CN109942704A - HSA single domain antibody, nucleotide sequence and kit - Google Patents
HSA single domain antibody, nucleotide sequence and kit Download PDFInfo
- Publication number
- CN109942704A CN109942704A CN201910297997.4A CN201910297997A CN109942704A CN 109942704 A CN109942704 A CN 109942704A CN 201910297997 A CN201910297997 A CN 201910297997A CN 109942704 A CN109942704 A CN 109942704A
- Authority
- CN
- China
- Prior art keywords
- gly
- ser
- tyr
- asp
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The present invention discloses a kind of HSA single domain antibody, nucleotide sequence and kit, wherein the HSA single domain antibody be include four frame areas and three complementary determining regions CDR1, CDR2, CDR3, wherein CDR1:Asp Tyr Ile Ile Gly；CDR2:Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu Ser Val Lys；CDR3:Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp.Technical solution of the present invention obtains a kind of single domain antibody for specifically binding HSA albumen by the method for combining genetic engineering, and the activity of the antibody specificity combination HSA albumen is high, and expression quantity is high, at low cost, is easily transformed.
Description
Technical field
The present invention relates to gene engineering technology field, in particular to a kind of HSA single domain antibody, nucleotide sequence and reagent
Box.
Background technique
Seralbumin in human serum albumins (HSA) blood of human body, is the most abundant protein in human plasma, accounts for blood
Albuminised 55%.HSA is generated by liver, plays transhipment hormone, fatty acid and other hydrophobic compounds in vivo, buffering
PH maintains the multiple functions such as osmotic pressure.Human serum albumins marker can be used as the detection mode of a variety of diseases, such as detect
Albumin content in urine can be used as the important detection mode of nephrosis, be the one of sugared patient with urine disease cardiovascular disease complication
A risk indicator.Human serum albumins can be used the detection of a variety of methods and label, and immunohistochemical method be it is most sensitive and
Special one kind.Its principle is by conjunction with seralbumin, cannot be only used for such as urine using albumin specific antibody
The quantitative detection of middle albumin, it may also be used for the detection of albumin in other body fluid.
In the prior art, HAS antibody binding activity is low, and specificity is bad.
Summary of the invention
The main object of the present invention is to provide a kind of HSA single domain antibody, it is intended to it is low to solve existing HSA antibody binding activity
Problem.
To achieve the above object, the present invention proposes that a kind of HSA single domain antibody, the HSA single domain antibody include four frames
Region and three complementary determining regions CDR1, CDR2, CDR3, wherein
CDR1:Asp Tyr Ile Ile Gly；
CDR2:Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu Ser Val Lys；
CDR3:Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp.
In one embodiment, four framework regions are respectively FR1, FR2, FR3, FR4, wherein
FR1:Asp Val Gln Leu Gln Ala Ser Gly Gly Asp Leu Val Gln Ala Gly Gly
Ser Leu Arg Leu Ser Cys His Ala Ser Gly Leu Asp
FR2:Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Leu Ser
FR3:Gly Arg Phe Thr Ile Ser Ser Asp Asn Ala Lys Asn Thr Val Tyr Leu
Gln Met Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala
FR4:Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.
The present invention also provides a kind of nucleotide sequence, the nucleotide sequence coded HSA single domain antibody, the HSA single domain
Antibody includes four frame areas and three complementary determining regions CDR1, CDR2, CDR3, wherein
CDR1:Asp Tyr Ile Ile Gly；
CDR2:Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu Ser Val Lys；
CDR3:Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp.
In one embodiment, the nucleotide sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGCCA
CGCCTCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGAGGGCCTCTCATGT
ATTAGTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCCAGTGACAACGCCA
AGAACACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTGCAGCAGATCGATA
TCGGTCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
The present invention also provides a kind of kit, the kit includes HSA single domain antibody, or including such as nucleotides sequence
Column；The HSA single domain antibody includes four frame areas and three complementary determining regions CDR1, CDR2, CDR3, wherein CDR1:
Asp Tyr Ile Ile Gly；CDR2:Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu
Ser Val Lys；CDR3:Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr
Asp；The nucleotide sequence are as follows: GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGA
GACTCTCCTGCCACGCCTCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGA
GGGCCTCTCATGTATTAGTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCC
AGTGACAACGCCAAGAACACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTG
CAGCAGATCGATATCGGTCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCAC
CGTCTCCTCA。
Technical solution of the present invention is anti-by the single domain that the method for combining genetic engineering obtains a kind of specific binding HSA albumen
The activity of body, the antibody specificity combination HSA albumen is high, and expression quantity is high, at low cost, is easily transformed.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described.
Fig. 1 is first round PCR single domain antibody gene electrophoretogram of the invention；
Fig. 2 is the second wheel PCR single domain antibody gene electrophoretogram in Fig. 1 in band 1 within the scope of 750bp-500bp；
Fig. 3 is protein expression and purification figure；
Fig. 4 is HSA single domain antibody of the present invention and HSA antigen-binding activity figure.
The embodiments will be further described with reference to the accompanying drawings for the realization, the function and the advantages of the object of the present invention.
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete
Site preparation description, it is clear that described embodiment is only a part of the embodiments of the present invention, instead of all the embodiments.Base
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts it is all its
His embodiment, shall fall within the protection scope of the present invention.
The present invention proposes a kind of HSA single domain antibody, nucleotide sequence and kit in fact.Following the description will be for described
HSA single domain antibody and its screening process describe in detail.
Firstly, there are three framework region and two variable regions for HSA single domain antibody tool of the invention.Wherein, three complementary decisions
Region sequence is as follows:
CDR1:Ser Tyr Thr Met Gly；
CDR2:Gly Ile Ser Pro Ser Gly Ala Tyr Thr Ser Tyr Ala Asp Ser Val Lys；
CDR3:Ala Asp Arg Tyr Gly Leu Leu His Thr Ala Glu Asp Val Tyr Pro.
Certainly, the framework sequence of HSA single domain antibody can there are many.In following the description with following four framework regions be tool
Body embodiment is described in detail.
FR1:Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
FR2:Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Thr；
FR3:Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Phe Val
Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Glu；
FR4:Cys Trp Gly Gly Gly Thr Gln Val Ala Val Ser Ser.
For the HSA single domain antibody, building mode of the present invention be divided into the building of antibody library, the screening of specific bacteriophage,
The screening of specific positive monoclonal, HSA single domain antibody are expressed in host e. coli, are purified.Following the description will be for every
One step is described in detail.
One, the building of antibody library
HSA antigen: producer, Divine Land Yi Qiao, Beijing, article No. 11958-H08H1.
It is mixed using the above-mentioned antigen of 2mg with isometric freund adjuvant.The alpaca for selecting adult healthy, injects the antigen, divides 7
It is secondary immune, after the 3rd time is immune, alpaca serum is taken, by chemiluminescent method, measures antigen immunizing potency.
a0: separation lymphocyte.When immunizing potency reaches 10,000 times or more, whole blood 150ml is adopted, uses QIAGEN reagent
Box (QIAamp RNA Blood Mini Kit (50), article No., 52304) is by separation of lymphocytes.
b0: cracking.By the lymphocytolysis after separation, the library CDNA is obtained, uses QIAGEN kit (QIAamp
RNA Blood Mini Kit (50), article No., 52304), measurement obtains CDNA concentration.
c0: nested PCR amplification.With cDNA synthetic agent box (MiniBESTAgarose Gel DNAExtraction Kit
Ver.4.0, TAKARA company), using nested PCR method, carry out two-wheeled PCR amplification antibody heavy chain variable region VHH genetic fragment；
First round PCR amplification can obtain the common antibody gene segments greater than 800bp, be between 800bp~500bp
The heavy chain antibody genes segment of light chain and the antibody heavy chain variable region segment VHH. of 500bp are lacked by electrophoresis, is filtered out
The genetic fragment of 800bp~500bp and the genetic fragment of 500bp；
d0: gel extraction, by the genetic fragment gel extraction of 800bp~500bp in step c0.Referring specifically to Fig. 1,1
Number band is common antibody dna and heavy chain antibody DNA, it can be seen that two bright bands therein have (the common antibody greater than 800bp
DNA), also there is (the heavy chain antibody DNA) between 500bp~750bp, the band that 750bp~500bp is located in the figure is cut into glue
Recycling；No. 2 bands are antibody heavy chain variable region segment VHH, and size is in 500bp；No. 2 band purpose bands are also recycled.
e0: the amplification of VHH target gene.Using the genetic fragment of the entire heavy chain antibody of recycling and its heavy chain variable region as mould
Plate obtains VHH target gene (500bp) with VHH specific primer through the second wheel PCR amplification.Referring to Fig. 2, it can be seen that one
Bright band, VHH target gene is about 500bp, that is, mixes that there are many VHH target gene of 500bp or so in the bright band.
