CN111560070B - Antibody aiming at novel coronavirus NP protein and detection application thereof - Google Patents

Abstract

The invention discloses an antibody aiming at novel coronavirus NP protein and detection application thereof, wherein the antibody comprises an antigen complementarity determining region CDR1 of an antibody light chain variable region, and CDR2 and CDR3 are respectively SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO: 7; the antigen complementarity determining regions CDR1, CDR2 and CDR3 of the antibody heavy chain variable region are SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO: 3. The invention also discloses the preparation process of the antibody and the amino acid sequences of the heavy chain variable region and the light chain variable region of the antibody.

Description

Antibody aiming at novel coronavirus NP protein and detection application thereof

Technical Field

The invention belongs to the fields of cellular immunology and molecular biology, and relates to an antibody aiming at a novel coronavirus NP protein and a detection application thereof.

Background

The international committee for viral classification named the novel coronavirus SARS-CoV-2 and the world health organization named the pneumonia caused by infection with this virus COVID-19. The virus has strong infectivity and wide transmission path. The virus can adapt to the environment of human body rapidly, has transmission capability in latent period after infection, and reports by some asymptomatic infectors that virus nucleic acid is detected even in various animals. These factors complicate the control of the virus and no effective therapeutic drugs and vaccines are currently on the market.

SARS-CoV-2 belongs to the genus Coronavirus, is a single-stranded positive-strand RNA virus, has a size of about 30kb, has a similarity of 79% to SARS-CoV, and has a similarity of up to about 88% to a Coronavirus (CoV) isolated from Bats. SARS-CoV-2 has typical coronavirus characteristics, and the virus envelope has typical spinous processes, which are shaped like coronages. The Nucleocapsid is of a spiral symmetrical type, the main structural protein is Nucleocapsid Protein (NP), and the total length of the NP is 420 amino acids. The NP has the most content in virus structural protein, is expressed in a large amount in the early stage of host infection, has stronger immunogenicity, and can cause strong immune response of a host. Thus, NP can be used as the main target antigen for serological diagnosis of SARS-CoV-2 infection.

Because specific therapeutic drugs and effective vaccines are not developed successfully, early diagnosis becomes an important measure for preventing and controlling epidemic situations, and early nucleic acid diagnosis and clinical diagnosis become important basis for accurate diagnosis. Although the nucleic acid diagnosis speed is high, the influence of the quality of the sampling is large, false positive and false negative exist, and the implementation of the prevention and control measures is influenced. Nucleic acid detection of part of asymptomatic infected persons is negative in the late stage of the disease process, and missed diagnosis is easy to occur only by nucleic acid detection. Serological diagnosis is to detect the immune response of an organism after pathogen infection, the duration is long, the immune response is stable, and the immune response shows a dynamic change trend along with the progress of the disease course. Serodiagnosis is therefore also an important tool for early diagnosis and assessment of the current state of infection.

Disclosure of Invention

One of the technical problems to be solved by the present invention is to provide a monoclonal antibody or its derivatives such as antibody Fab fragment, single chain antibody, etc. against novel coronavirus.

The second technical problem to be solved by the present invention is to provide a DNA molecule or gene encoding the above antibody.

The third technical problem to be solved by the present invention is to provide a method for preparing the above antibody.

In order to solve the technical problems, the invention adopts the following technical scheme:

in a first aspect of the present invention, there is provided a monoclonal antibody against a novel coronavirus, or a derivative thereof, comprising a first variable region and a second variable region, wherein the first variable region is an antibody light chain variable region comprising the antigen complementarity determining region CDR1, CDR2 and CDR3 respectively comprising the amino acid sequence of SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO: 7; wherein the second variable region is an antibody heavy chain variable region having the antigen complementarity determining regions CDR1, CDR2 and CDR3 of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO: 3;

the derivatives of the monoclonal antibody include antibody Fab fragments, single chain antibodies, bispecific antibodies (bi-specific), and the like.

As a preferred embodiment of the present invention, the first variable region is an antibody light chain variable region, which is SEQ ID NO: 8; wherein said second variable region is an antibody heavy chain variable region represented by SEQ id no: 4.

As a preferred embodiment of the present invention, it comprises the antibody light chain variable region and the human antibody light chain constant region, and the hinge region, CH1 region, CH2 region and CH3 region of the antibody heavy chain variable region and the human antibody heavy chain constant region.

As a preferred embodiment of the present invention, the human antibody light chain constant region is derived from a human antibody kappa chain or antibody lamda chain, and the human antibody heavy chain constant region is derived from a human IgG1, IgG2, IgG3 or IgG4 subtype.

In a second aspect of the invention, there is provided a DNA molecule or gene nucleotide sequence encoding the monoclonal antibody or derivative thereof as hereinbefore described.

As a preferred embodiment of the present invention, the variable region of the antibody light chain is SEQ ID NO:18, and the variable region of the antibody heavy chain is SEQ ID NO: 17.

In addition, the invention includes sequences that specifically hybridize to any of the nucleotide sequences provided herein. The term "specifically hybridizes" refers to the ability of a nucleotide sequence to hybridize to at least 12, 15, 20, 25, 30, 35, 40, 45, 50, or 100 linked nucleotides of a sequence provided herein or of a sequence complement thereto, such that it has less than 15%, preferably less than 10%, and more preferably less than 5% background hybridization to a control nucleic acid (e.g., non-specific DNA or DNA other than the specific antibody sequence provided herein). Various hybridization conditions can be used to detect specific hybridization, and stringency is largely determined by the washing steps of the hybridization assay. In general, high temperatures and low salt concentrations produce high stringency, while low temperatures and high salt concentrations produce low stringency. Low stringency hybridization is achieved by washing at 50 ℃ in, for example, about 2.0 XSSC, and high stringency is achieved with about 0.2 XSSC at 50 ℃.

The nucleotides encoding the antibodies of the invention or derivatives thereof may contain leader or signal sequences. The leader and signal sequences may be varied and may be substituted with alternative leader sequences, and it will be understood that in certain embodiments, the antibodies of the invention contain sequences without leader sequences. Any suitable alternative preamble or signal sequence may be used.

In a third aspect of the invention, there is provided an expression vector comprising the DNA molecule/gene nucleotide sequence set forth above and expression control sequences operatively linked to the sequence.

In a fourth aspect of the invention, there is provided a recombinant host cell transformed with an expression vector as hereinbefore described.

The recombinant host cell or progeny thereof expresses the monoclonal antibody or derivative thereof as described above.

In a fifth aspect of the invention, there is provided a method of preparing a monoclonal antibody or derivative thereof as hereinbefore described, the method comprising the steps of:

a) providing an expression vector comprising the DNA molecule sequence as described above and an expression control sequence operably linked to the sequence;

b) transforming a host cell with the expression vector of step a);

c) culturing the host cell obtained in step b) under suitable conditions: and

d) and (3) separating and purifying the monoclonal antibody or the derivative thereof from the culture solution of the host cell.

In a sixth aspect of the invention, there is provided a composition comprising a monoclonal antibody or derivative thereof as hereinbefore described.

In a seventh aspect of the invention, there is provided a kit comprising a monoclonal antibody or derivative thereof as hereinbefore described. The kit also includes a diagnostic agent.

The diagnostic agent includes a detectable substance, examples of which include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radionuclides, positron emitting metals (for use in positron emission tomography), and nonradioactive paramagnetic metal ions. For metal ions that can be conjugated to antibodies for use as diagnostic agents, see generally US4,741,900. Suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; suitable prosthetic groups include streptavidin, avidin and biotin; suitable fluorescent materials include umbelliferone, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, and phycoerythrin; suitable luminescent materials include luminol; suitable bioluminescent materials include luciferase, luciferin and aequorin; radioisotopes, e.g.¹²⁵I、¹³¹I、¹¹¹In and⁹⁰Y、Lu¹⁷⁷bismuth, bismuth²¹³Californium²⁵²Iridium (III)¹⁹²And tungsten¹⁸⁸Rhenium¹⁸⁸、²¹¹Astatine, astatine,⁹⁹Tc。

The kits of the invention also include a label and instructions for administration.

The composition or kit of the invention as described above may further comprise a second monoclonal antibody or derivative thereof comprising heavy chain variable region CDR1, heavy chain variable region CDR2, heavy chain variable region CDR3, light chain variable region CDR1, light chain variable region CDR2, light chain variable region CDR 3; wherein the content of the first and second substances,

heavy chain variable region CDR1 comprises SEQ ID NO: 9;

heavy chain variable region CDR2 comprises SEQ ID NO: 10;

heavy chain variable region CDR3 comprises SEQ ID NO: 11;

light chain variable region CDR1 contains SEQ ID NO: 13;

light chain variable region CDR2 contains SEQ ID NO: 14;

light chain variable region CDR3 contains SEQ ID NO: 15;

preferably, the second monoclonal antibody or derivative thereof comprises a heavy chain variable region, a light chain variable region; wherein the heavy chain variable region comprises SEQ ID NO:12 and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO: 16.

In the eighth aspect of the invention, the application of the monoclonal antibody or the derivative thereof in preparing a novel coronavirus detection product is provided.

In the ninth aspect of the invention, the application of the monoclonal antibody or the derivative thereof in preparing a novel coronavirus infection diagnosis product is provided.

In a tenth aspect of the invention, there is provided the use of a composition as hereinbefore described in the manufacture of a product for the detection of a novel coronavirus.

The term "monoclonal antibody (mab)" as used herein refers to an immunoglobulin derived from a pure line of cells, having the same structural and chemical properties, and being specific for a single antigenic determinant. Monoclonal antibodies differ from conventional polyclonal antibody preparations (typically having different antibodies directed against different determinants), each monoclonal antibody being directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are also advantageous in that they are obtained by hybridoma or recombinant engineered cell culture, and are not contaminated with other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.

The terms "antibody" and "immunoglobulin" as used herein are heterotetrameric proteins of about 150000 daltons having the same structural features, consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies between heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has a variable domain (VH) at one end. Followed by a plurality of constant regions. Each light chain has a variable domain (VL) at one end and a constant domain at the other end; the constant region of the light chain is opposite the first constant region of the heavy chain, and the variable region of the light chain is opposite the variable region of the heavy chain. Particular amino acid residues form the interface between the variable regions of the light and heavy chains.

The term "variable" as used herein means that certain portions of the variable regions of an antibody differ in sequence, which results in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the antibody variable region. It is concentrated in three segments in the light and heavy chain variable regions that become Complementarity Determining Regions (CDRs) or hypervariable regions.

The more conserved portions of the variable regions are called Framework Regions (FR). The variable regions of the heavy and light chains of an antibody each comprise four FR regions, which are in a substantially β -sheet configuration, connected by three CDRs which form a connecting loop, and in some cases may form part of a β -sheet structure. The CDRs in each chain are held closely together by the FR region and form the antigen-binding site of the antibody together with the CDRs of the other chain (see Ka ba t et al, NIH Pu bl. No.91-3242, Vol. 1, 647, 669 (1991)). Antibody constant regions are not directly involved in binding of an antibody to an antigen, but they exhibit different effector functions, such as participation in antibody-dependent cellular cytotoxicity (ADCC) or complement-mediated toxicity (CDC) of an antibody.

The term "expression control sequence" as used herein generally refers to a sequence involved in controlling the expression of a gene. Expression control sequences include a promoter and a termination signal operably linked to a gene of interest. The gene (DNA) sequence encoding the antibody of the present invention can be obtained by conventional means well known to those skilled in the art, such as artificial synthesis of the protein sequence according to the present disclosure or amplification by PCR. The resulting DNA fragment may then be inserted into a suitable expression vector by a variety of methods well known in the art. The expression vector used in the present invention may be a commercially available expression vector known to those skilled in the art, such as pCDNA3.1 expression vector of Invitrogen corporation.

Suitable host cells for transformation with the host cells to which the expression vectors are administered generally include prokaryotic and eukaryotic cells. Examples of commonly used prokaryotic host cells include E.coli, Bacillus subtilis, and the like. Commonly used eukaryotic host cells include yeast cells, insect cells, mammalian cells, and the like.

After culturing the host cells transformed with the expression vector under suitable conditions (e.g., adherent or suspension culture in a cell culture flask or bioreactor in serum-free medium), the culture supernatant is harvested and then purified by conventional separation procedures or means well known to those skilled in the art, including protein-A affinity chromatography, ion exchange chromatography, filter sterilization, etc., to obtain the antibody of the present invention.

The purified antibody of the present invention can be dissolved in a suitable solvent such as a sterile physiological saline solution, and the solubility can be prepared to be between 0.01 and 100mg/ml, and the desired final solubility can be prepared to be between 1 and 20 mg/ml.

Drawings

FIG. 1 shows a SDS-PAGE pattern of the recombinant SARS-CoV 2NP protein of the present invention;

FIG. 2 is a graph showing the results of detection of antibody titer by indirect ELISA;

FIG. 3 is a graph showing the results of detecting the binding of an antibody to an antigen using WB;

FIG. 4 shows the results of the affinity activity of JS01 detected by SPR;

FIG. 5 shows the results of the affinity activity of JS02 detected by SPR;

FIG. 6 is a graph showing the results of detecting the affinity activity of JS03 using SPR;

FIG. 7 is a graph showing the results of detecting the affinity activity of JS04 using SPR;

FIG. 8 is a graph showing the results of detecting the affinity activity of JS05 using SPR;

FIG. 9 is a graph showing the results of detecting the affinity activity of JS06 using SPR;

FIG. 10 is a graph showing the results of detecting the affinity activity of JS07 using SPR;

FIG. 11 is a graph showing the results of detecting the affinity activity of JS08 using SPR;

FIG. 12 is a graph showing the results of detecting the affinity activity of JS09 using SPR;

FIG. 13 is a graph showing the results of detecting the affinity activity of JS10 using SPR;

FIG. 14 is a graph showing the results of detecting the affinity activity of JS11 using SPR;

FIG. 15 is a graph showing the results of detecting the affinity activity of JS12 using SPR;

FIG. 16 is a graph showing the results of detecting the affinity activity of JS13 using SPR;

FIG. 17 is a graph showing the results of detecting the affinity activity of JS14 using SPR;

FIG. 18 is a graph showing the results of detecting the affinity activity of JS15 using SPR;

FIG. 19 is a graph showing the results of detecting the affinity activity of JS16 using SPR;

FIG. 20 is a graph showing the results of measuring the antibody coating concentration by the double antibody sandwich method;

FIG. 21 is a graph showing the results of detection sensitivity of antibodies by the double antibody sandwich method;

FIG. 22 is a graph showing the detection effect of the antigen detection chromatographic strip of the present invention.

Detailed Description

The invention is further illustrated by the figures and examples. It should be understood that the examples of the present invention are for illustrative purposes and not intended to limit the present invention. Simple modifications of the invention in accordance with its spirit fall within the scope of the claimed invention.

Example 1 antibody screening

Expression of recombinant SARS-CoV2 Nucleoprotein (NP)

1.1 Primary reagents

The SARS-CoV 2NP gene sequence (GenBank sequence number: MT066176.1) and the related primer synthesis and sequencing are all completed by general biological systems (Anhui) limited company; coli DH5 α, BL21(DE3) competent cells were purchased from general biosystems (anhui) ltd; BamHI and NotI endonucleases were purchased from New England Biolabs (NEB); EX Taq enzyme was purchased from TaKaRa; HRP-labeled anti-human Fc antibody was purchased from Sigma; other chemical reagents are domestic analytical pure reagents; serum from 2019-nCoV infected patients was collected and stored in the center.

1.2 prokaryotic expression plasmid construction

Designing a prokaryotic expression primer of the NP gene, wherein an upstream primer is provided with a BamH I restriction site, and a downstream primer is provided with a Not I restriction site. The primer sequence is as follows: cov2-NP-F: CGGGATCCTCTGATAATGGACCCCAAAATC; cov2-NP-R: ATAAGAATGCGGCCGCAGGCCTGAGTTGAGTCAGCAC. The NP gene was amplified using EX Taq enzyme, and the PCR reaction program was: 3min at 94 ℃; 30 cycles of 94 ℃ for 30s,58 ℃ for 30s and 72 ℃ for 80 s; 10min at 72 ℃. And recovering a 1300 bp target fragment from the PCR product by using glue, performing double enzyme digestion on the PCR product by using BamH I and Not I, connecting the PCR product with a pET28a vector, and transforming E.coli DH5 alpha competent cells. After single colony is selected the next day and sequenced correctly, the quality-improved particles are transformed into prokaryotic expression bacterium E.coli BL21(DE3) competent cells.

1.3 NP expression and purification

Culturing NP expressing strain until OD600 is 0.6, adding IPTG with final concentration of 0.5mmol/L, inducing at 16 deg.C for 6h, collecting thallus, ultrasonic crushing, and centrifuging to collect inclusion body. The inclusion bodies were dissolved in 8mol/L urea and then purified by nickel column affinity chromatography. After purification, the urea content is reduced in a gradient manner, the protein is dialyzed and renatured into PBS, and finally the protein expression and purification effects are detected by SDS-PAGE. After the small amount of fermentation is finished, the mixture is put into a 100L fermentation tank for mass fermentation, the fermentation medium is a TB medium (1% glycerol), the fermentation parameter is 280rpm, the aeration ratio is 0.5vvm (15L/min), the pH is controlled to be 6.8-7.2, the tank pressure is 0.06 MPa-0.1 MPa, the fermentation temperature is 16 ℃, and the mixture is cultured for 24 hours.

The SDS-PAGE results showed: the total length of the NP plus His tag and other additional amino acids in the vector predicted that the protein had a relative molecular mass of about 50X 10³. Watch (A)After the induction of the Dajun bacteria by IPTG, the expression level is found to be 50 multiplied by 10³There is a clear band around, consistent with the expected molecular weight size (FIG. 1A). After the inclusion body is dissolved, the inclusion body is purified by a nickel column, and an obvious elution peak is obtained when the concentration is 150mmol/L imidazole. After the proteins were renatured by dialysis, a single protein band was found to appear at the same position by SDS-PAGE (FIG. 1B). This indicates that the NP was successfully induced and purified to a higher degree. Note: in the figure, M: proteins, Makers; 1: uninduced pET28a-NP expressing bacteria; 2: pET28a-NP recombinant expression bacteria after IPTG induction; 3: and (4) purifying to obtain the recombinant nucleocapsid protein.

Second, phage library construction

1. Collecting peripheral blood of patient with COVID-19 in convalescent period, and separating mononuclear cells (PBMC) from the peripheral blood

In the project, 20ml of each peripheral blood of 5 COVID-19 patients before discharge is collected after informed consent on 14 days 2 months 2 in 2020. Mononuclear Cells (PBMC) were separated from 20ml of heparin anticoagulated using GE Ficoll-Paque PLUS by density gradient centrifugation.

2. Extraction of RNA and cDNA Synthesis in PBMC

PBMC cell RNA was extracted using the RNeasy Mini Kit from QIAGEN, and then the RNA was reverse-transcribed into cDNA using the First Strand Synthesis Kit from Roche (Transcriptor First Strand cDNA Synthesis Kit, Roche, Cat No.: 04896866001).

3. PCR amplification of VK, VL and VH (EX Taq, Takara, Cat No.: DRR001A)

(1) The amplification VK & VL system is shown in Table 1.

TABLE 1 amplification VK & VL system

Solutions or compositions	Volume (μ L)
		cDNA	1
EX Buffer(10x)	5
		dNTPs(10mM each)	4
P1(10μM)	2
		P2(10μM)	2
EX Taq 1U/μl	0.3
		dH2O	35.7

(2) The amplified heavy chain Fd fragment system is shown in Table 2.

TABLE 2 amplification of heavy chain Fd segment systems

Solutions or compositions	Volume (μ L)
		cDNA	2
EX Buffer(10x)	10
		dNTPs(10mM each)	8
P1(10μM)	2
		P2(10μM)	2
EX Taq 1U/μl	0.6
		dH2O	75.4

(3) The reaction sequence is shown in table 3.

TABLE 3 reaction procedure

The PCR product was electrophoresed through 2% agarose gel, and a fragment of about 750bp was recovered.

4. Cloning of the light chain (cloning VK and VL into pComb3H vector)

VK and VL were digested with XbaI and SacI and ligated with pComb3H vector, which was also digested with XbaI and SacI, and the ligation product was recovered and then transfected into XL1-Blue competent cells.

And (3) coating the electric shock bacterium liquid on a 15cm large plate, scraping the bacterium the next day, and obtaining the quality-improved particles, namely the light chain library. The recombinant plasmids were pComb3H-VK and pComb3H-VL at this time.

5. Heavy chain cloning (cloning VH Gene into pComb3H-VK and pComb3H-VL light chain Bank)

The light chain library pComb3-L and Fd fragments are respectively subjected to double enzyme digestion by XhoI and SpeI, are connected with pComb3H-VK and pComb3H-VL which are also subjected to double enzyme digestion by XhoI and SpeI, and are then electrically transformed to obtain the antibody library.

6. Packaging of antibody libraries

(1) Taking out the antibody library from a refrigerator at the temperature of-80 ℃, melting on ice, adding 1ml of the antibody library into 10ml of A + (20 mu g/ml)2YT culture medium, and shaking at the temperature of 37 ℃ and 200rpm for 1 hour;

(2) adding 100ml of A + (100. mu.g/ml), T + (20. mu.g/ml) 2YT medium, and shaking at 200rpm for 1 hour;

(3) plus 10¹²pfu VCSM13 helper phage, standing at 37 deg.C for 20min, shaking at 200rpm for 2 hr;

(4) adding 70 mu g/ml kanamycin at 30 ℃ and shaking at 200rpm overnight;

(5) centrifuging at 6000rpm for 20min the next day, pouring out the supernatant, adding 4% PEG8000(4g) and 3% NaCl (3g), mixing, and placing on ice for more than 30 min;

(6) and subpackaging in a 50ml centrifuge tube, centrifuging at 9000rpm for 25min, removing supernatant, draining, and resuspending the precipitate with 1ml PBS to obtain the packaged library.

Screening of phage library

1. The recombinant SARS-CoV2 Nucleoprotein (NP) was coated in an immune tube, 3 tubes were coated at 50. mu.g/tube, and left overnight at 4 ℃ with 2% skim milk for the next day to block the immune tube for 1 h.

2. 1.75ml of PBS containing 2% skim milk and 250. mu.l of the phage library were added to the tube, shaken at 37 ℃ for 1h, and then allowed to stand at 37 ℃ for 1 h.

3. The phage library was inverted and washed 20 times with PBST, 5min each.

4. The tube was eluted with 1ml Gly-HCl pH 2.2, left to stand at room temperature for 5min, shaken at 37 ℃ for 5min, then pipetted into a 1.5ml EP tube and neutralized to pH 7 with 57 μ l 2M Tris.

5. The eluate was transferred to a new 50ml centrifuge tube and 10ml of OD 1 fresh XL1-Blue was added immediately, mixed well and incubated at 37 ℃ for 30min, 10ml of 2YT (Amp 100. mu.g/ml, Tet 20. mu.g/ml) was added.

6. Mu.l of the broth was used to determine the volume of the elution pool, and 20ml of the remaining medium was poured into a 500ml Erlenmeyer flask and shaken at 230rpm for 1 hour.

7. 130ml of 2YT (Amp 100ug/ml, Tet 20. mu.g/ml) were added, shaken at 230rpm for 1 h.

8. The helper phage with MOI 20 was added and incubated at 37 ℃ for 30 min.

9. Centrifuge at 3000g for 10min, resuspend pellet into 150ml 2YT (Amp 100. mu.g/ml, Tet 20. mu.g/ml), shake at 37 ℃ at 230rpm for 2 h.

10. 110. mu.l of 70mg/ml kanamycin was added, and 30 ℃ overnight at 230 rpm. Adding 1/5 volume of PEG-NaCl (40ml) the next day, mixing, ice-cooling for at least 1h, centrifuging at 10000g and 4 deg.C for 20min, suspending the precipitate in 2-3ml PBS, centrifuging instantaneously to remove bacteria, and filtering with 0.45 μm filter for the next round of screening.

11. Repeating the screening step for 3 times to achieve the purpose of enriching and screening the phage library.

12. After the third round of enrichment, 2 x 96 clones were picked. After IPTG induction, ELSA detection was performed the next day.

Four, ELISA detection of 2 x 96 clones binding specificity

1.2 pieces of anti-human Fab antibody (1:3000) and 2 pieces of NP protein (2. mu.g/ml) were coated separately and left overnight at 4 ℃.

2. The next day was blocked with 3% skim milk for 1h, then 50. mu.l of induction supernatant and 50. mu.l of skim milk were added, incubated at 37 ℃ for 1h, and washed with PBST.

3. HRP-labeled anti-human Fab antibody (1:3000) was added to each of the 4 plates, incubated at 37 ℃ for 1h, washed with PBST, and then TMB developed.

178 phage antibody fragments which can be specifically combined with NP are obtained through screening, and the fragments are Fab fragments of human origin, including full-length light chain and Fd fragment of heavy chain. 178 single colonies were amplified and sequenced to obtain 159 strains of complete and qualified sequences.

Example 2 expression of full antibodies and related functional validation

Finally selecting 16 antibodies from the 159 antibodies for expression of the whole antibody and relevant function verification, and naming the 16 antibodies as JS01-JS 16.

Wherein the JS13 antibody sequence is shown as follows:

the amino acid sequence of CDR1 in the heavy chain variable region is shown in SEQ ID NO. 1;

the amino acid sequence of CDR2 in the heavy chain variable region is shown in SEQ ID NO. 2;

the amino acid sequence of CDR3 in the heavy chain variable region is shown in SEQ ID NO. 3;

the amino acid sequence of CDR1 in the variable region of the light chain is shown in SEQ ID NO. 5;

the amino acid sequence of CDR2 in the variable region of the light chain is shown in SEQ ID NO. 6;

the amino acid sequence of CDR3 in the variable region of the light chain is shown in SEQ ID NO. 7;

the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 4, and the nucleic acid sequence is shown as SEQ ID NO. 17; the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 8, and the nucleic acid sequence is shown as SEQ ID NO. 18.

The JS08 antibody sequence is shown below:

the amino acid sequence of CDR1 of the heavy chain variable region is shown in SEQ ID NO. 9;

the amino acid sequence of CDR2 of the heavy chain variable region is shown in SEQ ID NO. 10;

the amino acid sequence of CDR3 of the heavy chain variable region is shown in SEQ ID NO. 11;

the amino acid sequence of CDR1 in the variable region of the light chain is shown in SEQ ID NO. 13;

the amino acid sequence of CDR2 in the variable region of the light chain is shown in SEQ ID NO. 14;

the amino acid sequence of CDR3 in the variable region of the light chain is shown in SEQ ID NO. 15.

The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 12; the amino acid sequence of the light chain variable region is shown in SEQ ID NO 16.

1. Full antibody expression

The 16-strain humanized antibody is constructed into an IgG-type humanized whole molecule antibody, expressed in 293F cells and purified by Protein A for later use.

2. ELISA (enzyme-Linked immuno sorbent assay) for detecting binding specificity of 16-strain antibody and recombinant NP

Recombinant NPs were coated onto ELISA plates with PBS at a concentration of 1. mu.g/ml, all antibody concentrations were diluted to 1mg/ml, then diluted in multiples starting at 1:10000 and incubated at 37 ℃ for 30 min. Then PBST was washed 3 times, HRP-labeled anti-human IgG (1:5000) was added, and after incubation at 37 ℃ for 30min, PBST was washed 3 times, then TMB was developed, and OD450 absorbance values were read after termination.

The dilution titer of the 16 NP antibody was measured by indirect ELISA, and the average OD value of the negative control was 0.119 with a standard deviation of 0.132, so that the cutoff value was defined as

The detection titer of the 16-strain antibody was judged to be between 1:80000 and 1:1280000 (FIG. 2).

3. Western Blot results of 16 antibodies and purified NP

Mu.g of the recombinant NP was electrophoresed by SDS-PAGE, transferred to a PVDF membrane, incubated with the above 16 antibodies (0.5. mu.g/ml) at 37 ℃ for 1h, washed 3 times with PBST, then incubated with HRP-labeled anti-human IgG (1:5000) for 30min, washed 3 times with PBST, and then developed on the membrane with DAB.

WB experimental results showed that 16 antibodies were able to specifically bind to recombinantly expressed Nucleoprotein (NP) and a distinct band of color appeared at 50kDa, suggesting that the group of antibodies were all linear epitope antibodies (fig. 3).

4. Antibody affinity activity detection

The antibody affinity determination is completed by a Biacore T200 workstation and is carried out according to the following steps: the CM5 chip was first activated with amino-coupled activators NHS and EDC at 10. mu.l/min for 300s, then the recombinantly expressed SARS-CoV-2NP was diluted to 1ug/mL with 10mM sodium acetate buffer (pH5.5), the Response values (RUs) were brought to around 600 by flowing 10. mu.l/min through the chip for 30s, and finally 10. mu.l/min, 420s were set, and the remaining activated sites on the chip surface were blocked with ethanolamine. Serially diluted antibodies were sequentially injected at 25 ℃ at a flow rate of 30. mu.l/min, and after each concentration measurement, CM5 chips were regenerated with glycine-hydrochloric acid of pH 2.0, and then subjected to the next concentration measurement. After the experiment was completed, binding affinity was obtained by global fitting of the curve using Biacore T200 Evaluation Software.

The experimental results are shown in FIGS. 4-19, JS01-JS16 can efficiently bind to SARS-CoV-2NP protein, and the parameters related to the affinity activity are shown in Table 4.

TABLE 4 antibody affinity parameters

Name of antibody	Amount of ligand coupling	ka(1/Ms)	Kd(1/s)	KD(M)
					JS01	102RU	2.18E+06	4.79E-04	2.20E-10
JS02	162RU	9.12E+05	5.83E-05	6.39E-11
					JS03	102RU	8.97E+05	2.12E-04	2.36E-10
JS04	162RU	7.15E+04	1.91E-04	2.67E-09
					JS05	162RU	5.94E+05	2.43E-04	4.09E-10
JS06	136RU	1.61E+05	0.002576	1.61E-08
					JS07	110RU	1.44E+06	1.78E-04	1.24E-10
JS08	162RU	3.03E+04	5.77E-06	1.90E-10
					JS09	129RU	6.89E+05	4.79E-05	6.94E-11
JS10	136RU	1.47E+06	2.99E-04	2.04E-10
					JS11	110RU	1.93E+05	5.62E-05	2.92E-10
JS12	110RU	4.88E+05	7.33E-05	1.50E-10
					JS13	110RU	8.05E+05	9.66E-05	1.20E-10
JS14	136RU	1.24E+06	2.21E-04	1.78E-10
					JS15	110RU	7.72E+04	1.22E-04	1.58E-09
JS16	136RU	2.68E+05	4.01E-05	1.50E-10

5. Antibody pairing assay

5.1 determination of antibody coating concentration

(1) Mu.l of JS12 antibody was diluted from 5. mu.g/ml to 0.0024. mu.g/ml for 12 dilutions before being coated in ELISA plates. Coating at 4 deg.C overnight, blocking with 1% BSA for 2h, and washing with PBST for 3 times.

(2) 50ng of recombinant NP was added to the first well of each coating concentration, then diluted in multiples to 0.39 ng/well for 8 dilutions, incubated for 1h at 37 ℃ and washed 3 times with PBST.

(3) Adding HRP marked JS08 diluted at 1:1000, incubating for 1h at 37 ℃, PBST washing for 3 times, and reading the OD450nm absorbance value after TMB color development.

As can be seen from the graph in FIG. 20, the amount of the coated antibody has an effect on the detection sensitivity, and the amount of the coating from 5. mu.g/ml to 0.00245. mu.g/ml is not so much affected, and the sensitivity for detecting the NP antigen is less than 3.9 ng/ml. Therefore, in all subsequent pairing experiments, we chose a concentration of 2. mu.g/ml as the antibody coating and 1:4000 as the dilution of the enzyme-labeled antibody.

5.2 double antibody Sandwich method for detecting NP

(1) 16 NP antibodies JS01-JS16 were coated on ELISA plates at 2. mu.g/ml, coated overnight at 4 ℃, blocked with 1% BSA for 2h the next time, and washed with PBST for 3 times.

(2) 0.1. mu.g/ml recombinant NP protein was added, then diluted in multiples to 0.78ng/ml for 8 dilutions, incubated at 37 ℃ for 1h, and washed 3 times with PBST.

(3) HRP-labeled JS08(1:1000) was added, incubated at 37 ℃ for 1h, PBST washed 3 times, TMB developed, and OD450nm absorbance values were read.

As can be seen from FIG. 21, enzyme-labeled JS08 cannot pair with JS06, JS11 and JS08 per se, but can pair with other 13 NP antibodies for double antibody sandwich NP detection. The JS08 and JS16 have the best matching effect, the detection limit can reach below 0.78ng/ml, and the detection limit of other matched antibodies is 12.5-1.56 ng/ml.

6. Sensitivity of double-antibody sandwich immunochromatography for detecting recombinant NP

The anti-JS 08 monoclonal antibody is coated on a nitrocellulose membrane to form a T line, and the anti-human IgG antibody is marked to the C line. After the NP protein is diluted in series, 50 mu L of the NP protein is added into a sample hole, JS01-JS16 antibodies of the labeled colored microspheres on a binding pad under the sample hole and the NP form an immune complex, then the immune complex is migrated to a T line through chromatography, and the T line is combined and fixed with the labeled antibodies to form a colored T line. And the redundant humanized monoclonal antibodies are continuously transferred to the C line and combined with the anti-human antibodies to form the C line. This was used to determine the binding sensitivity to NP.

Respectively matching the JS08 antibody marked by the colored microspheres with the 13 strains of antibodies to prepare the antigen detection chromatographic strip. When the test strip is verified by using 2ng/ml of recombinant NP, all chromatographic strips can see a remarkable detection T line and a quality control C line is also very remarkable (FIG. 22). This indicates that both 13 pairs of antibody combinations can be used to detect nucleoproteins of the novel coronavirus with a limit of detection of less than 2 ng/ml.

Although only specific embodiments of the present invention have been described above, it will be understood by those skilled in the art that these are by way of illustration only, and that the scope of the invention is defined by the appended claims. Various changes or modifications to these embodiments may be made by those skilled in the art without departing from the principle and spirit of the invention, and these changes or modifications are within the scope of the invention.

Sequence listing

<110> center for disease prevention and control in Jiangsu province (public health research institute in Jiangsu province)

<120> antibody against novel coronavirus NP protein and detection application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Gly Gly Thr Phe Ser Ser Tyr Ala

1 5

<210> 2

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Ile Ile Pro Ile Phe Gly Thr Ala

1 5

<210> 3

<211> 24

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Ala Arg Gly Gly Trp Val Ile Cys Ser Ser Thr Ser Cys Tyr Thr Lys

1 5 10 15

Tyr Ser Tyr Tyr Gly Met Asp Val

20

<210> 4

<211> 131

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Trp Val Ile Cys Ser Ser Thr Ser Cys Tyr Thr Lys

100 105 110

Tyr Ser Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr

115 120 125

Val Ser Ser

130

<210> 5

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Ser Ser Asn Ile Gly Asn Asn Tyr

1 5

<210> 6

<211> 3

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Asp Asn Asn

1

<210> 7

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Gly Thr Trp Asp Ser Ser Leu Ile Ala Arg Leu

1 5 10

<210> 8

<211> 110

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly Gln

1 5 10 15

Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn

20 25 30

Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu

35 40 45

Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu Gln

65 70 75 80

Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Ser Ser Leu

85 90 95

Ile Ala Arg Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210> 9

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Gly Gly Ser Ile Ser Ser Tyr Tyr

1 5

<210> 10

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Ile Tyr Tyr Ser Gly Ser Thr

1 5

<210> 11

<211> 15

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Ala Arg Glu Gln Phe Ser Gly Gly Asp Tyr Glu Gly Phe Asp Phe

1 5 10 15

<210> 12

<211> 121

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Gln Val Gln Leu Val Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Glu

1 5 10 15

Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr

20 25 30

Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Asn Ile Tyr Tyr Ser Gly Ser Thr Asp Tyr Asn Pro Ser Leu Lys

50 55 60

Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu

65 70 75 80

Arg Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Glu Gln Phe Ser Gly Gly Asp Tyr Glu Gly Phe Asp Phe Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 13

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Ser Ser Asn Ile Gly Ala Gly Tyr Asp

1 5

<210> 14

<211> 3

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 14

Gly Asn Ser

1

<210> 15

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 15

Gln Ser Tyr Asp Ser Ser Leu Ser Gly Trp Val

1 5 10

<210> 16

<211> 111

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 16

Gln Ser Val Leu Thr Gln Glu Pro Ser Val Ser Gly Ala Pro Gly Gln

1 5 10 15

Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly

20 25 30

Tyr Asp Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu

35 40 45

Leu Ile Tyr Gly Asn Ser Asn Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser Ser

85 90 95

Leu Ser Gly Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210> 17

<211> 393

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60

tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac agcaaactac 180

gcacagaagt tccagggcag agtcacgatt accgcggacg aatccacgag cacagcctac 240

atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagaggaggt 300

tgggtgattt gtagtagtac cagctgctac actaagtact cctactacgg tatggacgtc 360

tggggccaag ggaccacggt caccgtctcc tca 393

<210> 18

<211> 330

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cagagcgtgc tcacgcagcc gccctcagtg tctgcggccc caggacagaa ggtcaccatc 60

tcctgctctg gaagcagctc caacattggg aataattatg tatcctggta ccagcagctc 120

ccaggaacag cccccaaact cctcatttat gacaataata agcgaccctc agggattcct 180

gaccgattct ctggctccaa gtctggcacg tcagccaccc tgggcatcac cggactccag 240

actggggacg aggccgatta ttactgcgga acgtgggata gcagcctgat tgcccggttg 300

ttcggcggag ggaccaagct gaccgtccta 330

Claims (15)

1. A monoclonal antibody against a novel coronavirus NP protein, comprising a first variable region and a second variable region, wherein the first variable region is an antibody light chain variable region having the amino acid sequences of the antigen complementarity determining regions CDR1, CDR2 and CDR3 as set forth in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 is shown in the specification; wherein the second variable region is an antibody heavy chain variable region having the amino acid sequences of the antigen complementarity determining regions CDR1, CDR2 and CDR3 set forth in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively.

2. The monoclonal antibody of claim 1, wherein the first variable region is an antibody light chain variable region as set forth in SEQ ID NO: 8; the second variable region is an antibody heavy chain variable region which is represented by SEQ ID NO: 4.

3. The monoclonal antibody according to claim 1 or 2, wherein the monoclonal antibody comprises the antibody light chain variable region and a human antibody light chain constant region, and the hinge, CH1, CH2 and CH3 regions of the antibody heavy chain variable region and a human antibody heavy chain constant region.

4. The monoclonal antibody of claim 3, wherein the human antibody light chain constant region is from a human antibody kappa chain or antibody lamda chain and the human antibody heavy chain constant region is from a human IgG1, IgG2, IgG3 or IgG4 subtype.

5. A DNA molecule encoding the monoclonal antibody of any one of claims 1-4.

6. The DNA molecule of claim 5, wherein the nucleotide sequence of the variable region of the antibody light chain is SEQ ID NO:18, the nucleotide sequence of the heavy chain variable region of the antibody is SEQ ID NO: shown at 17.

7. An expression vector comprising the DNA molecule sequence of claim 5 or 6 and expression control sequences operatively linked thereto.

8. A recombinant host cell transformed with the expression vector of claim 7.

9. The recombinant host cell according to claim 8, wherein the recombinant host cell or progeny cells thereof express the monoclonal antibody of any one of claims 1-4.

10. A method of producing the monoclonal antibody of any one of claims 1-4, comprising the steps of:

a) providing an expression vector comprising the DNA molecule sequence of claim 5 or 6 and an expression control sequence operably linked to said sequence;

b) transforming a host cell with the expression vector of step a);

c) culturing the host cell obtained in step b) under suitable conditions: and

d) separating and purifying from the culture solution of the host cell to obtain the monoclonal antibody.

11. A composition or kit comprising the monoclonal antibody of any one of claims 1-4; the composition or kit further comprises a second monoclonal antibody comprising heavy chain variable region CDR1, heavy chain variable region CDR2, heavy chain variable region CDR3, light chain variable region CDR1, light chain variable region CDR2, light chain variable region CDR 3; wherein the content of the first and second substances,

the amino acid sequence of CDR1 of the heavy chain variable region is set forth in SEQ ID NO:9 is shown in the figure;

the amino acid sequence of CDR2 of the heavy chain variable region is set forth in SEQ ID NO:10 is shown in the figure;

the amino acid sequence of CDR3 of the heavy chain variable region is set forth in SEQ ID NO:11 is shown in the figure;

the amino acid sequence of CDR1 of the light chain variable region is set forth in SEQ ID NO:13 is shown in the figure;

the amino acid sequence of CDR2 of the light chain variable region is set forth in SEQ ID NO:14 is shown in the figure;

the amino acid sequence of CDR3 of the light chain variable region is set forth in SEQ ID NO: shown at 15.

12. The composition or kit of claim 11, wherein the second monoclonal antibody comprises a heavy chain variable region, a light chain variable region; wherein the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO:12, the amino acid sequence of the light chain variable region is shown as SEQ ID NO: shown at 16.

13. Use of the monoclonal antibody of any one of claims 1-4 for the preparation of a novel coronavirus detection product.

14. Use of the monoclonal antibody of any one of claims 1-4 for the preparation of a novel diagnostic product for coronavirus infection.

15. Use of a composition according to claim 11 or 12 for the preparation of a product for the detection of a novel coronavirus.

Images