CN110003330A

CN110003330A - TNF-α single domain antibody, nucleotide sequence and kit

Info

Publication number: CN110003330A
Application number: CN201910301957.2A
Authority: CN
Inventors: 李胜华; 包朝乐萌; 李莹莹; 许莎莎; 余祥
Original assignee: Shenzhen Purim Biopharmaceutical Co Ltd
Current assignee: Shenzhen Purim Biopharmaceutical Co Ltd
Priority date: 2019-04-12
Filing date: 2019-04-12
Publication date: 2019-07-12
Anticipated expiration: 2039-04-12
Also published as: CN110003330B

Abstract

The present invention discloses a kind of TNF-α single domain antibody, nucleotide sequence and kit, wherein the TNF-α single domain antibody includes four frame areas FR1, FR2, R3, FR4 and three Variable Areas CDR1, CDR2, CDR3.Technical solution of the present invention is logical to obtain a kind of single domain antibody for specifically binding TNF-α albumen, and the activity of the antibody specificity combination TNF-α albumen is high, and expression quantity is high, at low cost, is easily transformed.

Description

TNF-α single domain antibody, nucleotide sequence and kit

Technical field

The present invention relates to gene engineering technology field, in particular to a kind of TNF-α single domain antibody, nucleotide sequence and reagent Box.

Background technique

Tumor necrosis factor (TNF) can be can produce and be secreted by various kinds of cell, can be divided into according to the difference in source TNF-α and TNF-beta two types, two kinds of hypotypes all have in terms of serology feature, molecular biological characteristics and biological effect Consistency.Wherein, secreted after TNF-α is mainly excited by macrophage, and TNF β is then generated by T lymphocyte, people is intracorporal TNF is mainly based on TNF-α.TNF-α belongs to II type memebrane protein, it passes through the tumor necrosis factorα receptor with cell membrane surface It combines to realize its biological function, in a variety of lifes such as inflammatory reaction, cellular immunity, tumour immunity, hypoxemia and dyslipidemia Very crucial effect is played in reason and pathologic process.

Numerous studies discovery, serum, synovial membrane and synovia of the TNF-a in autoimmune disorders such as rheumatoid arthritis It is significantly increased in equal tissues, it might even be possible to promote the factors such as body release IL-1, IL-8 and TNF, aggravate the damage to tissue.It is logical It crosses using TNF-a antagonist, such as TNF-a monoclonal antibody, can effectively inhibit internal TNF-a activity, alleviate because of immune system Disease and symptom caused by exception.

However in the prior art, TNF-α antibody binding activity is lower, and when manufacturing, expression quantity is also relatively low.

Summary of the invention

The main object of the present invention is to provide a kind of polypeptide sequence, it is intended to solve the problems, such as that existing TNF-α antibody activity is low.

To achieve the above object, the present invention proposes a kind of TNF-α single domain antibody, including four frame area FR1, FR2, R3, FR4 and three Variable Areas CDR1, CDR2, CDR3, wherein

FR1:Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Ala Asn；

CDR1:Ile Tyr Ala Met Gly；

FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Asp Arg Glu Leu Val Ala；

CDR2:Asp Ile Ser Arg Ala Asn Arg Thr Leu Tyr Ala Asp Ser Val Lys；

FR3:Gly Arg Phe Thr Ile Ser Arg Thr Asn Asp Trp Arg Thr Val Tyr Leu Gln Met Asn Met Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn；

CDR3:Thr Arg Asn；

FR4:Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.

The present invention also provides a kind of nucleotide sequence, the nucleotide sequence coded TNF-α single domain antibody, the TNF-α Single domain antibody includes four frame areas FR1, FR2, R3, FR4 and three Variable Areas CDR1, CDR2, CDR3, wherein

CDR1:Ile Tyr Ala Met Gly；

FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Asp Arg Glu Leu Val Ala；

CDR2:Asp Ile Ser Arg Ala Asn Arg Thr Leu Tyr Ala Asp Ser Val Lys；

CDR3:Thr Arg Asn；

FR4:Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.