Above-mentioned first round PCR primer includes SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.
Wherein SEQ ID NO:1 and SEQ ID NO:2 pairing uses, and amplification obtains two bands shown in 1 in Fig. 1；
SEQ ID NO:2 and SEQ ID NO:3 pairing uses, and amplification obtains a band shown in 2 in Fig. 1.
Second wheel PCR primer includes SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence.SEQ ID NO:4 and SEQ
ID NO:5 pairing uses, and obtains 500bp target gene shown in Fig. 2.
| Gene order title | Primer sequence |
| SEQ ID NO:1 | CGCCATCAAGGTACCAGTTGA |
| SEQ ID NO:2 | CGGGATCCCAGGTACAGCTGGTGGAGTCTGGGGGAG |
| SEQ ID NO:3 | CCGCTCGAGTACTTCATTCGTTCCTGAGGAGACGGT |
| SEQ ID NO:4 | CCGCTCGAGTGAGGAGACGGTGACCT GG |
| SEQ ID NO:5 | CGGGATCCGAGGTACAGCTGGTGGAGTCTGGGGGAG |
f0: it is transferred to TG1 competent cell.VHH segment obtained above is connected to pHEN6 Vector for Phage Display plasmid
(passing through BamHI, XhoI double digestion) later connects VHH segment and pHEN6 carrier (ZL20111028003.1) linked enzyme,
Electrotransformation is into TG1 competent cell, then by competent cell spread plate, verifies VHH gene insertion rate through bacterium colony PCR.
After verifying VHH gene is inserted into successfully, cloning efficiency detection is carried out to recombination: electrotransformation bacterium solution being taken to be coated with
It on LB/Amp plate, 32 DEG C, is incubated overnight, the joint efficiency of the method validation antibody of secondary daily bacterium colony PCR.
Wherein, the method for bacterium colony PCR is as follows: 1, first in resistance with autoclaved toothpick or pipette tips picking single bacterium colony
Monoclonal is put on plate and saves (label), is subsequently placed in 20ul Triton-x100 (or deionized water) and is mixed.2, it will be equipped with
The EP pipe of 20ul Tritonx-100 boils 2 minutes at 100 DEG C.3, taking 1ul supernatant is template, and PCR system is added and carries out PCR
Reaction, PCR system can be 20ul.4, agarose gel electrophoresis observes result.
When the joint efficiency of phage antibody library is lower than 90%, illustrate to need to repeat above-mentioned tested in operation error
Journey；When the efficiency of phage antibody library reaches 90%, next step operation is carried out.
g0: expand culture, preservation.Electrotransformation bacterium solution is coated on LB/Amp plate, 32 DEG C, overnight culture is trained with 2YT
Feeding base is washed down, is expanded culture under 2YT culture medium with 1:1000 ratio, and helper phage M13K07 is added
(Invitrogen) it is infected, is incubated overnight, is centrifuged, 20%PEG-2.5M NaCl mixing (bacteriophage is added after collecting supernatant
In supernatant), be collected by centrifugation precipitating, PBS be added and glycerol is resuspended, and be preserved in -80 DEG C it is spare.
Two, the screening of specific bacteriophage
There are many VHH segments come out due to process nested PCR amplification, and in these segments, not all these genes
Segment is all target fragment, after these segments VHH segment is transferred to bacteriophage, needs to be enriched with target phage, following
The step of content is enrichment target phage:
a1: with of CPBS solution.A small amount of nonfat milk is added in PBS solution, wherein the accounting of nonfat milk exists
1%-5% (plays sealing process)；The HSA albumen being dissolved in CPBS solution is diluted to 150 μ g/ml；
b1: after HSA diluted protein solution, 150 holes μ l/ are coated with；
c1: it stands, and abandons coating buffer, 300 hole μ l/ confining liquid (1%CPBS), 37 DEG C of closing 2h are added；
d1: the bacteriophage screened is added in micropore, and confining liquid is added and mixes to every 150 μ l of pore volume；
e1: incubation at room temperature 2h (secretory antibody, antibody and HSA protein binding on the shell of bacteriophage)；
f1: sieve pore is respectively washed 10 times with PBST (containing 0.05%Tween20), PBS respectively, and each 2min will be not bound with
Bacteriophage wash off；
g1: TEA wash-out bacteriophage into sieve pore is added, pressure-vaccum is suspended uniformly, is stored at room temperature 10min；
h1: pressure-vaccum is added in the 1M Tris-HCl of pre-cooling after being suspended uniformly and mixes again, carries out the measurement of titre；
i1: it expands and purifies the bacteriophage after amplification.
Above-mentioned steps a1To step i1, three-wheel is repeated, and with step i1Bacteriophage as next round step d1In addition
(bacteriophage of the first round is spare from above-mentioned -80 DEG C of preservations, and it is 10 μ g/ that three-wheel, which screens peridium concentration, for the bacteriophage of micropore
Ml, each hole 150 μ l/ are coated with).
The selection result is detailed in following table
| Screen number | Phage antibody library total amount is added | Eluent+Tris-HCl |
| The first round | 5.60E+11 | 300ulTEA+200ulTris |
| Second wheel | 5.00E+11 | 150ul*5TEA+350ulTris |
| Third round | 5.00E+11 | 150ul*5TEA+350ulTris |
Above-mentioned steps a1To step i1To be coated with HSA antigen as target, using solid-phase screening method from total phage antibody library
3 wheel screenings are carried out, are screened by three-wheel, the phage titre eluted increases, that is to say, that HSA specific bacteriophage obtains
Efficiently concentrating.
Three, the screening of specific positive monoclonal
Although efficiently concentrating has been obtained in above-mentioned bacteriophage, appoints and so remains a small amount of nonspecific bacteriophage,
In the following, specific HSA single domain antibody gene will be further screened.Specific step is as follows:
a2: by SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence, above-mentioned enriched HSA specificity is bitten
Thallus carries out PCR amplification, and the specific HSA single domain antibody gene of acquisition is (with the site restriction enzyme BbsI and BamHI
PCR product)；
b2: PCR product and pSJF2 carrier are handled respectively with restriction enzyme BbsI and BamHI
(ZL201110280031), it connects and recombinates through T4 ligase, and obtaining can be in the plasmid sdAb- of E. coli
pSJF2；
c2: then the multiple single colonies of random picking from the agar plate of growth bacterium colony are seeded in the 2YT liquid containing Amp
In 96 hole depth well culture plates of body culture medium；
d2: after culture 4 hours, monoclonal is corresponded to be seeded in and is consolidated with the LB containing Amp separated with small lattice numbered
On body plate；
e2: IPTG to final concentration 0.5mM induction is added to deep hole culture plate；
f2: after overnight incubation, the bacterium supernatant of harvest expression albumen；
g2: ELISA measurement is carried out with HSA antigen, selects Anti-HSA positive colony ELISA measurement result；
h2: the HSA positive colony picked out identifies the gene order SEQ of anti-HSA single domain antibody clone through DNA sequencing
ID NO:6 (or SEQ ID NO:7 complementary with SEQ ID NO:6).
SEQ ID NO:6 sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGCCA
CGCCTCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGAGGGCCTCTCATGT
ATTAGTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCCAGTGACAACGCCA
AGAACACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTGCAGCAGATCGATA
TCGGTCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
Four, HSA single domain antibody is expressed in host e. coli, is purified
After obtaining above-mentioned positive monoclonal, HSA single domain antibody can be obtained by needing to be expressed, subsequent mainly by big
Enterobacteria expression, then purifies, required HSA single domain antibody can be obtained.Specific operation process is as follows:
a3: the above-mentioned strain containing plasmid HSA is seeded on the LB culture plate containing aminobenzylpenicillin, 37 DEG C are overnight.
