CN110003337A - IL17RA single domain antibody, nucleotide sequence and kit - Google Patents

IL17RA single domain antibody, nucleotide sequence and kit Download PDF

Info

Publication number
CN110003337A
CN110003337A CN201910302018.XA CN201910302018A CN110003337A CN 110003337 A CN110003337 A CN 110003337A CN 201910302018 A CN201910302018 A CN 201910302018A CN 110003337 A CN110003337 A CN 110003337A
Authority
CN
China
Prior art keywords
ser
gly
leu
ala
il17ra
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910302018.XA
Other languages
Chinese (zh)
Other versions
CN110003337B (en
Inventor
李胜华
包朝乐萌
许莎莎
李莹莹
余祥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Pregene Biopharma Co ltd
Original Assignee
Shenzhen Pregene Biopharma Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Pregene Biopharma Co ltd filed Critical Shenzhen Pregene Biopharma Co ltd
Priority to CN201910302018.XA priority Critical patent/CN110003337B/en
Publication of CN110003337A publication Critical patent/CN110003337A/en
Application granted granted Critical
Publication of CN110003337B publication Critical patent/CN110003337B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567—Framework region [FR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses an IL17RA single-domain antibody, a nucleotide sequence and a kit, wherein the polypeptide comprises 4 framework regions and 3 variable regions, four framework regions FR1, FR2, R3 and FR4, and three variable regions CDR1, CDR2 and CDR 3. The technical scheme of the invention obtains the single domain antibody specifically binding the IL17A/F protein by combining a genetic engineering method, and the antibody specifically binds the IL17RA protein, and has the advantages of high activity, high expression level, low cost and easy modification.

Description

IL17RA single domain antibody, nucleotide sequence and kit
Technical field
The present invention relates to gene engineering technology field, in particular to a kind of IL17RA single domain antibody, nucleotide sequence and examination Agent box.
Background technique
Interleukin-17 acceptor A (IL-17RA) is I type transmembrane glycoprotein, is distributed widely in the surface of various cells, such as non- The epithelial cell of hematopoietic cell, fibrocyte, cartilage cell and the macrophage of hematopoietic cell, neutrophil leucocyte, T cell Deng playing a significant role in inflammatory reaction.IL-17RA regulates and controls receptor as important inflammation, with IL-17A ining conjunction with after it is sharp IL-17RA signal path living, it is highly relevant with the disease symptoms mechanism such as autoimmune disease and cancer.Studies have shown that IL-17RA Access antagonist --- if IL-17RA specific antibody is by that in conjunction with IL-17RA, can block IL-17 family cell factor In conjunction with receptor, inhibit inflammatory reaction.
However, existing interleukin-17 acceptor A system expression amount is relatively low, affinity of antibody is not also high, and molecular weight is big, production It is at high cost, it is not easy to be transformed.
Summary of the invention
The main object of the present invention is to provide a kind of polypeptide sequence, it is intended to solve that existing IL17RA affinity of antibody is low to ask Topic.
To achieve the above object, the present invention proposes a kind of IL17RA single domain antibody, including four frame area FR1, FR2, R3, FR4 and three Variable Areas CDR1, CDR2, CDR3, wherein
FR1:Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
CDR1:Glu Tyr Ala Leu Gly；
FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Gln Gln Asp Trp Val Ala；
CDR2:Ser Ile Asn Ser Leu Gly Asp Pro Thr Tyr Ala Glu Ser Val Lys；
FR3:Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asn Tyr Tyr；
CDR3:Cys Asn Ile Pro Arg Leu Asn；
FR4:Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.
The present invention also provides a kind of nucleotide sequence, the nucleotide sequence coded IL17RA single domain antibody is described IL17RA single domain antibody includes four frame areas FR1, FR2, R3, FR4 and three Variable Areas CDR1, CDR2, CDR3, Wherein,
FR1:Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
CDR1:Glu Tyr Ala Leu Gly；
FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Gln Gln Asp Trp Val Ala；
CDR2:Ser Ile Asn Ser Leu Gly Asp Pro Thr Tyr Ala Glu Ser Val Lys；
FR3:Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asn Tyr Tyr；
CDR3:Cys Asn Ile Pro Arg Leu Asn；
FR4:Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.
In one embodiment, the nucleotide sequence is as follows:
CAGGTAAAGCTGGAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGAGTCACTGAAACTCTCCTGTGC AGCCTCTGGAGGGACCTTCAGCGAATATGCCCTGGGTTGGTACCGCCAGGCTCCAGGGAACCAGCAGGACTGGGTC GCATCCATTAATAGTTTAGGTGATCCAACCTATGCAGAGTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACG CCAAGAGCACGCTCTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCAATTATTACTGTAATATTCCCCG CCTTAATTTATGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
The present invention also provides a kind of kit, the kit includes IL17RA single domain antibody or nucleotide sequence；Institute State IL17RA single domain antibody include four frame areas FR1, FR2, R3, FR4 and three Variable Area CDR1, CDR2, CDR3, wherein
FR1:Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
CDR1:Glu Tyr Ala Leu Gly；
FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Gln Gln Asp Trp Val Ala；
CDR2:Ser Ile Asn Ser Leu Gly Asp Pro Thr Tyr Ala Glu Ser Val Lys；
FR3:Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asn Tyr Tyr；
CDR3:Cys Asn Ile Pro Arg Leu Asn；
FR4:Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser；The nucleotide sequence is such as Under:
CAGGTAAAGCTGGAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGAGTCACTGAAACTCTCCTGTGC AGCCTCTGGAGGGACCTTCAGCGAATATGCCCTGGGTTGGTACCGCCAGGCTCCAGGGAACCAGCAGGACTGGGTC GCATCCATTAATAGTTTAGGTGATCCAACCTATGCAGAGTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACG CCAAGAGCACGCTCTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCAATTATTACTGTAATATTCCCCG CCTTAATTTATGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
Technical solution of the present invention obtains a kind of list for specifically binding IL17A/F albumen by the method for combining genetic engineering The activity of domain antibodies, the antibody specificity combination IL17RA albumen is high, and expression quantity is high, at low cost, with transformation.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.
Fig. 1 is first round PCR single domain antibody gene electrophoretogram of the invention；
Fig. 2 is to carry out the second wheel PCR single domain antibody gene in Fig. 1 in 1 after the DNA of 750bp-500bp, 2 and 3 recycling Electrophoretogram；
Fig. 3 is protein expression and purification figure；
Fig. 4 is IL17RA single domain antibody of the present invention and IL17RA antigen-binding activity figure.
Fig. 5 is IL17RA single domain antibody affinity detection process figure of the present invention；
Fig. 6 is IL17RA single domain antibody affinity detection process of the present invention and linear fit comparison diagram.
The embodiments will be further described with reference to the accompanying drawings for the realization, the function and the advantages of the object of the present invention.
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation description, it is clear that described embodiment is only a part of the embodiments of the present invention, instead of all the embodiments.Base Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts it is all its His embodiment, shall fall within the protection scope of the present invention.
The present invention proposes a kind of IL17RA single domain antibody, nucleotide sequence and kit in fact.Following the description will be directed to institute It states polypeptide and its screening process describes in detail.
Firstly, there are three framework region and two variable regions for polypeptide tool of the invention:
FR1:Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
CDR1:Glu Tyr Ala Leu Gly；
FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Gln Gln Asp Trp Val Ala；
CDR2:Ser Ile Asn Ser Leu Gly Asp Pro Thr Tyr Ala Glu Ser Val Lys；
FR3:Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asn Tyr Tyr；
CDR3:Cys Asn Ile Pro Arg Leu Asn；
FR4:Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.
For the IL17RA single domain antibody, building mode of the present invention is divided into the sieve of the building of antibody library, specific bacteriophage Choosing, the screening of specific positive monoclonal, IL17RA single domain antibody are expressed in host e. coli, are purified.Following the description will It is described in detail for each step.
One, the building of antibody library
IL17RA antigen: producer, Divine Land Yi Qiao, Beijing, article No. 11958-H08H1.
It is mixed using the above-mentioned antigen of 1mg with isometric freund adjuvant.The alpaca for selecting adult healthy, injects the antigen, divides 6 It is secondary immune, after the 4th is immune, alpaca serum is taken, by chemiluminescent method, measures antigen immunizing potency.
a0: separation lymphocyte.When immunizing potency reaches 10,000 times or more, whole blood 150ml is adopted, uses QIAGEN reagent Box (QIAamp RNA Blood Mini Kit (50), article No., 52304) is by separation of lymphocytes.
b0: cracking.By the lymphocytolysis after separation, RNA purifying is then carried out, QIAGEN kit is used (QIAamp RNA Blood Mini Kit (50), article No., 52304), measurement obtain RNA concentration.
c0: nested PCR amplification.With cDNA synthetic agent box (MiniBESTAgarose Gel DNAExtraction Kit Ver.4.0, TAKARA company), using nested PCR method, carry out two-wheeled PCR amplification antibody heavy chain variable region VHH genetic fragment；
First round PCR amplification can obtain the common antibody gene segments greater than 800bp, be between 800bp~500bp The heavy chain antibody genes segment of light chain and the antibody heavy chain variable region segment VHH. of 500bp are lacked by electrophoresis, is filtered out The genetic fragment of 800bp~500bp and the genetic fragment of 500bp.
d0: gel extraction, by the genetic fragment gel extraction of 800bp~500bp in step c0.Referring specifically to Fig. 1,1 Number band is common antibody dna and heavy chain antibody DNA, it can be seen that two bright bands therein have (the common antibody greater than 800bp DNA), also there is (the heavy chain antibody DNA) between 500bp~750bp, the band that 750bp~500bp is located in the figure is cut into glue Recycling；No. 2 bands and No. 3 bands are antibody heavy chain variable region segment VHH, and size is in 500bp；By No. 2 bands and No. 3 band purpose bands It is recycled.
e0: the amplification of VHH target gene.Using the genetic fragment of the entire heavy chain antibody of recycling and its heavy chain variable region as mould Plate obtains VHH target gene (500bp) with VHH specific primer through the second wheel PCR amplification.Referring to Fig. 2, it can be seen that one Bright band, VHH target gene is about 500bp, that is, mixes that there are many VHH target gene of 500bp or so in the bright band.
Above-mentioned first round PCR primer includes SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 nucleotide sequence.
Wherein SEQ ID NO:1 and SEQ ID NO:2 pairing uses, and amplification obtains two bands shown in 1 in Fig. 1； SEQ ID NO:2 and SEQ ID NO:3 pairing uses, and amplification obtains a band shown in 2 in Fig. 1.
Second wheel PCR primer includes SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence.SEQ ID NO:4 and SEQ ID NO:5 pairing uses, and obtains 500bp target gene shown in Fig. 2.
f0: it is transferred to TG1 competent cell.VHH segment obtained above is connected to pHEN6 Vector for Phage Display plasmid (passing through BamHI, XhoI double digestion) later connects VHH segment and pHEN6 carrier (ZL20111028003.1) linked enzyme, Electrotransformation is into TG1 competent cell, then by competent cell spread plate, verifies VHH gene insertion rate through bacterium colony PCR.
After verifying VHH gene is inserted into successfully, cloning efficiency detection is carried out to recombination: electrotransformation bacterium solution being taken to be coated with It on LB/Amp plate, 32 DEG C, is incubated overnight, the joint efficiency of the method validation antibody of secondary daily bacterium colony PCR.
Wherein, the method for bacterium colony PCR is as follows: 1, first in resistance with autoclaved toothpick or pipette tips picking single bacterium colony Monoclonal is put on plate and saves (label), is subsequently placed in 20ul Triton-x100 (or deionized water) and is mixed.2, it will be equipped with The EP pipe of 20ul Tritonx-100 boils 2 minutes at 100 DEG C.3, taking 1ul supernatant is template, and PCR system is added and carries out PCR Reaction, PCR system can be 20ul.4, agarose gel electrophoresis observes result.
When the joint efficiency of phage antibody library is lower than 90%, illustrate to need to repeat above-mentioned tested in operation error Journey；When the efficiency of phage antibody library reaches 90%, next step operation is carried out.
g0: expand culture, preservation.Electrotransformation bacterium solution is coated on LB/Amp plate, 32 DEG C, overnight culture is trained with 2YT Feeding base is washed down, is expanded culture under 2YT culture medium with 1:1000 ratio, and helper phage M13K07 is added (Invitrogen) it is infected, is incubated overnight, is centrifuged, 20%PEG-2.5M NaCl mixing (bacteriophage is added after collecting supernatant In supernatant), be collected by centrifugation precipitating, PBS be added and glycerol is resuspended, and be preserved in -80 DEG C it is spare.
Two, the screening of specific bacteriophage
There are many VHH segments come out due to process nested PCR amplification, and in these segments, not all these genes Segment is all target fragment, after these segments VHH segment is transferred to bacteriophage, needs to purify target phage, following The step of content is purification of target bacteriophage:
a1: with of CPBS solution.A small amount of nonfat milk is added in PBS solution, wherein the accounting of nonfat milk exists 1%-5% (sealing process)；The IL17RA albumen being dissolved in CPBS solution is diluted to 150 μ g/ml；
b1: after IL17RA diluted protein solution, 150 holes μ l/ are coated with；
c1: it stands, and abandons coating buffer, 300 hole μ l/ confining liquid (1%CPBS), 37 DEG C of closing 2h are added；
d1: the bacteriophage screened is added in micropore, and confining liquid is added and mixes to every 150 μ l of pore volume；
e1: incubation at room temperature 2h (secretory antibody, antibody and IL17RA protein binding on the shell of bacteriophage)；
f1: sieve pore is respectively washed 10 times with PBST (containing 0.05%Tween20), PBS respectively, and each 2min will be not bound with Bacteriophage wash off；
g1: TEA wash-out bacteriophage into sieve pore is added, pressure-vaccum is suspended uniformly, is stored at room temperature 10min；
h1: pressure-vaccum is added in the 1M Tris-HCl of pre-cooling after being suspended uniformly and mixes again, carries out the measurement of titre；
i1: it expands and purifies the bacteriophage after amplification.
Above-mentioned steps a1To step i1, three-wheel is repeated, and with step i1Bacteriophage as next round step d1In addition The bacteriophage of micropore (bacteriophage of the first round is spare from above-mentioned -80 DEG C of preservations).
The selection result is detailed in following table
Screen number Phage antibody library total amount is added Eluent+Tris-HCl
The first round 9.60E+11 300ulTEA+200ulTris
Second wheel 4.80E+11 300ulTEA+200ulTris
Third round 1.66E+12 150ul*5TEA+350ulTris
Above-mentioned steps a1To step i1It is anti-from total bacteriophage using solid-phase screening method to be coated with IL17RA antigen as target Body library carries out 3 wheel screenings, screens by three-wheel, the phage titre eluted increases, that is to say, that IL17RA specificity is bitten Thallus has obtained efficiently concentrating.
Three, the screening of specific positive monoclonal
Although efficiently concentrating has been obtained in above-mentioned bacteriophage, appoints and so remains a small amount of nonspecific bacteriophage, Specific IL17RA single domain antibody gene in the following, will be further purified.Specific step is as follows:
a2: it is special to above-mentioned enriched IL17RA by SEQ ID NO:4 and SEQ ID NO:5 nucleotide sequence Property bacteriophage carry out PCR amplification, the specific IL17RA single domain antibody gene of acquisition (with restriction enzyme BbsI and The PCR product in the site BamHI)；
b2: PCR product and pSJF2 carrier (ZL are handled respectively with restriction enzyme BbsI and BamHI 201110280031) it, connects and recombinates through T4 ligase, and obtaining can be in the plasmid sdAb- of E. coli pSJF2；
c2: then the random multiple single colonies of picking (such as 50 to 95) from the agar plate of growth bacterium colony are inoculated with In 96 hole depth well culture plates of the 2YT fluid nutrient medium containing Amp；
d2: after culture 4 hours, monoclonal is corresponded to be seeded in and is consolidated with the LB containing Amp separated with small lattice numbered On body plate；
e2: IPTG to final concentration 0.5mM induction is added to deep hole culture plate；
f2: after overnight incubation, the bacterium supernatant of harvest expression albumen；
g2: ELISA measurement is carried out with IL17RA antigen, selects Anti-IL17RA positive colony ELISA measurement result；
h2: the IL17RA positive colony picked out identifies the gene sequence of anti-IL17RA single domain antibody clone through DNA sequencing It arranges SEQ ID NO:6 (or SEQ ID NO:7 complementary with SEQ ID NO:6).
SEQ ID NO:6 sequence is as follows:
CAGGTAAAGCTGGAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGAGTCACTGAAACTCTCCTGTGC AGCCTCTGGAGGGACCTTCAGCGAATATGCCCTGGGTTGGTACCGCCAGGCTCCAGGGAACCAGCAGGACTGGGTC GCATCCATTAATAGTTTAGGTGATCCAACCTATGCAGAGTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACG CCAAGAGCACGCTCTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCAATTATTACTGTAATATTCCCCG CCTTAATTTATGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA.Four, IL17RA single domain antibody is in host e. coli Expression, purifying
After obtaining above-mentioned positive monoclonal, IL17RA antibody can be obtained by needing to be expressed, subsequent mainly by big Enterobacteria expression, then purifies, required IL17RA single domain antibody can be obtained.Specific operation process is as follows:
a3: the above-mentioned strain containing plasmid IL17RA is seeded on the LB culture plate containing aminobenzylpenicillin, 37 DEG C of mistakes Night.Here, itself penicillin toranto has resistance due to pSJF2 carrier, thus, in the LB culture containing aminobenzylpenicillin On plate, the Escherichia coli only containing pSJF2 carrier can grow, and avoid the interference of other miscellaneous bacterias；
b3: it selects single bacterium colony and is inoculated in the LB culture solution containing aminobenzylpenicillin of 5ml, 37 DEG C, shaking table culture mistake Night；
c3: transferred species 2ml overnight culture is in LB culture solution of the 200mL containing aminobenzylpenicillin；
d3: 240 revs/min, when culture to OD value is up to 0.4~0.6,0.5~1.0mM IPTG is added in 37 DEG C of shaking table cultures, Continue overnight incubation, be then centrifuged for, receives bacterium.
e3: hypertonic method cracks bacterium, and soluble single domain antibody albumen in supernatant is received in centrifugation；
f3: purity is obtained up to 95% or more albumen through Ni+ ion affinity chromatography.
(Fig. 3 is different from a upper case, needs detailed analysis) are specific referring to figure 3., and in Fig. 3, M is protein molecular mark Standard, band 1 are that total protein slightly gets sample product after broken bacterium.
Band 2 is that total protein slightly mentioned the sample after nickel column, illustrates that only a small amount of sample is eluted, in Ni+ column A large amount of sample albumen is there remains.
Band 3 is illustrate by further eluting with the remaining sample after stripping nickel removal column containing 40 mmoles imidazoles Afterwards, most of albumen is all eluted.
Band 4 is remaining sample after crossing nickel removal column with the eluent containing 100 mmoles imidazoles, illustrates do not have in Ni+ column The foreign protein being eluted is few.
Band 5 is remaining sample after crossing nickel column with the eluent containing 400 mmoles imidazoles, can be seen by this band Out, the albumen almost all of Ni+ column is eluted, and the target protein eluted is purer.Five, single domain antibody and IL17RA are anti- Original combines determination of activity
Target antibody is screened and is purified by the above process, in order to verify the activity of target antibody, experimental procedure It is as follows:
a4: IL17RA antigen is diluted to 2 μ g/ml, 100 holes μ l/, antigen with 0.05M Na2CO3NaHCO3 (pH 9.5) It is coated with 96 orifice plates, 4 DEG C of overnight incubations；
b4: three times with PBS board-washing, 300 μ l 2%BSA (or 1%CPBS) close 96 orifice plates, 37 DEG C, are incubated for 2 hours；
c4: the IL17RA single domain antibody of the purifying of different diluted concentrations is added, is added by 100 holes μ l/, 37 DEG C, it is small to be incubated for 1 When；
d4: three times with 0.05%PBST board-washing；
e4: add 5000 times of diluted antiMyctag antibody (HRP), be added by 100 holes μ l/, 37 DEG C, it is small to be incubated for 1 When；
f4: three times with 0.05%PBST board-washing, adds the hole TMB100 μ l/, be protected from light and be stored at room temperature 10 minutes.G4: 2M is added 50 hole μ l/ H2SO4 terminates reaction；
g4: the sample OD value under 450nm wavelength is measured with microplate reader.
From fig. 4, it can be seen that even if the concentration after IL17RA single domain antibody and IL17RA antigen binding is in 3.2ng/ml, It still can detecte higher activity.
Fig. 5 is affinity detection process figure and results of measuring.Wherein, four curves are respectively to use various concentration gradient anti- Body measures result, and (Line 1 corresponding concentration is the antibody of 235.3nM, the antibody that No. 2 line corresponding concentrations are 470.6nM, No. 3 lines pair Answering concentration is the antibody of 941.2nM, the antibody that No. 4 line corresponding concentrations are 1882nM).Abscissa is time shaft (0-900 seconds), is indulged Coordinate is the reaction numerical value (Response) that machine is read in experimentation.It was antigen-antibody knot before 300 seconds according to experimental design Conjunction process, -900 seconds 300 seconds are dissociation process, referring to the cut-off rule in Fig. 5.At any time according to numerical value machine-readable in cohesive process Variation, can obtain binding constant Kon (1/Ms).It is changed with time according to numerical value machine-readable in dissociation process, dissociation constant can be obtained Kdis(1/s).According to formula:
It is anti-can to obtain the IL17RA for using various concentration to measure by affinity constant KD=dissociation constant Kdis/ binding constant Kon Body affinity constant KD=2.99E-11M.Testing result is consistent under each concentration gradient, and experimental result is reliable (referring to being fitted in Fig. 6 Curve and following table, R2=0.997).
Affinity test is carried out to commercially available 4 kinds of IL17RA antibody, test result shows that commercially available IL17RA antibody passes through The affinity that above-mentioned identical method measures is respectively 7.73E-09M (R2=0.992), 9.72E-09M (R2=0.995), 5.55E-09M(R2=0.989), 6.69E-09M (R2=0.997).
It can be seen that IL17RA affinity of antibody of the invention is existing commercially available 30.7~53.8 times, much high appearance There is the affinity of IL17RA antibody in technology.Finally, due to IL17RA single domain antibody is a kind of nano antibody in the present invention, it is raw At low cost, high production efficiency is produced, it is transformed conducive to subsequent.
For IL17RA antibody producing efficiency, the present invention using spectrophotometer to the IL17RA antibody obtained after purification into Row concentration mensuration is measured through expression, extraction, Tot Prot is 3.66mg after purification.Because expression system used in embodiment is 200ml, therefore, the IL17RA single domain antibody prokaryotic expression system unit expression quantity constructed in the present embodiment are 1.83mg/ 100ml。
The expression quantity finally obtained by analytical calculation can prove expression system used in embodiment to the table of albumen Up to efficiency, i.e. albumen quality obtained by unit expression volume.Under normal conditions, expression quantity reaches 0.3mg/100ml, that is, thinks Higher expression (highest level in compared with the existing technology) is embodied, the expression quantity of this IL17RA single domain antibody reaches 1.83mg/100ml has been arrived, high levels are in.
The above description is only a preferred embodiment of the present invention, is not intended to limit the scope of the invention, all at this Under the inventive concept of invention, using equivalent structure transformation made by description of the invention and accompanying drawing content, or directly/use indirectly It is included in other related technical areas in scope of patent protection of the invention.
SEQUENCE LISTING
<110>Shenzhen Puri gold Bioceuticals Inc.
<120>IL17RA single domain antibody, nucleotide sequence and kit
<130> 123
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 273
<212> PRT
<213>artificial sequence
<400> 1
Gly Leu Asn Val Ala Leu Leu Tyr Ser Ser Glu Arg Gly Leu Tyr Gly
1 5 10 15
Leu Tyr Gly Leu Tyr Val Ala Leu Gly Leu Asn Gly Leu Tyr Ser Glu
20 25 30
Arg Leu Tyr Ser Ser Glu Arg Cys Tyr Ser Ala Leu Ala Ala Leu Ala
35 40 45
Ser Glu Arg Gly Leu Tyr Gly Leu Tyr Thr His Arg Pro His Glu Ser
50 55 60
Glu Arg Thr Tyr Arg Ala Leu Ala Gly Leu Tyr Thr Arg Pro Thr Tyr
65 70 75 80
Arg Ala Arg Gly Gly Leu Asn Ala Leu Ala Gly Leu Tyr Ala Ser Asn
85 90 95
Gly Leu Asn Gly Leu Asn Ala Ser Pro Thr Arg Pro Val Ala Leu Ala
100 105 110
Leu Ala Ser Glu Arg Ile Leu Glu Ala Ser Asn Ser Glu Arg Gly Leu
115 120 125
Tyr Ala Ser Pro Thr His Arg Thr Tyr Arg Ala Leu Ala Ser Glu Arg
130 135 140
Val Ala Leu Leu Tyr Ser Gly Leu Tyr Ala Arg Gly Pro His Glu Thr
145 150 155 160
His Arg Ile Leu Glu Ser Glu Arg Ala Arg Gly Ala Ser Pro Ala Ser
165 170 175
Asn Ala Leu Ala Leu Tyr Ser Ser Glu Arg Thr His Arg Thr Tyr Arg
180 185 190
Gly Leu Asn Met Glu Thr Ala Ser Asn Ser Glu Arg Leu Tyr Ser Ala
195 200 205
Ser Pro Thr His Arg Ala Leu Ala Ala Ser Asn Thr Tyr Arg Thr Tyr
210 215 220
Arg Cys Tyr Ser Ala Ser Asn Ile Leu Glu Ala Arg Gly Ala Ser Asn
225 230 235 240
Thr Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His Arg Gly
245 250 255
Leu Asn Val Ala Leu Thr His Arg Val Ala Leu Ser Glu Arg Ser Glu
260 265 270
Arg
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
cgccatcaag gtaccagttg a 21
<210> 3
<211> 29
<212> DNA
<213>artificial sequence
<400> 3
cgggatccca ggtacagctg gtggagtctg ggggag 36
<210> 4
<211> 43
<212> DNA
<213>artificial sequence
<400> 4
ccgctcgagt acttcattcg ttcctgagga gacggt 36
<210> 5
<211> 41
<212> DNA
<213>artificial sequence
<400> 5
ccgctcgagt gaggagacgg tgacctgg 28
<210> 6
<211> 47
<212> DNA
<213>artificial sequence
<400> 6
cgggatccga ggtacagctg gtggagtctg ggggag 36
<210> 7
<211> 339
<212> DNA
<213>artificial sequence
<400> 7
caggtaaagc tggaggagtc tgggggaggc ttggtgcagc ctggggagtc actgaaactc 60
tcctgtgcag cctctggagg gaccttcagc gaatatgccc tgggttggta ccgccaggct 120
ccagggaacc agcaggactg ggtcgcatcc attaatagtt taggtgatcc aacctatgca 180
gagtctgtga agggccgatt caccatctcc agagacaacg ccaagagcac gctctatctg 240
caaatgaaca gcctgaaacc tgaggacacg gccaattatt actgtaatat tccccgcctt 300
aatttatggg gccaggggac ccaggtcacc gtctcctca 339

Claims (4)

1. a kind of IL17RA single domain antibody, which is characterized in that can including four frame areas FR1, FR2, R3, FR4 and three Become region CDR1, CDR2, CDR3, wherein
FR1:Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser；
CDR1:Glu Tyr Ala Leu Gly；
FR2:Trp Tyr Arg Gln Ala Pro Gly Asn Gln Gln Asp Trp Val Ala；
CDR2:Ser Ile Asn Ser Leu Gly Asp Pro Thr Tyr Ala Glu Ser Val Lys；
FR3:Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asn Tyr Tyr；
CDR3:Cys Asn Ile Pro Arg Leu Asn；
FR4:Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser.
2. a kind of nucleotide sequence, which is characterized in that the nucleotide sequence coded IL17RA as described in claim 1 Single domain antibody.
3. nucleotide sequence as claimed in claim 2, which is characterized in that the nucleotide sequence is as follows:
CAGGTAAAGCTGGAGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGAGTCACTGAAACTCTCCTGTGCAGCC TCTGGAGGGACCTTCAGCGAATATGCCCTGGGTTGGTACCGCCAGGCTCCAGGGAACCAGCAGGACTGGGTCGCAT CCATTAATAGTTTAGGTGATCCAACCTATGCAGAGTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAA GAGCACGCTCTATCTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCAATTATTACTGTAATATTCCCCGCCTT AATTTATGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。
4. a kind of kit, which is characterized in that including IL17RA single domain antibody as described in claim 1, or as right is wanted Nucleotide sequence described in asking 2 or 3.
CN201910302018.XA 2019-04-12 2019-04-12 IL17RA single domain antibody, nucleic acid and kit Active CN110003337B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910302018.XA CN110003337B (en) 2019-04-12 2019-04-12 IL17RA single domain antibody, nucleic acid and kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910302018.XA CN110003337B (en) 2019-04-12 2019-04-12 IL17RA single domain antibody, nucleic acid and kit

Publications (2)

Publication Number Publication Date
CN110003337A true CN110003337A (en) 2019-07-12
CN110003337B CN110003337B (en) 2023-05-09

Family

ID=67172093

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910302018.XA Active CN110003337B (en) 2019-04-12 2019-04-12 IL17RA single domain antibody, nucleic acid and kit

Country Status (1)

Country Link
CN (1) CN110003337B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111848795A (en) * 2020-06-19 2020-10-30 北京东方百泰生物科技股份有限公司 anti-IL-17 RA monoclonal antibody and application thereof
WO2021018035A1 (en) * 2019-07-26 2021-02-04 神州细胞工程有限公司 Humanized anti-il17a antibody and use thereof
CN114805577A (en) * 2019-12-31 2022-07-29 南京融捷康生物科技有限公司 Antibody for IL-17RA protein and preparation method and application thereof
CN117843801A (en) * 2023-12-29 2024-04-09 北京贝来药业有限公司 Novel antibodies and downstream products targeting interleukin family members

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101541833A (en) * 2006-10-02 2009-09-23 安姆根有限公司 IL-17 receptor A antigen binding proteins
AU2011203098A1 (en) * 2006-10-02 2011-07-14 Amgen K-A, Inc. IL-17 receptor A antigen binding proteins

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101541833A (en) * 2006-10-02 2009-09-23 安姆根有限公司 IL-17 receptor A antigen binding proteins
AU2011203098A1 (en) * 2006-10-02 2011-07-14 Amgen K-A, Inc. IL-17 receptor A antigen binding proteins

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021018035A1 (en) * 2019-07-26 2021-02-04 神州细胞工程有限公司 Humanized anti-il17a antibody and use thereof
CN114805577A (en) * 2019-12-31 2022-07-29 南京融捷康生物科技有限公司 Antibody for IL-17RA protein and preparation method and application thereof
CN114805577B (en) * 2019-12-31 2023-11-21 南京融捷康生物科技有限公司 Antibody for IL-17RA protein, preparation method and application thereof
CN111848795A (en) * 2020-06-19 2020-10-30 北京东方百泰生物科技股份有限公司 anti-IL-17 RA monoclonal antibody and application thereof
CN111848795B (en) * 2020-06-19 2021-03-12 北京东方百泰生物科技股份有限公司 anti-IL-17 RA monoclonal antibody and application thereof
CN117843801A (en) * 2023-12-29 2024-04-09 北京贝来药业有限公司 Novel antibodies and downstream products targeting interleukin family members

Also Published As

Publication number Publication date
CN110003337B (en) 2023-05-09

Similar Documents

Publication Publication Date Title
CN110003337A (en) IL17RA single domain antibody, nucleotide sequence and kit
CN110003333A (en) Polypeptide, PD-L1 single-domain antibody, nucleotide sequence and kit
CN110003329A (en) Polypeptide, IL17A/F single domain antibody, nucleotide sequence and kit
US8841419B2 (en) Hybridoma cell line 10G4 and a monoclonal antibody against the total of aflatoxin B1, B2, G1 and G2
CN110003335A (en) VHH chain of CD47 single domain antibody, CD47 single domain antibody, nucleotide sequence and kit
CN109970858A (en) CD22 single domain antibody, nucleotide sequence and kit
JP6466397B2 (en) Protocol for identification and isolation of antigen-specific B cells and production of antibodies against the desired antigen
CN110003336A (en) PD-1 single domain antibody, nucleotide sequence and kit
JP2016536353A (en) Nanoantibody immunoadsorbent for aflatoxin, immunoaffinity column, preparation method thereof and application thereof
US20150276729A1 (en) Immunosorbent and immunoaffinity column for aflatoxin m1 nanobody and preparation method thereof
EP1773994B1 (en) Polypeptide
CN110105450A (en) VEGF single domain antibody, nucleotide sequence and kit
CN112111011B (en) Variable region sequence of specific anti-thiamethoxam antibody and recombinant full-length antibody thereof
CN114276445B (en) Rotavirus recombinant protein specific antibody, plasmid vector and method
CN116284401B (en) Human anti-IL-1R 3 antibody and application thereof
CN110003330A (en) TNF-α single domain antibody, nucleotide sequence and kit
CN109970855A (en) VHH chain of IL23 single domain antibody, IL23 single domain antibody, nucleotide sequence and kit
CN109942704A (en) HSA single domain antibody, nucleotide sequence and kit
JPWO2007114139A1 (en) Phage display with novel filamentous phage
CN113896793A (en) Anti-human IL-17RC monoclonal antibody and application thereof
CN110003334A (en) Polypeptide, CD19 single-domain antibody, preparation method thereof, nucleotide sequence and kit
CN114057881B (en) Anti-ketamine specific antibodies, plasmid vectors and methods
CN110981959A (en) CD47 single domain antibody, nucleotide sequence, expression vector and kit
CN117866100B (en) Single-domain antibodies or antigen-binding fragments thereof directed against D-dimer and related biomaterials and uses thereof
CN116987194B (en) Anti-idiotype nano antibody of mimic epitope peptide of human ST2 antigen and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: Room 605, building 1, Shenzhen Biomedical Innovation Industrial Park, 14 Jinhui Road, Jinsha community, Kengzi street, Pingshan District, Shenzhen, Guangdong 518000

Applicant after: Shenzhen prijin biopharmaceutical Co.,Ltd.

Address before: 518000 Building 402, Shenzhen Biomedical Innovation Industrial Park, No. 14 Jinhui Road, Kengzi Street, Pingshan District, Shenzhen City, Guangdong Province

Applicant before: SHENZHEN PREGENE BIOPHARMA Co.,Ltd.

GR01 Patent grant
GR01 Patent grant