In one embodiment, the nucleotide sequence is as follows:

CAGGTACAGCTGGTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCTCTGAGACTCTCGTGTGC AGCCTCTGGGAGCATCGCCAATATCTATGCCATGGGCTGGTACCGCCAGGCTCCAGGGAACGATCGCGAGTTGGTC GCAGATATTAGTCGTGCTAATCGGACACTCTATGCAGACTCCGTAAAGGGCCGATTCACCATCTCCAGAACCAACG ACTGGAGGACGGTGTATCTGCAAATGAACATGCTGAAACCTGAGGACACGGCCGTCTATTACTGTAATACTAGAAA CGACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

The present invention also provides a kind of kit, the kit includes TNF-α single domain antibody or nucleotide sequence；Institute Stating TNF-α single domain antibody described in single domain antibody includes four frame areas FR1, FR2, R3, FR4 and three Variable Areas CDR1, CDR2, CDR3, wherein

CDR1:Ile Tyr Ala Met Gly；

FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Asp Arg Glu Leu Val Ala；

CDR2:Asp Ile Ser Arg Ala Asn Arg Thr Leu Tyr Ala Asp Ser Val Lys；

CDR3:Thr Arg Asn；

FR4:Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser；The nucleotide sequence is such as Under:

Technical solution of the present invention obtains a kind of single domain for specifically binding TNF-α albumen by the method for combining genetic engineering The activity of antibody, the antibody specificity combination TNF-α albumen is high, and expression quantity is high, at low cost, is easily transformed.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.

Fig. 1 is first round PCR single domain antibody gene electrophoretogram of the invention；

Fig. 2 is second that the gene in Fig. 1 in band 1 within the scope of 750bp-500bp in gene and band 2 carries out Take turns the gene electrophoretogram of PCR amplification；

Fig. 3 is protein expression and purification figure；

Fig. 4 is TNF-α single domain antibody of the present invention and TNF-α antigen-binding activity figure.

Fig. 5 is TNF-α single domain antibody affinity detection process figure of the present invention；

Fig. 6 is TNF-α single domain antibody affinity detection process of the present invention and linear fit comparison diagram.

The embodiments will be further described with reference to the accompanying drawings for the realization, the function and the advantages of the object of the present invention.

Specific embodiment

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiment is only a part of the embodiments of the present invention, instead of all the embodiments.Base Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts it is all its His embodiment, shall fall within the protection scope of the present invention.

The present invention proposes a kind of TNF-α single domain antibody, nucleotide sequence and kit in fact.Following the description will be for described Polypeptide and its screening process describe in detail.

Firstly, there are three framework region and two variable regions for polypeptide tool of the invention:

CDR1:Ile Tyr Ala Met Gly；

FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Asp Arg Glu Leu Val Ala；

CDR2:Asp Ile Ser Arg Ala Asn Arg Thr Leu Tyr Ala Asp Ser Val Lys；

CDR3:Thr Arg Asn；

FR4:Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.

For the TNF-α single domain antibody, building mode of the present invention is divided into the sieve of the building of antibody library, specific bacteriophage Choosing, the screening of specific positive monoclonal, TNF-α single domain antibody are expressed in host e. coli, are purified.Following the description is by needle Each step is described in detail.

One, the building of antibody library

It is mixed using 0.6mgTNF- α antigen with isometric freund adjuvant.The alpaca for selecting adult healthy, injects the antigen, Divide 6 times and be immunized, after the 4th is immune, take alpaca serum, pass through chemiluminescent method, measures antigen immunizing potency.

a₀: separation lymphocyte.When immunizing potency reaches 10,000 times or more, whole blood 100ml is adopted, uses QIAGEN reagent Box (QIAamp RNA Blood Mini Kit (50), article No., 52304) is by separation of lymphocytes.

b₀: cracking.By the lymphocytolysis after separation, RNA purifying is then carried out, QIAGEN kit is used (QIAamp RNA Blood Mini Kit (50), article No., 52304), measurement obtain RNA concentration.

c₀: nested PCR amplification.With cDNA synthetic agent box (MiniBESTAgarose Gel DNAExtraction Kit Ver.4.0, TAKARA company), using nested PCR method, carry out two-wheeled PCR amplification antibody heavy chain variable region VHH genetic fragment；

First round PCR amplification can obtain the common antibody gene segments greater than 800bp, be between 800bp~500bp The heavy chain antibody genes segment of light chain and the antibody heavy chain variable region segment VHH. of 500bp are lacked by electrophoresis, is filtered out The genetic fragment of 800bp~500bp and the genetic fragment of 500bp.

d₀: gel extraction, by the genetic fragment gel extraction of 800bp~500bp in step c0.Referring specifically to Fig. 1,1 Number band is common antibody dna and heavy chain antibody DNA, it can be seen that two bright bands therein have (the common antibody greater than 800bp DNA), also there is (the heavy chain antibody DNA) between 500bp~750bp, the band that 750bp~500bp is located in the figure is cut into glue Recycling；No. 2 and No. 3 bands are antibody heavy chain variable region segment VHH, and size is in 500bp；No. 2 and No. 3 band purpose bands are also carried out Recycling.

e₀: the amplification of VHH target gene.Using the genetic fragment of the entire heavy chain antibody of recycling and its heavy chain variable region as mould Plate obtains VHH target gene (500bp) with VHH specific primer through the second wheel PCR amplification.Referring to Fig. 2, it can be seen that one Bright band, VHH target gene is about 500bp, that is, mixes that there are many VHH target gene of 500bp or so in the bright band.

Above-mentioned first round PCR primer includes SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.

Wherein SEQ ID NO:1 and SEQ ID NO:2 pairing uses, and amplification obtains two bands shown in 1 in Fig. 1； SEQ ID NO:2 and SEQ ID NO:3 pairing uses, and amplification obtains a band shown in 2 in Fig. 1.

Second wheel PCR primer includes SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence.SEQ ID NO:4 and SEQ ID NO:5 pairing uses, and obtains 500bp target gene shown in Fig. 2.

Gene order title	Primer sequence
		SEQ ID NO:1	CGCCATCAAGGTACCAGTTGA
SEQ ID NO:2	CGGGATCCCAGGTACAGCTGGTGGAGTCTGGGGGAG
		SEQ ID NO:3	CCGCTCGAGTACTTCATTCGTTCCTGAGGAGACGGT
SEQ ID NO:4	CCGCTCGAGTGAGGAGACGGTGACCT GG
		SEQ ID NO:5	CGGGATCCGAGGTACAGCTGGTGGAGTCTGGGGGAG

f₀: it is transferred to TG1 competent cell.VHH segment obtained above is connected to pHEN6 Vector for Phage Display plasmid (passing through BamHI, XhoI double digestion) later connects VHH segment and pHEN6 carrier (ZL20111028003.1) linked enzyme, Electrotransformation is into TG1 competent cell, then by competent cell spread plate, verifies VHH gene insertion rate through bacterium colony PCR.

After verifying VHH gene is inserted into successfully, cloning efficiency detection is carried out to recombination: electrotransformation bacterium solution being taken to be coated with It on LB/Amp plate, 32 DEG C, is incubated overnight, the joint efficiency of the method validation antibody of secondary daily bacterium colony PCR.

Wherein, the method for bacterium colony PCR is as follows: 1, first in resistance with autoclaved toothpick or pipette tips picking single bacterium colony Monoclonal is put on plate and saves (label), is subsequently placed in 20ul Triton-x100 (or deionized water) and is mixed.2, it will be equipped with The EP pipe of 20ul Tritonx-100 boils 2 minutes at 100 DEG C.3, taking 1ul supernatant is template, and PCR system is added and carries out PCR Reaction, PCR system can be 20ul.4, agarose gel electrophoresis observes result.

When the joint efficiency of phage antibody library is lower than 90%, illustrate to need to repeat above-mentioned tested in operation error Journey；When the efficiency of phage antibody library reaches 90%, next step operation is carried out.

g₀: expand culture, preservation.Electrotransformation bacterium solution is coated on LB/Amp plate, 32 DEG C, overnight culture is trained with 2YT Feeding base is washed down, is expanded culture under 2YT culture medium with 1:1000 ratio, and helper phage M13K07 is added (Invitrogen) it is infected, is incubated overnight, is centrifuged, 20%PEG-2.5M NaCl mixing (bacteriophage is added after collecting supernatant In supernatant), be collected by centrifugation precipitating, PBS be added and glycerol is resuspended, and be preserved in -80 DEG C it is spare.

Two, the screening of specific bacteriophage

There are many VHH segments come out due to process nested PCR amplification, and in these segments, not all these genes Segment is all target fragment, after these segments VHH segment is transferred to bacteriophage, needs to purify target phage, following The step of content is purification of target bacteriophage:

a₁: with of CPBS solution.A small amount of nonfat milk is added in PBS solution, wherein the accounting of nonfat milk exists 1%-5% (sealing process)；The TNF-α albumen being dissolved in CPBS solution is diluted to 150 μ g/ml；

b₁: after TNF-α diluted protein solution, 150 holes μ l/ are coated with；

c₁: it stands, and abandons coating buffer, 300 hole μ l/ confining liquid (1%CPBS), 37 DEG C of closing 2h are added；

d₁: the bacteriophage screened is added in micropore, and confining liquid is added and mixes to every 150 μ l of pore volume；

e₁: incubation at room temperature 2h (secretory antibody, antibody and TNF-α protein binding on the shell of bacteriophage)；

f₁: sieve pore is respectively washed 10 times with PBST (containing 0.05%Tween20), PBS respectively, and each 2min will be not bound with Bacteriophage wash off；

g₁: TEA wash-out bacteriophage into sieve pore is added, pressure-vaccum is suspended uniformly, is stored at room temperature 10min；

h₁: pressure-vaccum is added in the 1M Tris-HCl of pre-cooling after being suspended uniformly and mixes again, carries out the measurement of titre；

i₁: it expands and purifies the bacteriophage after amplification.

Above-mentioned steps a₁To step i₁, three-wheel is repeated, and with step i₁Bacteriophage as next round step d₁In addition The bacteriophage of micropore (bacteriophage of the first round is spare from above-mentioned -80 DEG C of preservations).

The selection result is detailed in following table

Screen number	Phage antibody library total amount is added	Eluent+Tris-HCl
			The first round	5.00E+11	300ulTEA+200ulTris
Second wheel	5.35E+11	150ul*5TEA+350ulTris
			Third round	5.06E+11	150ul*5TEA+350ulTris

Above-mentioned steps a₁To step i₁To be coated with TNF-α antigen as target, using solid-phase screening method from total phage antibody Library carries out 3 wheel screenings, screens by three-wheel, the phage titre eluted increases, that is to say, that TNF-α specific bacteriophage Efficiently concentrating is obtained.

Three, the screening of specific positive monoclonal

Although efficiently concentrating has been obtained in above-mentioned bacteriophage, appoints and so remains a small amount of nonspecific bacteriophage, Specificity T NF- α single domain antibody gene in the following, will be further purified.Specific step is as follows:

a₂: by SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence, to above-mentioned enriched TNF-α specificity Bacteriophage carries out PCR amplification, and the specificity T NF- α single domain antibody gene of acquisition (has restriction enzyme BbsI and BamHI The PCR product of point)；

b₂: PCR product and pSJF2 carrier (ZL are handled respectively with restriction enzyme BbsI and BamHI 201110280031) it, connects and recombinates through T4 ligase, and obtaining can be in the plasmid sdAb- of E. coli pSJF2；

c₂: then the random multiple single colonies of picking (such as 50 to 95) from the agar plate of growth bacterium colony are inoculated with In 96 hole depth well culture plates of the 2YT fluid nutrient medium containing Amp；

d₂: after culture 4 hours, monoclonal is corresponded to be seeded in and is consolidated with the LB containing Amp separated with small lattice numbered On body plate；

e₂: IPTG to final concentration 0.5mM induction is added to deep hole culture plate；

f₂: after overnight incubation, the bacterium supernatant of harvest expression albumen；

g₂: ELISA measurement is carried out with TNF-α antigen, selects Anti-TNF- α positive colony ELISA measurement result；

h₂: the TNF-α positive colony picked out identifies the gene order of anti-tnf-alpha single domain antibody clone through DNA sequencing SEQ ID NO:6 (or SEQ ID NO:7 complementary with SEQ ID NO:6).

SEQ ID NO:6 sequence is as follows:

CAGGTACAGCTGGTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCTCTGAGACTCTCGTGTGC AGCCTCTGGGAGCATCGCCAATATCTATGCCATGGGCTGGTACCGCCAGGCTCCAGGGAACGATCGCGAGTTGGTC GCAGATATTAGTCGTGCTAATCGGACACTCTATGCAGACTCCGTAAAGGGCCGATTCACCATCTCCAGAACCAACG ACTGGAGGACGGTGTATCTGCAAATGAACATGCTGAAACCTGAGGACACGGCCGTCTATTACTGTAATACTAGAAA CGACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA.Four, TNF-α single domain antibody expresses in host e. coli, is pure Change

After obtaining above-mentioned positive monoclonal, TNF-α antibody can be obtained by needing to be expressed, subsequent mainly to pass through large intestine Bacillus expression, then purifies, required TNF-α single domain antibody can be obtained.Specific operation process is as follows:

a₃: the above-mentioned strain containing plasmid TNF-α is seeded on the LB culture plate containing aminobenzylpenicillin, 37 DEG C of mistakes Night.Here, itself penicillin toranto has resistance due to pSJF2 carrier, thus, in the LB culture containing aminobenzylpenicillin On plate, the Escherichia coli only containing pSJF2 carrier can grow, and avoid the interference of other miscellaneous bacterias；

b₃: it selects single bacterium colony and is inoculated in the LB culture solution containing aminobenzylpenicillin of 5ml, 37 DEG C, shaking table culture mistake Night；

c₃: transferred species 2ml overnight culture is in LB culture solution of the 200mL containing aminobenzylpenicillin；

d₃: 240 revs/min, when culture to OD value is up to 0.4~0.6,0.5~1.0mMIPTG is added in 37 DEG C of shaking table cultures, after Continuous overnight incubation, is then centrifuged for, and receives bacterium.

e₃: hypertonic method cracks bacterium, and soluble single domain antibody albumen in supernatant is received in centrifugation；

f₃: purity is obtained up to 95% or more albumen through Ni+ ion affinity chromatography.

(Fig. 3 is different from a upper case, needs detailed analysis) are specific referring to figure 3., and in Fig. 3, M is protein molecular mark It is quasi-.

(stream) is that total protein slightly mentioned the sample after nickel column, illustrates that only a small amount of sample is eluted, in Ni+ column also Residue has a large amount of sample albumen.

(40) with the remaining sample after stripping nickel removal column containing 40 mmoles imidazoles, illustrate by further eluting Afterwards, most of albumen is all eluted.

(100) it is remaining sample after crossing nickel removal column with the eluent containing 100 mmoles imidazoles, illustrates do not have in Ni+ column The albumen being eluted is few.

(400) it is remaining sample after crossing nickel column with the eluent containing 400 mmoles imidazoles, can be seen by this band Out, the albumen almost all of Ni+ column is eluted, and the target protein eluted is purer.

Five, single domain antibody and TNF-α antigen-binding activity measure

Target antibody is screened and is purified by the above process, in order to verify target antibody perhaps, experimental procedure It is as follows:

a₄: TNF-α antigen is diluted to 2 μ g/ml, 100 holes μ l/, antigen with 0.05M Na2CO3NaHCO3 (pH 9.5) It is coated with 96 orifice plates, 4 DEG C of overnight incubations；

b₄: three times with PBS board-washing, 300 μ l 2%BSA (or 1%CPBS) close 96 orifice plates, 37 DEG C, are incubated for 2 hours；

c₄: the TNF-α single domain antibody of the purifying of different diluted concentrations is added, is added by 100 holes μ l/, 37 DEG C, it is small to be incubated for 1 When；

d₄: three times with 0.05%PBST board-washing；

e₄: add 5000 times of diluted antiMyctag antibody (HRP), be added by 100 holes μ l/, 37 DEG C, it is small to be incubated for 1 When；

f₄: three times with 0.05%PBST board-washing, adds the hole TMB100 μ l/, be protected from light and be stored at room temperature 10 minutes.G4: 2M is added 50 hole μ l/ H2SO4 terminates reaction；

g₄: the sample OD value under 450nm wavelength is measured with microplate reader.

From fig. 4, it can be seen that even if the concentration after TNF-α single domain antibody and TNF-α antigen binding is in 0.08 μ g/ml, It still can detecte higher activity.

Fig. 5 is affinity detection process figure and results of measuring.Wherein, four curves are respectively to use various concentration gradient anti- Body measures result, and (Line 1 corresponding concentration is the antibody of 235.3nM, the antibody that No. 2 line corresponding concentrations are 470.6nM, No. 3 lines pair Answering concentration is the antibody of 941.2nM, the antibody that No. 4 line corresponding concentrations are 1882nM).Abscissa is time shaft (0-900 seconds), is indulged Coordinate is the reaction numerical value (Response) that machine is read in experimentation.It was antigen-antibody knot before 300 seconds according to experimental design Conjunction process, -900 seconds 300 seconds are dissociation process, referring to the cut-off rule in Fig. 5.At any time according to numerical value machine-readable in cohesive process Variation, can obtain binding constant Kon (1/Ms).It is changed with time according to numerical value machine-readable in dissociation process, dissociation constant can be obtained Kdis(1/s).According to formula:

It is anti-can to obtain the IL17RA for using various concentration to measure by affinity constant KD=dissociation constant Kdis/ binding constant Kon Body affinity constant KD=5.58E-8M.Testing result is consistent under each concentration gradient, and experimental result is reliable (referring to being fitted in Fig. 5 Curve and following table, R²=0.997).

For TNF-α monoclonal antibody production efficiency, the present invention using spectrophotometer to the TNF-α antibody obtained after purification into Row concentration mensuration is measured through expression, extraction, Tot Prot is 4.68mg after purification.Because expression system used in embodiment is 200ml, therefore, the TNF-α single domain antibody prokaryotic expression system unit expression quantity constructed in the present embodiment are 2.34mg/100ml Bacterium solution.

The expression quantity finally obtained by analytical calculation can prove expression system used in embodiment to the table of albumen Up to efficiency, i.e. albumen quality obtained by unit expression volume.Under normal conditions, expression quantity reaches 0.5mg/100ml, that is, thinks Higher expression (highest level in compared with the existing technology), the expression quantity of this TNF-α single domain antibody are embodied Reach 2.34mg/100ml, reaches industry high levels.

The above description is only a preferred embodiment of the present invention, is not intended to limit the scope of the invention, all at this Under the inventive concept of invention, using equivalent structure transformation made by description of the invention and accompanying drawing content, or directly/use indirectly It is included in other related technical areas in scope of patent protection of the invention.

SEQUENCE LISTING

<110>Shenzhen Puri gold Bioceuticals Inc.

<120>TNF-α single domain antibody, nucleotide sequence and kit

<130> 123

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 291

<212> PRT

<213>artificial sequence

<400> 1

Gly Leu Asn Val Ala Leu Gly Leu Asn Val Ala Leu Ser Glu Arg Gly

1 5 10 15

Leu Tyr Gly Leu Tyr Gly Leu Tyr Val Ala Leu Gly Leu Asn Gly Leu

20 25 30

Tyr Gly Leu Tyr Ser Glu Arg Ala Arg Gly Ser Glu Arg Cys Tyr Ser

35 40 45

Ala Leu Ala Ala Leu Ala Ser Glu Arg Gly Leu Tyr Ser Glu Arg Ile

50 55 60

Leu Glu Ala Leu Ala Ala Ser Asn Ile Leu Glu Thr Tyr Arg Ala Leu

65 70 75 80

Ala Met Glu Thr Gly Leu Tyr Thr Arg Pro Thr Tyr Arg Ala Arg Gly

85 90 95

Gly Leu Asn Ala Leu Ala Gly Leu Tyr Ala Ser Asn Ala Ser Pro Ala

100 105 110

Arg Gly Val Ala Leu Ala Leu Ala Ala Ser Pro Ile Leu Glu Ser Glu

115 120 125

Arg Ala Arg Gly Ala Leu Ala Ala Ser Asn Ala Arg Gly Thr His Arg

130 135 140

Thr Tyr Arg Ala Leu Ala Ala Ser Pro Ser Glu Arg Val Ala Leu Leu

145 150 155 160

Tyr Ser Gly Leu Tyr Ala Arg Gly Pro His Glu Thr His Arg Ile Leu

165 170 175

Glu Ser Glu Arg Ala Arg Gly Thr His Arg Ala Ser Asn Ala Ser Pro

180 185 190

Thr Arg Pro Ala Arg Gly Thr His Arg Val Ala Leu Thr Tyr Arg Gly

195 200 205

Leu Asn Met Glu Thr Ala Ser Asn Met Glu Thr Leu Tyr Ser Ala Ser

210 215 220

Pro Thr His Arg Ala Leu Ala Val Ala Leu Thr Tyr Arg Thr Tyr Arg

225 230 235 240

Cys Tyr Ser Ala Ser Asn Thr His Arg Ala Arg Gly Ala Ser Asn Ala

245 250 255

Ser Pro Thr Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His

260 265 270

Arg Gly Leu Asn Val Ala Leu Thr His Arg Val Ala Leu Ser Glu Arg

275 280 285

Ser Glu Arg

290

<210> 2

<211> 21

<212> DNA

<213>artificial sequence

<400> 2

cgccatcaag gtaccagttg a 21

<210> 3

<211> 29

<212> DNA

<213>artificial sequence

<400> 3

cgggatccca ggtacagctg gtggagtctg ggggag 36

<210> 4

<211> 43

<212> DNA

<213>artificial sequence

<400> 4

ccgctcgagt acttcattcg ttcctgagga gacggt 36

<210> 5

<211> 41

<212> DNA

<213>artificial sequence

<400> 5

ccgctcgagt gaggagacgg tgacctgg 28

<210> 6

<211> 47

<212> DNA

<213>artificial sequence

<400> 6

cgggatccga ggtacagctg gtggagtctg ggggag 36

<210> 7

<211> 333

<212> DNA

<213>artificial sequence

<400> 7

caggtacagc tggtggaatc tgggggaggc ttggtacagc ctggggggtc tctgagactc 60

tcgtgtgcag cctctgggag catcgccaat atctatgcca tgggctggta ccgccaggct 120

ccagggaacg atcgcgagtt ggtcgcagat attagtcgtg ctaatcggac actctatgca 180

gactccgtaa agggccgatt caccatctcc agaaccaacg actggaggac ggtgtatctg 240

caaatgaaca tgctgaaacc tgaggacacg gccgtctatt actgtaatac tagaaacgac 300

tggggccagg ggacccaggt caccgtctcc tca 333

Claims

1. a kind of TNF-α single domain antibody, which is characterized in that can including four frame areas FR1, FR2, R3, FR4 and three Become region CDR1, CDR2, CDR3, wherein

CDR1:Ile Tyr Ala Met Gly；

FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Asp Arg Glu Leu Val Ala；

CDR2:Asp Ile Ser Arg Ala Asn Arg Thr Leu Tyr Ala Asp Ser Val Lys；

CDR3:Thr Arg Asn；

FR4:Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.

2. a kind of nucleotide sequence, which is characterized in that the nucleotide sequence coded TNF-α as described in claim 1 Single domain antibody.

3. nucleotide sequence as claimed in claim 2, which is characterized in that the nucleotide sequence is as follows:

CAGGTACAGCTGGTGGAATCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCTCTGAGACTCTCGTGTGCAGCC TCTGGGAGCATCGCCAATATCTATGCCATGGGCTGGTACCGCCAGGCTCCAGGGAACGATCGCGAGTTGGTCGCAG ATATTAGTCGTGCTAATCGGACACTCTATGCAGACTCCGTAAAGGGCCGATTCACCATCTCCAGAACCAACGACTG GAGGACGGTGTATCTGCAAATGAACATGCTGAAACCTGAGGACACGGCCGTCTATTACTGTAATACTAGAAACGAC TGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

4. a kind of kit, which is characterized in that including TNF-α single domain antibody as described in claim 1, or such as claim Nucleotide sequence described in 2 or 3.