Here, itself penicillin toranto has resistance due to pSJF2 carrier, thus, in the LB culture plate containing aminobenzylpenicillin
On, the Escherichia coli only containing pSJF2 carrier can grow, and avoid the interference of other miscellaneous bacterias；
b3: it selects single bacterium colony and is inoculated in the LB culture solution containing aminobenzylpenicillin of 5ml, 37 DEG C, shaking table culture mistake
Night；
c3: transferred species 2ml overnight culture is in LB culture solution of the 200mL containing aminobenzylpenicillin；
d3: 240 revs/min, when culture to OD value is up to 0.4~0.6,0.5~1.0mM IPTG is added in 37 DEG C of shaking table cultures,
Continue overnight incubation, be then centrifuged for, receives bacterium.
e3: hypertonic method cracks bacterium, and soluble single domain antibody albumen in supernatant is received in centrifugation；
f3: purity is obtained up to 95% or more albumen through Ni+ ion affinity chromatography.
Specifically referring to figure 3., in Fig. 3, M is protein molecular standard, and band 1 is that total protein slightly gets sample product after broken bacterium.
Band 2 is that total protein slightly mentioned the sample after nickel column, illustrates that only a small amount of sample is eluted, in Ni+ column
A large amount of sample albumen is there remains.
Band 3 is illustrate by further eluting with the remaining sample after stripping nickel removal column containing 40 mmoles imidazoles
Afterwards, most of albumen is all eluted.
Band 4 is remaining sample after crossing nickel removal column with the eluent containing 100 mmoles imidazoles, illustrates do not have in Ni+ column
The albumen being eluted is few.
Band 5 is remaining sample after crossing nickel column with the eluent containing 400 mmoles imidazoles, can be seen by this band
Out, the albumen almost all of Ni+ column is eluted, and the target protein eluted is purer.
Five, single domain antibody and HSA antigen-binding activity measure
Target antibody is screened and is purified by the above process, in order to verify the activity of target antibody, experimental procedure
It is as follows:
a4: HSA antigen is diluted to 2 μ g/ml, 100 holes μ l/, antigen packet with 0.05M Na2CO3NaHCO3 (pH 9.5)
By 96 orifice plates, 4 DEG C of overnight incubations；
b4: three times with PBS board-washing, 300 μ l 2%BSA (or 1%CPBS) close 96 orifice plates, 37 DEG C, are incubated for 2 hours；
c4: the HSA single domain antibody of the purifying of different diluted concentrations is added, is added by 100 holes μ l/, 37 DEG C, is incubated for 1 hour；
d4: three times with 0.05%PBST board-washing；
e4: add 5000 times of diluted antiMyctag antibody (HRP), be added by 100 holes μ l/, 37 DEG C, it is small to be incubated for 1
When；
f4: three times with 0.05%PBST board-washing, adds the hole TMB100 μ l/, be protected from light and be stored at room temperature 10 minutes.G4: 2M is added
50 hole μ l/ H2SO4 terminates reaction；
g4: the sample OD value under 450nm wavelength is measured with microplate reader.
From fig. 4, it can be seen that even if the concentration after HSA single domain antibody and HSA antigen binding is in 0.08 μ g/ml, still
It can detecte higher activity.
In addition, carry out concentration mensuration to the albumen that obtains after purification using spectrophotometer, measure through expression, extraction, pure
Tot Prot is 4.05mg after change.Because expression system used in embodiment is 200ml, therefore, the HSA constructed in the present embodiment is mono-
Domain antibodies prokaryotic expression system unit expression quantity is 2.02mg/100ml bacterium solution
The expression quantity finally obtained by analytical calculation can prove expression system used in embodiment to the table of albumen
Up to efficiency, i.e. albumen quality obtained by unit expression volume.Under normal conditions, expression quantity reaches 0.5mg/100ml, that is, thinks
Higher expression is embodied, the expression quantity of this HSA single domain antibody has reached 2.02mg/100ml, is existing higher row
Four times of industry level.
Finally, due to HSA single domain antibody is a kind of nano antibody, and molecular weight is small, and manufacturing cost is low in the present invention,
It is transformed conducive to subsequent.
The above description is only a preferred embodiment of the present invention, is not intended to limit the scope of the invention, all at this
Under the inventive concept of invention, using equivalent structure transformation made by description of the invention and accompanying drawing content, or directly/use indirectly
It is included in other related technical areas in scope of patent protection of the invention.
SEQUENCE LISTING
<110>Shenzhen Puri gold Bioceuticals Inc.
<120>HSA single domain antibody, nucleotide sequence and kit
<130> 123
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 321
<212> PRT
<213>artificial sequence
<400> 1
Ala Ser Pro Val Ala Leu Gly Leu Asn Gly Leu Asn Ala Leu Ala Ser
1 5 10 15
Glu Arg Gly Leu Tyr Gly Leu Tyr Ala Ser Pro Val Ala Leu Gly Leu
20 25 30
Asn Ala Leu Ala Gly Leu Tyr Gly Leu Tyr Ser Glu Arg Ala Arg Gly
35 40 45
Ser Glu Arg Cys Tyr Ser His Ile Ser Ala Leu Ala Ser Glu Arg Gly
50 55 60
Leu Tyr Ala Ser Pro Ala Ser Pro Thr Tyr Arg Ile Leu Glu Ile Leu
65 70 75 80
Glu Gly Leu Tyr Thr Arg Pro Pro His Glu Ala Arg Gly Gly Leu Asn
85 90 95
Ala Leu Ala Gly Leu Tyr Leu Tyr Ser Ala Arg Gly Gly Leu Tyr Ser
100 105 110
Glu Arg Cys Tyr Ser Ile Leu Glu Ser Glu Arg Ala Arg Gly Ser Glu
115 120 125
Arg Ala Ser Pro Gly Leu Tyr Ala Ser Asn Thr His Arg Thr Tyr Arg
130 135 140
Thr Tyr Arg Ala Leu Ala Ser Glu Arg Val Ala Leu Leu Tyr Ser Gly
145 150 155 160
Leu Tyr Ala Arg Gly Pro His Glu Thr His Arg Ile Leu Glu Ser Glu
165 170 175
Arg Ser Glu Arg Ala Ser Pro Ala Ser Asn Ala Leu Ala Leu Tyr Ser
180 185 190
Ala Ser Asn Thr His Arg Val Ala Leu Thr Tyr Arg Gly Leu Asn Met
195 200 205
Glu Thr Ala Ser Pro Ser Glu Arg Leu Tyr Ser Ala Ser Pro Thr His
210 215 220
Arg Ala Leu Ala Val Ala Leu Thr Tyr Arg Thr Tyr Arg Cys Tyr Ser
225 230 235 240
Ala Leu Ala Ala Leu Ala Ala Ser Pro Ala Arg Gly Thr Tyr Arg Ala
245 250 255
Arg Gly Ser Glu Arg Gly Leu Tyr Pro His Glu Gly Leu Tyr Ala Ser
260 265 270
Asn Gly Leu Tyr Thr Tyr Arg Thr Tyr Arg Ala Ser Pro Thr Tyr Arg
275 280 285
Thr Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His Arg Gly
290 295 300
Leu Asn Val Ala Leu Thr His Arg Val Ala Leu Ser Glu Arg Ser Glu
305 310 315 320
Arg
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
cgccatcaag gtaccagttg a 21
<210> 3
<211> 29
<212> DNA
<213>artificial sequence
<400> 3
cgggatccca ggtacagctg gtggagtctg ggggag 36
<210> 4
<211> 43
<212> DNA
<213>artificial sequence
<400> 4
ccgctcgagt acttcattcg ttcctgagga gacggt 36
<210> 5
<211> 41
<212> DNA
<213>artificial sequence
<400> 5
ccgctcgagt gaggagacgg tgacctgg 28
<210> 6
<211> 47
<212> DNA
<213>artificial sequence
<400> 6
cgggatccga ggtacagctg gtggagtctg ggggag 36
<210> 7
<211> 369
<212> DNA
<213>artificial sequence
<400> 7
gatgtgcagc tgcaggcgtc tgggggagac ctggtgcagg ctggagggtc tctgagactc 60
tcctgccacg cctctggttt ggatgattat atcattggct ggttccgcca ggccccaggg 120
aaggagcgcg agggcctctc atgtattagt agaagtgatg gtaacacata ctatgcagag 180
tccgtgaagg gccgattcac catttccagt gacaacgcca agaacacggt gtatctgcaa 240
atggacagcc tgaaacctga ggacacggct gtttattact gtgcagcaga tcgatatcgg 300
tcgggatttt tggggaatgg atatgagtat gactactggg gccaggggac ccaggtcacc 360
gtctcctca 369
Claims (5)
1. a kind of HSA single domain antibody, which is characterized in that including four frame areas and three complementary determining region CDR1, CDR2,
CDR3, wherein
CDR1:Asp Tyr Ile Ile Gly；
CDR2:Cys Ile Ser Arg Ser Asp Gly Asn Thr Tyr Tyr Ala Glu Ser Val Lys；
CDR3:Ala Asp Arg Tyr Arg Ser Gly Phe Leu Gly Asn Gly Tyr Glu Tyr Asp.
2. HSA single domain antibody as described in claim 1, which is characterized in that four framework regions be respectively FR1, FR2,
FR3, FR4, wherein
FR1:Asp Val Gln Leu Gln Ala Ser Gly Gly Asp Leu Val Gln Ala Gly Gly Ser
Leu Arg Leu Ser Cys His Ala Ser Gly Leu Asp
FR2:Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Leu Ser
FR3:Gly Arg Phe Thr Ile Ser Ser Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln
Met Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala
FR4:Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.
3. a kind of nucleotide sequence, which is characterized in that the nucleotide sequence coded HSA as claimed in claim 1 or 2
Single domain antibody.
4. nucleotide sequence as claimed in claim 3, which is characterized in that the nucleotide sequence is as follows:
GATGTGCAGCTGCAGGCGTCTGGGGGAGACCTGGTGCAGGCTGGAGGGTCTCTGAGACTCTCCTGCCACGCC
TCTGGTTTGGATGATTATATCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGAGGGCCTCTCATGTATTA
GTAGAAGTGATGGTAACACATACTATGCAGAGTCCGTGAAGGGCCGATTCACCATTTCCAGTGACAACGCCAAGAA
CACGGTGTATCTGCAAATGGACAGCCTGAAACCTGAGGACACGGCTGTTTATTACTGTGCAGCAGATCGATATCGG
TCGGGATTTTTGGGGAATGGATATGAGTATGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
5. a kind of kit, which is characterized in that including HSA single domain antibody as claimed in claim 1 or 2, or including such as weighing
Benefit require 3 or 4 described in nucleotide sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910297997.4A CN109942704B (en) | 2019-04-12 | 2019-04-12 | HSA single domain antibodies, nucleic acids and kits |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910297997.4A CN109942704B (en) | 2019-04-12 | 2019-04-12 | HSA single domain antibodies, nucleic acids and kits |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109942704A true CN109942704A (en) | 2019-06-28 |
| CN109942704B CN109942704B (en) | 2023-01-20 |
Family
ID=67015090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910297997.4A Active CN109942704B (en) | 2019-04-12 | 2019-04-12 | HSA single domain antibodies, nucleic acids and kits |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109942704B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111234015A (en) * | 2020-02-12 | 2020-06-05 | 康维众和(中山)生物药业有限公司 | Antibody for prolonging half life of medicine, fusion protein and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080267949A1 (en) * | 2006-12-05 | 2008-10-30 | Ablynx N.V. | Peptides capable of binding to serum proteins |
| CN107674122A (en) * | 2016-12-28 | 2018-02-09 | 天津天锐生物科技有限公司 | A kind of single domain antibody for identifying human serum albumins |
| GB201818460D0 (en) * | 2018-11-13 | 2018-12-26 | Crescendo Biologics Ltd | Single domain antibodies that bind human serum albumin |
-
2019
- 2019-04-12 CN CN201910297997.4A patent/CN109942704B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080267949A1 (en) * | 2006-12-05 | 2008-10-30 | Ablynx N.V. | Peptides capable of binding to serum proteins |
| CN107674122A (en) * | 2016-12-28 | 2018-02-09 | 天津天锐生物科技有限公司 | A kind of single domain antibody for identifying human serum albumins |
| GB201818460D0 (en) * | 2018-11-13 | 2018-12-26 | Crescendo Biologics Ltd | Single domain antibodies that bind human serum albumin |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111234015A (en) * | 2020-02-12 | 2020-06-05 | 康维众和(中山)生物药业有限公司 | Antibody for prolonging half life of medicine, fusion protein and application thereof |
| CN111234015B (en) * | 2020-02-12 | 2021-04-06 | 康维众和(中山)生物药业有限公司 | Antibody for prolonging half life of medicine, fusion protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109942704B (en) | 2023-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109970858A (en) | CD22 single domain antibody, nucleotide sequence and kit | |
| CN110003335A (en) | VHH chain of CD47 single domain antibody, CD47 single domain antibody, nucleotide sequence and kit | |
| CN110003333A (en) | Polypeptide, PD-L1 single-domain antibody, nucleotide sequence and kit | |
| US9435776B2 (en) | Immunosorbent and immunoaffinity column for aflatoxin M1 nanobody and preparation method thereof | |
| DK3124973T3 (en) | AFLATOXIN-NANOBODY IMMUNO ABSORBENT AND IMMUNO-EFFICIENCY COLUMN AND PREPARATION AND METHOD OF USING IT | |
| CN110003336A (en) | PD-1 single domain antibody, nucleotide sequence and kit | |
| CN111560070B (en) | Antibody aiming at novel coronavirus NP protein and detection application thereof | |
| CN110003329A (en) | Polypeptide, IL17A/F single domain antibody, nucleotide sequence and kit | |
| CN108794632B (en) | Nano antibody for broad-spectrum specificity recognition of diethoxy organophosphorus pesticide and enzyme-linked immunoassay method | |
| CN110105450A (en) | VEGF single domain antibody, nucleotide sequence and kit | |
| CN110003337A (en) | IL17RA single domain antibody, nucleotide sequence and kit | |
| CN114276445B (en) | Rotavirus recombinant protein specific antibody, plasmid vector and method | |
| CN109942704A (en) | HSA single domain antibody, nucleotide sequence and kit | |
| CN116925218B (en) | Antibody of small heat shock protein HSPB1, antibody composition, hybridoma cell strain and application thereof | |
| Kang et al. | Yeast surface display for protein engineering: library generation, screening, and affinity maturation | |
| CN109970855A (en) | VHH chain of IL23 single domain antibody, IL23 single domain antibody, nucleotide sequence and kit | |
| US11946055B2 (en) | Protein engineering via error-prone orthogonal replication and yeast surface display | |
| CN110003334A (en) | Polypeptide, CD19 single-domain antibody, preparation method thereof, nucleotide sequence and kit | |
| CN110003330A (en) | TNF-α single domain antibody, nucleotide sequence and kit | |
| CN113583119A (en) | Anti-staphylococcus aureus nanobody Nb56, application and kit | |
| CN110804096A (en) | CD123 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN113150122A (en) | Preparation method of high-throughput whole rabbit-derived monoclonal antibody | |
| CN113683684B (en) | Anti-hepatitis B virus surface antigen antibody, antibody pair, detection reagent containing same and kit | |
| CN114057881B (en) | Anti-ketamine specific antibodies, plasmid vectors and methods | |
| CN116987194B (en) | Anti-idiotype nano antibody of mimic epitope peptide of human ST2 antigen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: Room 605, building 1, Shenzhen Biomedical Innovation Industrial Park, 14 Jinhui Road, Jinsha community, Kengzi street, Pingshan District, Shenzhen, Guangdong 518000 Applicant after: Shenzhen prijin biopharmaceutical Co.,Ltd. Address before: 518000 Building 402, Shenzhen Biomedical Innovation Industrial Park, No. 14 Jinhui Road, Kengzi Street, Pingshan District, Shenzhen City, Guangdong Province Applicant before: SHENZHEN PREGENE BIOPHARMA Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |