTTGCTGCACACTGCGGAGGATGTGTATCCTTGCTGGGGCGGGGGGACCCAGGTCGCCGTCTCCTCA。
4. a kit comprising the CD22 single domain antibody of claim 1, or the nucleic acid of claim 2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910297462.7A CN109970858B (en) | 2019-04-12 | 2019-04-12 | CD22 single domain antibody, nucleotide sequence and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910297462.7A CN109970858B (en) | 2019-04-12 | 2019-04-12 | CD22 single domain antibody, nucleotide sequence and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109970858A CN109970858A (en) | 2019-07-05 |
| CN109970858B true CN109970858B (en) | 2023-05-09 |
Family
ID=67084483
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910297462.7A Active CN109970858B (en) | 2019-04-12 | 2019-04-12 | CD22 single domain antibody, nucleotide sequence and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109970858B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111217908B (en) * | 2019-11-29 | 2021-07-06 | 深圳普瑞金生物药业有限公司 | CD22 single domain antibody, nucleotide sequence, kit, CAR-T viral vector and CAR-T cell |
| US20230416360A1 (en) * | 2020-12-03 | 2023-12-28 | Simcere Zaiming Pharmaceutical Co., Ltd. | Anti-cd22 nano antibody and use thereof |
| US20240084003A1 (en) * | 2021-01-18 | 2024-03-14 | Simcere Zaiming Pharmaceutical Co., Ltd. | Anti-human cd22 monoclonal antibodies and use thereof |
| CN114230665B (en) * | 2021-06-23 | 2024-03-22 | 苏州智核生物医药科技有限公司 | CD8 alpha binding polypeptides and uses thereof |
| CN114113639B (en) * | 2022-01-29 | 2022-04-19 | 北京大有天弘科技有限公司 | Blood type antibody detection method and application thereof |
| CN116836280B (en) * | 2023-09-01 | 2023-10-31 | 北京纳百生物科技有限公司 | Anti-estriol monoclonal antibody, detection reagent and application thereof |
| CN117582506B (en) * | 2024-01-17 | 2024-04-02 | 首都医科大学附属北京儿童医院 | Application of transmembrane protein TMEFF1 inhibitor in preparation of medicine for treating neuroblastoma |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101626782A (en) * | 2006-12-01 | 2010-01-13 | 梅达雷克斯公司 | Human antibodies that bind CD22 and uses thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106029098A (en) * | 2014-02-25 | 2016-10-12 | 免疫医疗公司 | Humanized RFB4 anti-CD22 antibody |
| US10738116B2 (en) * | 2015-03-19 | 2020-08-11 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Dual specific anti-CD22-anti-CD19 chimeric antigen receptors |
-
2019
- 2019-04-12 CN CN201910297462.7A patent/CN109970858B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101626782A (en) * | 2006-12-01 | 2010-01-13 | 梅达雷克斯公司 | Human antibodies that bind CD22 and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| Development and characterization of a camelid single-domain antibody directed to human CD22 biomarker;Fatemeh Faraji et al;《Biotechnology and Applied Biochemistry》;20180406;第65卷(第5期);第718页摘要，第719-720页第2.1-2.4节，第720页第2.7节，第721页第3.2节以及图2，第722页第3.4节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109970858A (en) | 2019-07-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109970858B (en) | CD22 single domain antibody, nucleotide sequence and kit | |
| CN110003335B (en) | CD47 single domain antibody, nucleic acid and kit | |
| CN110003336B (en) | PD-1 single domain antibody, nucleotide sequence and kit | |
| JP3344584B2 (en) | Recombinant library screening method | |
| Steiner et al. | Efficient selection of DARPins with sub-nanomolar affinities using SRP phage display | |
| KR101732552B1 (en) | Screening and Engineering Method of Super-Stable Immunoglobulin Variable Domains and Their Uses | |
| CN110003333B (en) | Polypeptide, PD-L1 single domain antibody, nucleotide sequence and kit | |
| CN110003337B (en) | IL17RA single domain antibody, nucleic acid and kit | |
| CN110003329B (en) | Polypeptide, IL17A/F single domain antibody, nucleotide sequence and kit | |
| CN111217908B (en) | CD22 single domain antibody, nucleotide sequence, kit, CAR-T viral vector and CAR-T cell | |
| CN113493510A (en) | Bovine-derived single-chain antibody for resisting staphylococcus aureus LukD virulence factor and preparation and application thereof | |
| CN111848790B (en) | Bovine-derived single-chain antibody for resisting staphylococcus aureus and preparation and application thereof | |
| CN108017712B (en) | Protein skeleton derived from shark antibody and application thereof | |
| CN110105450B (en) | VEGF single domain antibody, nucleotide sequence and kit | |
| US20220228138A1 (en) | Method for preparing phage library | |
| CN110878124B (en) | Antibody fragment of DNA polymerase, antibody and application thereof | |
| CN111138532A (en) | Use of single domain antibodies against hepatitis a virus | |
| CN109942704B (en) | HSA single domain antibodies, nucleic acids and kits | |
| CN110003334B (en) | Polypeptide, CD19 single domain antibody, preparation method thereof, nucleotide sequence and kit | |
| CN110003330B (en) | TNF-alpha single domain antibody, nucleic acid molecule and kit | |
| CN110804096A (en) | CD123 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN106905435B (en) | Method for preparing binding protein based on protein A mutant | |
| CN113912729B (en) | Single-domain antibody aiming at sST2, and derivative protein and application thereof | |
| CN114369165B (en) | Bovine single-chain antibody of bovine-derived anti-staphylococcus aureus virulence factor GapC, preparation method and application thereof | |
| CN114605555B (en) | Bispecific neutralizing antibody for resisting novel coronavirus SARS-CoV-2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: Room 605, building 1, Shenzhen Biomedical Innovation Industrial Park, 14 Jinhui Road, Jinsha community, Kengzi street, Pingshan District, Shenzhen, Guangdong 518000 Applicant after: Shenzhen prijin biopharmaceutical Co.,Ltd. Address before: 518000 Building 402, Shenzhen Biomedical Innovation Industrial Park, No. 14 Jinhui Road, Kengzi Street, Pingshan District, Shenzhen City, Guangdong Province Applicant before: SHENZHEN PREGENE BIOPHARMA Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |