CN110003336B - PD-1 single domain antibody, nucleotide sequence and kit - Google Patents
PD-1 single domain antibody, nucleotide sequence and kit Download PDFInfo
- Publication number
- CN110003336B CN110003336B CN201910301975.0A CN201910301975A CN110003336B CN 110003336 B CN110003336 B CN 110003336B CN 201910301975 A CN201910301975 A CN 201910301975A CN 110003336 B CN110003336 B CN 110003336B
- Authority
- CN
- China
- Prior art keywords
- ser
- gly
- ala
- val
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a PD-1 single-domain antibody, a nucleotide sequence and a kit, wherein the PD-1 single-domain antibody comprises four framework regions and three complementarity determining regions CDR1, CDR2 and CDR3, wherein CDR1: ser Tyr Ala Met Gly; CDR2: ala Val Ser Arg Ser Gly Leu Lys Thr Gly Tyr Ala Asp Ser Val Lys; CDR3: ala Arg Asp Glu Arg Val Tyr Ser Asp Ile Asp Phe Phe Arg Pro Phe Asp Tyr Gly. According to the technical scheme, the single-domain antibody specifically binding to the PD-1 protein is obtained through a genetic engineering binding method, and the activity of the antibody specifically binding to the PD-1 protein is high.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a PD-1 single-domain antibody, a nucleotide sequence and a kit.
Background
Programmed death molecule receptor 1 (PD ⁃ 1) belongs to the CD28/CTLA-4 family, is a type I transmembrane receptor protein, consists of 268 amino acids and comprises an intracellular region, a transmembrane region and an extracellular immunoglobulin variable region. Two independent phosphorylation sites, namely an N-terminal Immunoreceptor Tyrosine Switching Motif (ITSM) and a c-terminal Immunoreceptor Tyrosine Inhibitory Motif (ITIM), are arranged in an intracellular region, can be activated through T cell antigens and cytokine receptors, and have the effect of regulating the inhibitory signaling between T cells.
PD-1 is expressed primarily in activated T cells and B cells, and functions to inhibit activation of the cells, a self-stabilizing mechanism of the immune system, avoiding excessive T/B cell activation that can cause autoimmune disease. However, tumor microenvironments induce high expression of PD-1 molecules by infiltrating T cells. Tumor cells can induce the continuous activation of PD-1 channels in the microenvironment, inhibit the functions of T cells, so that the tumor cells cannot be killed, and the immune escape of the tumor cells is realized. And antagonists of this pathway, such as antibodies to PD-1, can block this pathway, partially restoring T cell function, enabling T cells to kill tumor cells.
However, existing PD-1 single domain antibodies have low binding activity to antigen.
Disclosure of Invention
The invention mainly aims to provide a PD-1 single-domain antibody and aims to solve the problem of low activity of the existing PD-1 single-domain antibody.
In order to achieve the above purpose, the invention provides a PD-1 single domain antibody, wherein the PD-1 single domain antibody is shown in SEQ ID NO:7, comprising four framework regions and three complementarity determining regions CDR1, CDR2, CDR3, wherein,
CDR1：Ser Tyr Ala Met Gly；
CDR2：AlaVal SerArgSerGlyLeu Lys ThrGly TyrAla Asp Ser Val Lys；
CDR3：AlaArg AspGluArg Val Tyr Ser Asp Ile Asp PhePheArg Pro Phe Asp Tyr Gly。
in one embodiment, the four framework regions are FR1, FR2, FR3, FR4, respectively, wherein,
FR1：Asp Val GlnLeuGlnAlaSerGlyGlyAlaGln Val Gln Pro GlyGlySerLeuArgLeuSerCysAlaAlaSerGlyArgThrPheSer;
FR2：TrpPheArgGlnAlaPro Gly Lys GluArgGluPhe Val Ala ;
FR3：GlyArgPheThr IleSerArg Asp AsnAla Lys AsnThr Val TyrLeuGln Met AsnSerLeu Lys Pro Glu AspThrAla Val Tyr TyrCysAla;
FR4：Tyr TrpGlyGlnGlyThrGln Val Thr ValSerSer。
the invention also provides a nucleotide sequence encoding a PD-1 single domain antibody comprising four framework regions and three complementarity determining regions CDR1, CDR2, CDR3, wherein,
CDR1：Ser Tyr Ala Met Gly；
CDR2：AlaVal SerArgSerGlyLeu Lys ThrGly TyrAla Asp Ser Val Lys；
CDR3：AlaArg AspGluArg Val Tyr Ser Asp Ile Asp PhePheArg Pro Phe Asp Tyr Gly。
in one embodiment, the nucleotide sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGCGCAGGTGCAGCCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGACGCACTTTCAGTAGCTATGCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTAGCAGCTGTTAGTCGGAGTGGTCTTAAGACTGGCTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGCGCAGCACGTGATGAGAGAGTCTATAGTGATATTGACTTCTTTCGTCCGTTTGATTATGGCTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
the invention also provides a kit comprising a PD-1 single domain antibody, or comprising, for example, a nucleotide sequence; the PD-1 single domain antibody comprises four framework regions and three complementarity determining regions CDR1, CDR2 and CDR3, wherein CDR1: ser Tyr Ala Met Gly; CDR2: alaVal SerArgSerGlyLeu Lys ThrGly TyrAla Asp Ser Val Lys; CDR3: alaArg AspGluArg Val Tyr Ser Asp Ile Asp PhePheArg Pro Phe Asp Tyr Gly; the nucleotide sequence is as follows: GATGTGCAGCTGCAGGCGTCTGGGGGAGCGCAGGTGCAGCCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGACGCACTTTCAGTAGCTATGCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTAGCAGCTGTTAGTCGGAGTGGTCTTAAGACTGGCTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGCGCAGCACGTGATGAGAGAGTCTATAGTGATATTGACTTCTTTCGTCCGTTTGATTATGGCTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA.
According to the technical scheme, the single-domain antibody specifically binding to the PD-1 protein is obtained through a genetic engineering binding method, and has high activity of specifically binding to the PD-1 protein, small molecular weight, low production and manufacturing cost and easy transformation.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1 is a first round of PCR single domain antibody gene electrophoresis;
FIG. 2 is a diagram showing the second round of PCR single domain antibody gene electrophoresis after recovery of 750bp-500bp, 2-lane and 3-lane DNA in lane 1 of FIG. 1;
FIG. 3 is a diagram of purification of protein expression;
FIG. 4 is a graph showing the binding activity of the PD-1 single domain antibody of the invention to PD-1 antigen.
The achievement of the objects, functional features and advantages of the present invention will be further described with reference to the accompanying drawings, in conjunction with the embodiments.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The invention provides a PD-1 single domain antibody, a nucleotide sequence and a kit. The following will describe the PD-1 single domain antibody and the screening process thereof in detail.
First, the PD-1 single domain antibodies of the invention have four framework regions and three complementarity determining regions. Wherein the three complementarity determining regions are the following sequences:
CDR1：Ser Tyr Ala Met Gly；
CDR2：AlaVal SerArgSerGlyLeu Lys ThrGly TyrAla Asp Ser Val Lys；
CDR3：AlaArg AspGluArg Val Tyr Ser Asp Ile Asp PhePheArg Pro Phe Asp Tyr Gly。
of course, there may be a variety of framework region sequences for PD-1 single domain antibodies. The following four frame areas are described in detail as specific examples.
FR1：Glu Val GlnLeu Val GluSerGlyGlyGlyLeu Val GlnAlaGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyGlyThrPheSer；
FR2：TrpPheArgGlnAlaPro Gly Lys GluArgGluPhe Val Thr；
FR3：GlyArgPheThr IleSerArg Asp AsnAla Lys AsnThr Met PheVal Gln Met AsnSerLeu Lys Pro Glu AspThrAla Val Tyr TyrCysGlu；
FR4：CysTrpGlyGlyGlyThrGln Val Ala Val SerSer。
Aiming at the PD-1 single-domain antibody, the construction mode of the invention is divided into construction of an antibody library, screening of specific phage, screening of specific positive monoclonal and expression and purification of the PD-1 single-domain antibody in host escherichia coli. The following will be described in detail for each step.
1. Construction of antibody libraries
PD-1 antigen: manufacturer Acro, cat No. PD1-H82E4.
1mg of the antigen was mixed with an equal volume of Freund's adjuvant. Adult healthy alpaca is selected, the antigen is injected, 6 times of immunization are carried out, alpaca serum is adopted after the 5 th immunization, and antigen immune titer is determined by a chemiluminescence method.
a 0 Lymphocytes are isolated. When the immunization titer was 1 ten thousand times or more, 150ml of whole blood was collected, and lymphocytes were isolated using QIAGEN kit (QIAamp RNA Blood Mini Kit (50), cat# 52304).
b 0 Cracking. The isolated lymphocytes were lysed and then subjected to a CDNA library, and the CDNA concentration was determined using the QIAGEN kit (QIAamp RNA Blood Mini Kit (50), cat# 52304).
c 0 : nested PCR amplification. Two rounds of PCR amplification of the antibody heavy chain variable region VHH gene fragment were performed using cDNA synthesis kit (MiniBESTAgarose Gel DNAExtraction Kit Ver.4.0, TAKARA Co.) using nested PCR method;
the first PCR amplification can obtain a common antibody gene fragment of more than 800bp, a heavy chain antibody gene fragment of 800-500 bp with a deletion light chain, and a heavy chain antibody variable region fragment VHH of 500bp, and the 800-500 bp gene fragment and the 500bp gene fragment are screened out by electrophoresis.
d 0 : and (3) cutting and recycling, namely cutting and recycling the gene fragments of 800-500 bp in the step c 0. Referring specifically to FIG. 1, the number 1 bands are common antibody DNA and heavy chain antibody DNA, two bands can be seen, wherein the two bands are more than 800bp (common antibody DNA) and 500-75 bp0bp (heavy chain antibody DNA), and the band gel at 750bp-500bp in the figure is cut and recovered; bands 2 and 3 are heavy chain antibody variable region fragments VHH, with the size of 500bp; the target strips of the No. 2 and No. 3 bands are also recovered.
e 0 : amplification of the VHH gene of interest. The gene fragment of the recovered complete heavy chain antibody and the heavy chain variable region thereof is used as a template, and VHH specific primers are used for carrying out second PCR amplification to obtain the VHH target gene (500 bp). Referring to FIG. 2, a bright band is seen in which the VHH target gene is about 500bp, i.e., the bright band is mixed with a plurality of VHH target genes of about 500 bp.
The first round PCR primer comprises SEQ ID NO: 1. SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.
Wherein SEQ ID NO:1 and SEQ ID NO:2, performing pairing, and amplifying to obtain two bands shown in lane 1 in FIG. 1; SEQ ID NO:2 and SEQ ID NO:3, and amplifying to obtain one band shown in lane 2 of FIG. 1.
The second round PCR primers include SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence. SEQ ID NO:4 and SEQ ID NO:5, and obtaining the 500bp target gene shown in figure 2.
f 0 : transferring into TG1 competent cells. The VHH fragment obtained above was ligated to pHEN6 phage display vector plasmid (by BamHI, xhoI double cleavage), followed by ligation of the VHH fragment and pHEN6 vector (ZL 20111028003.1) via ligase, electrotransformation into TG1 competent cells, followed by plating of the competent cells with plates and verification of VHH gene insertion rate by colony PCR.
After verifying that VHH gene insertion was successful, clone efficiency detection was performed on the recombinant gene: the electrotransformation bacterial liquid is coated on an LB/Amp plate, cultured at 32 ℃ overnight, and the connection efficiency of the antibody is verified by a colony PCR method on the next day.
The colony PCR method is as follows: 1. individual colonies were picked with autoclaved toothpicks or tips, spot-kept (marked) on resistant plates and then stirred in 20ul Triton-x100 (or deionized water). 2. An EP tube containing 20ul Triton x-100 was boiled at 100℃for 2 minutes. 3.1 ul of supernatant is taken as a template, and a PCR system, which can be 20ul, is added for PCR reaction. 4. The results were observed by agarose gel electrophoresis.
When the connection efficiency of the phage antibody library is lower than 90%, the experimental process is required to be repeated in case of misoperation; when the phage antibody library efficiency reached 90%, the next operation was performed.
g 0 : and (5) performing expansion culture and preserving. The electrotransformation bacteria liquid is coated on LB/Amp plates, the overnight culture is washed by a 2YT culture medium, the expansion culture is carried out in the 2YT culture medium according to the proportion of 1:1000, helper phage M13K07 (Invitrogen) is added for infection, the overnight culture is carried out, centrifugation is carried out, 20% PEG-2.5M NaCl is added after supernatant is collected for uniform mixing (phage in supernatant), sediment is collected after centrifugation, PBS and glycerol are added for resuspension, and the sediment is preserved at-80 ℃ for standby.
2. Screening of specific phages
Because there are several VHH fragments amplified by nested PCR, not all of these gene fragments are target fragments, and after the VHH fragments are transferred into phage, the target phage needs to be purified, and the following steps are used for purifying the target phage:
a 1 CPBS solution preparation. Adding a small amount of non-fat milk into the PBS solution, wherein the non-fat milk accounts for 1% -5% (blocking effect); diluting the PD-1 protein dissolved in CPBS solution to 150 μg/ml;
b 1 : after PD-1 protein dilution, 150 μl/well was coated;
c 1 : standing, removing the coating liquid, adding a sealing liquid (1% CPBS) 300 μl/hole, and sealing at 37deg.C for 2 hr;
d 1 : adding the selected phage into the micropores, and adding a sealing solution, and uniformly mixing until the volume of each hole is 150 mu l;
e 1 : incubation at RT for 2h (outer shell of phage)Upper secretion of antibodies, which bind to PD-1 protein);
f 1 : the mesh was washed 10 times with PBST (containing 0.05% Tween 20) and PBS, 2min each, and unbound phage were washed away;
g 1 : adding TEA into the sieve holes to elute phage, blowing and sucking to suspend uniformly, and standing for 10min at room temperature;
h 1 : blowing and sucking the suspension again, adding the suspension into precooled 1M Tris-HCl, mixing uniformly, and measuring the titer;
i 1 amplifying and purifying the amplified phage.
Step a above 1 To step i 1 Repeating the steps three times and using the step i 1 Phage as the next round of step d 1 The phage added with microwells (phage from the first round of storage at-80 ℃ C., second round of screening coating concentration 10. Mu.g/ml, third round of screening coating concentration 10. Mu.g/ml, second round of coating 150. Mu.l/well, third round of coating).
The screening results are detailed in the following table
Step a above 1 To step i 1 The coated PD-1 antigen is used as a target, 3 rounds of screening are carried out from a total phage antibody library by adopting a solid phase screening method, and the titer of the eluted phage is increased after three rounds of screening, namely, the PD-1 specific phage is enriched with high efficiency.
3. Screening of specific positive monoclonal
Although the above phages have been enriched with high efficiency, there is a small amount of nonspecific phages left, and the specific PD-1 single-domain antibody gene will be further purified in the following. The method comprises the following specific steps:
a 2 : by SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence, PCR amplification of the enriched PD-1 specific phage to obtain specific PD-1 single domain antibody gene (with restriction endonucleasePCR products of BbsI and BamHI sites);
b 2 : the PCR product and pSJF2 vector (ZL 201110280031) are treated by restriction endonucleases BbsI and BamHI respectively, and are recombined by T4 ligase connection to obtain plasmid sdAb-pSJF2 which can be efficiently expressed in escherichia coli;
c 2 : randomly picking a plurality of single colonies from an agar plate for growing the colonies, and then inoculating the single colonies into a 96-well deep-hole culture plate containing a 2YT liquid culture medium of Amp;
d 2 : after 4 hours of culture, the monoclonal antibodies are inoculated on LB solid plates with numbers and separated by cells in a one-to-one correspondence manner, wherein the LB solid plates contain Amps;
e 2 : adding IPTG to the deep-hole culture plate to a final concentration of 0.5mM for induction;
f 2 : after overnight culture, the protein-expressing bacterial supernatant was harvested;
g 2 : ELISA determination is carried out by using PD-1 antigen, and the ELISA determination result of Anti-PD-1 positive clone is selected;
h 2 : the selected PD-1 positive clones were DNA sequenced to identify the gene sequence of the anti-PD-1 single domain antibody clone SEQ ID NO:6.
SEQ ID NO: the sequence 6 is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGCGCAGGTGCAGCCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGACGCACTTTCAGTAGCTATGCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTAGCAGCTGTTAGTCGGAGTGGTCTTAAGACTGGCTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGCGCAGCACGTGATGAGAGAGTCTATAGTGATATTGACTTCTTTCGTCCGTTTGATTATGGCTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
4. PD-1 single domain antibody expression and purification in host E.coli
After the positive monoclonal is obtained, the PD-1 single domain antibody can be obtained by the expression method, and then the required PD-1 single domain antibody can be obtained by expressing the positive monoclonal mainly through escherichia coli and purifying the positive monoclonal. The specific operation process is as follows:
a 3 : inoculating the strain containing the plasmid PD-1On LB plates containing ampicillin, overnight at 37 ℃. Because the pSJF2 vector has resistance to ampicillin, only escherichia coli containing the pSJF2 vector can grow on an LB culture plate containing ampicillin, so that the interference of other miscellaneous bacteria is avoided;
b 3 : single colony is selected and inoculated in 5ml LB culture solution containing ampicillin, and shake culture is carried out at 37 ℃ for overnight;
c 3 : 2mL of overnight culture was inoculated into 200mL of LB medium containing ampicillin;
d 3 : shaking culture at 37 ℃ for 240 revolutions per minute, adding 0.5-1.0 mM IPTG when the OD value reaches 0.4-0.6, continuing to culture overnight, and centrifuging to obtain the strain.
e 3 : lysing bacteria by a hypertonic method, centrifuging, and collecting soluble single-domain antibody proteins in supernatant;
f 3 : obtaining the protein with purity of more than 95% through Ni+ ion affinity chromatography.
Referring to fig. 3, in fig. 3, M is a protein molecular standard, and band 1 is a crude total protein extract sample after bacterial disruption.
5. Single domain antibody binding Activity assay with PD-1 antigen
The above procedure has been performed to screen and purify the target antibody, and in order to verify the activity of the target antibody, the experimental procedure is as follows:
a 4 : diluting the PD-1 antigen to 2 [ mu ] g/ml with 0.05M Na2CO3 NaHCO3 (pH 9.5), coating the antigen on a 96-well plate at 100 [ mu ] l/well, and incubating overnight at 4 ℃;
b 4 : plates were washed three times with PBS, blocked with 300 μl 2% bsa (or 1% cpbs) and incubated for 2 hours at 37 ℃;
c 4 : adding purified PD-1 single-domain antibodies with different dilution concentrations, and incubating for 1 hour at the temperature of 100 [ mu ] l/Kong Jiaru and 37 ℃;
d 4 : plates were washed three times with 0.05% pbst;
e 4 : adding 5000 times diluted antiMyctag antibody (HRP), and incubating for 1 hour at the temperature of 100 mu l/Kong Jiaru and 37 ℃;
f 4 : plates were washed three times with 0.05% PBST, TMB100 μl/well was added, and the plates were allowed to stand at room temperature in the dark for 10 minutes. g4: the reaction was stopped by adding 2M H2SO4 at 50. Mu.l/well;
g 4 : the OD of the sample at 450 nm wavelength was measured with a microplate reader.
As can be seen from fig. 4, even when the concentration of the PD-1 single domain antibody after binding to the PD-1 antigen is 0.016 μg/ml, a higher activity can be detected.
Further, the concentration of the purified protein was measured by using a spectrophotometer, and the total amount of the expressed, extracted and purified protein was found to be 5.92mg. Since the expression system used in the examples was 200ml, the unit expression level of the PD-1 single-domain antibody prokaryotic expression system constructed in the examples was 2.96 mg/100ml
The expression system used in the examples can demonstrate the expression efficiency of the protein, i.e., the amount of the protein available per unit expression volume, by analyzing and calculating the finally obtained expression amount. Under normal conditions, the expression level reaches 0.5mg/100ml, namely the expression level is considered to be higher, and the expression level of the PD-1 single-domain antibody reaches 2.96 mg/ml at this time, which is far beyond the industry level.
Finally, because the PD-1 single domain antibody is a nano antibody, the molecular weight is small, the manufacturing cost is low, and the subsequent transformation of the PD-1 single domain antibody is facilitated.
The foregoing description is only of the preferred embodiments of the present invention and is not intended to limit the scope of the invention, and all equivalent structural changes made by the description of the present invention and the accompanying drawings or direct/indirect application in other related technical fields are included in the scope of the invention.
Sequence listing
<120> PD-1 single domain antibody, nucleotide sequence and kit
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
cgccatcaag gtaccagttg a 21
<210> 2
<211> 36
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
cgggatccca ggtacagctg gtggagtctg ggggag 36
<210> 3
<211> 36
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
ccgctcgagt acttcattcg ttcctgagga gacggt 36
<210> 4
<211> 28
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
ccgctcgagt gaggagacgg tgacctgg 28
<210> 5
<211> 36
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 5
cgggatccga ggtacagctg gtggagtctg ggggag 36
<210> 6
<211> 384
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 6
gatgtgcagc tgcaggcgtc tgggggagcg caggtgcagc ctgggggctc tctgagactc 60
tcctgtgcag cctctggacg cactttcagt agctatgcca tgggctggtt ccgccaggct 120
ccagggaagg agcgtgagtt tgtagcagct gttagtcgga gtggtcttaa gactggctat 180
gcagactccg tgaagggccg attcaccatc tccagagaca acgccaagaa cacggtgtat 240
ctgcaaatga acagcctgaa acctgaggac acggccgttt attactgcgc agcacgtgat 300
gagagagtct atagtgatat tgacttcttt cgtccgtttg attatggcta ctggggccag 360
gggacccagg tcaccgtctc ctca 384
<210> 7
<211> 128
<212> PRT
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 7
Asp Val Gln Leu Gln Ala Ser Gly Gly Ala Gln Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr
20 25 30
Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val
35 40 45
Ala Ala Val Ser Arg Ser Gly Leu Lys Thr Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Asp Glu Arg Val Tyr Ser Asp Ile Asp Phe Phe Arg Pro
100 105 110
Phe Asp Tyr Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser
115 120 125
Claims (4)
1. A PD-1 single domain antibody is characterized by comprising four framework regions and three complementarity determining regions CDR1, CDR2 and CDR3, wherein,
CDR1：Ser Tyr Ala Met Gly；
CDR2：Ala Val Ser Arg Ser Gly Leu Lys Thr Gly Tyr Ala Asp Ser Val Lys；
CDR3：Ala Arg Asp Glu Arg Val Tyr Ser Asp Ile Asp Phe Phe Arg Pro Phe Asp Tyr Gly；
the four framework regions are FR1, FR2, FR3 and FR4 respectively, wherein,
FR1：Asp Val Gln Leu Gln Ala Ser Gly Gly Ala Gln Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser；
FR2：Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ala；
FR3：Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala；
FR4：Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser。
2. a nucleic acid encoding the PD-1 single domain antibody of claim 1.
3. The nucleic acid of claim 2, wherein the nucleic acid sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGCGCAGGTGCAGCCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGACGCACTTTCAGTAGCTATGCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTAGCAGCTGTTAGTCGGAGTGGTCTTAAGACTGGCTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGCGCAGCACGTGATGAGAGAGTCTATAGTGATATTGACTTCTTTCGTCCGTTTGATTATGGCTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
4. a kit comprising the PD-1 single domain antibody of claim 1, or the nucleic acid of claim 2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910301975.0A CN110003336B (en) | 2019-04-12 | 2019-04-12 | PD-1 single domain antibody, nucleotide sequence and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910301975.0A CN110003336B (en) | 2019-04-12 | 2019-04-12 | PD-1 single domain antibody, nucleotide sequence and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110003336A CN110003336A (en) | 2019-07-12 |
| CN110003336B true CN110003336B (en) | 2023-05-12 |
Family
ID=67172146
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910301975.0A Active CN110003336B (en) | 2019-04-12 | 2019-04-12 | PD-1 single domain antibody, nucleotide sequence and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110003336B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504672B (en) * | 2018-03-30 | 2022-09-27 | 南京农业大学 | Ralstonia solanacearum N477 extracellular protein PHD and coding gene and application thereof |
| CN114222759B (en) * | 2019-09-06 | 2023-06-06 | 北京拓界生物医药科技有限公司 | anti-PD-1 single-domain antibody, derived protein and medical application thereof |
| CN114763384B (en) * | 2021-01-14 | 2023-03-17 | 立凌生物制药(苏州)有限公司 | PD-1-targeting single domain antibody and derivative and application thereof |
| CN113777295B (en) * | 2021-09-15 | 2024-03-19 | 江南大学 | High-sensitivity quantum dot probe for detecting tumor marker PD-L1, preparation method and application |
| CN116284386A (en) * | 2021-12-21 | 2023-06-23 | 博生吉医药科技(苏州)有限公司 | Development of novel PD1 single-domain antibody |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107474135A (en) * | 2017-02-17 | 2017-12-15 | 广西医科大学 | Anti- PD 1 nano antibody PD 1/Nb20 and preparation method and application |
| CN107686520A (en) * | 2016-08-04 | 2018-02-13 | 信达生物制药(苏州)有限公司 | Anti- PD L1 nano antibodies and its application |
| CN107814845A (en) * | 2016-09-14 | 2018-03-20 | 浙江特瑞思药业股份有限公司 | The new nano antibodies of anti-PD 1 and its application |
| WO2018127709A1 (en) * | 2017-01-06 | 2018-07-12 | Crescendo Biologics Limited | Single domain antibodies to programmed cell death (pd-1) |
| CN108285485A (en) * | 2018-01-08 | 2018-07-17 | 乌鲁木齐恒康致远生物技术有限公司 | The single domain antibody of anti-PD-1 a kind of and its application |
-
2019
- 2019-04-12 CN CN201910301975.0A patent/CN110003336B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107686520A (en) * | 2016-08-04 | 2018-02-13 | 信达生物制药(苏州)有限公司 | Anti- PD L1 nano antibodies and its application |
| CN107814845A (en) * | 2016-09-14 | 2018-03-20 | 浙江特瑞思药业股份有限公司 | The new nano antibodies of anti-PD 1 and its application |
| WO2018127709A1 (en) * | 2017-01-06 | 2018-07-12 | Crescendo Biologics Limited | Single domain antibodies to programmed cell death (pd-1) |
| CN107474135A (en) * | 2017-02-17 | 2017-12-15 | 广西医科大学 | Anti- PD 1 nano antibody PD 1/Nb20 and preparation method and application |
| CN108285485A (en) * | 2018-01-08 | 2018-07-17 | 乌鲁木齐恒康致远生物技术有限公司 | The single domain antibody of anti-PD-1 a kind of and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110003336A (en) | 2019-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110003336B (en) | PD-1 single domain antibody, nucleotide sequence and kit | |
| CN109970858B (en) | CD22 single domain antibody, nucleotide sequence and kit | |
| CN110003335B (en) | CD47 single domain antibody, nucleic acid and kit | |
| KR101732552B1 (en) | Screening and Engineering Method of Super-Stable Immunoglobulin Variable Domains and Their Uses | |
| Steiner et al. | Efficient selection of DARPins with sub-nanomolar affinities using SRP phage display | |
| CN110003333B (en) | Polypeptide, PD-L1 single domain antibody, nucleotide sequence and kit | |
| JP3344584B2 (en) | Recombinant library screening method | |
| CN111217908B (en) | CD22 single domain antibody, nucleotide sequence, kit, CAR-T viral vector and CAR-T cell | |
| CN111542343A (en) | Single domain antibody against BCMA and uses thereof | |
| JP2015531597A5 (en) | ||
| CN110003329B (en) | Polypeptide, IL17A/F single domain antibody, nucleotide sequence and kit | |
| CN110105450B (en) | VEGF single domain antibody, nucleotide sequence and kit | |
| CN110003337B (en) | IL17RA single domain antibody, nucleic acid and kit | |
| CN108017712B (en) | Protein skeleton derived from shark antibody and application thereof | |
| US20220228138A1 (en) | Method for preparing phage library | |
| CN110003334B (en) | Polypeptide, CD19 single domain antibody, preparation method thereof, nucleotide sequence and kit | |
| CN109942704B (en) | HSA single domain antibodies, nucleic acids and kits | |
| CN110981959B (en) | CD47 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN110804096A (en) | CD123 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN106905435B (en) | Method for preparing binding protein based on protein A mutant | |
| CN113912729B (en) | Single-domain antibody aiming at sST2, and derivative protein and application thereof | |
| CN110003330B (en) | TNF-alpha single domain antibody, nucleic acid molecule and kit | |
| CN114106167B (en) | Nanobody for specifically recognizing listeria monocytogenes, recombinant vector, host cell and application of nanobody | |
| CN112940122B (en) | Mouse single-chain antibody of targeting DNAM-1, recombinant plasmid for expressing mouse single-chain antibody, recombinant cell and application | |
| CN114369165B (en) | Bovine single-chain antibody of bovine-derived anti-staphylococcus aureus virulence factor GapC, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: Room 605, building 1, Shenzhen Biomedical Innovation Industrial Park, 14 Jinhui Road, Jinsha community, Kengzi street, Pingshan District, Shenzhen, Guangdong 518000 Applicant after: Shenzhen prijin biopharmaceutical Co.,Ltd. Address before: 518000 Building 402, Shenzhen Biomedical Innovation Industrial Park, No. 14 Jinhui Road, Kengzi Street, Pingshan District, Shenzhen City, Guangdong Province Applicant before: SHENZHEN PREGENE BIOPHARMA Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |