CN109943664A - A kind of 3 rapid detection method of pig circular ring virus and its kit - Google Patents

Abstract

The invention discloses a kind of 3 rapid detection method of pig circular ring virus and its kits, 3 quick detection kit of pig circular ring virus includes: probe molecule solutions, polystyrene nanospheres solution, positive control plasmid, negative control, wherein the structure of the probe molecule are as follows: reporter fluorescence group-tcaagcagcagctcggattctgac.The detection method of PCV-3 used in the present invention is low in cost, the ELISA detection reagent using expensive PCR instrument and valuableness is not needed, only need simple fluorescence detection device that the detection and analysis of result can be realized, detection time is short, high sensitivity, it can be widely applied to scene, clinical or laboratory testing, especially pig farm on-site test.

Description

A kind of 3 rapid detection method of pig circular ring virus and its kit

Technical field:

The invention belongs to field of biotechnology, and in particular to 3 rapid detection method of pig circular ring virus and its kit.

Background technique:

Pig circular ring virus (Porcine circovirus, PCV) belongs to circovirus section, Circovirus, is a kind of nothing The sub-thread cyclic DNA virus of cyst membrane and presently found the smallest animal virus.Mainly there are three genes for pig circular ring virus Type, i.e. PCV1, PCV2 and PCV3.Wherein, PCV1 is a kind of conventional viral that can infect pig, to pig no pathogenicity.PCV2 in Report for the first time within 1998, to pig have it is pathogenic, clinically mainly cause pmws (PMWS), Breeding difficulty, respiratory tract and intestines problem and dermatitis-nephrotic syndrome (PDNS), cause great to global pig breeding industry Economic loss.In June, 2015, it is more with sow anorexia, skin presentation that an example has occurred in North Carolina pig farm Stove papule and spot produce the epidemic disease that the scorching pigskins such as stillborn foetus and the mummification of fetus, nephrotic syndrome and breeding difficulty are main feature, R.Palinski etc. passes through macro gene order-checking and heredity from illness sow and aborted fetus vivo detection to a kind of new virus Evolutionary analysis is classified as a kind of novel pig circular ring virus, is named as 3 type of pig circular ring virus (PCV-3).PCV-3 not yet divides at present It is pathogenic also not furtherd investigate from success.Molecule Epidemiology Investigation the result shows that, PCV-3 in U.S. swinery extensively It is popular.2016-2017, China have 12 provinces (Anhui, Fujian, Hebei, Henan, Shandong, Guangdong, Hubei, Hunan, rivers Soviet Union, Jiangxi, Liaoning and Zhejiang) and the pig farm of a municipality directly under the Central Government (Chongqing) detect the presence of PCV-3 in succession.PCV-3 genome Overall length is 2000bp, contains 3 open reading frame (ORFs), and wherein ORF1 encodes the replicase (Rep) containing 296 amino acid The capsid protein (Cap) containing 214 amino acid is encoded with ORF2.In addition there are one open reading frame ORF3.

3 type of pig circular ring virus is as a kind of novel pig circular ring virus, at present in the geographical distribution in China, popularity, group It is still not fully aware of to knit tropism, pathogenesis and source.For this purpose, establishing early stage rapid detection method to 3 type of pig circular ring virus Research, prevention and control have a very important significance.Currently, the method that pig circular ring virus is commonly detected in laboratory has virus Isolation technics, immunology diagnosis technology (Immunohistochemical detection, immunofluorescence, enzyme-linked immunosorbent assay etc.) and molecule are raw Object detection technique (Standard PCR and real-time fluorescence PCR etc.).Traditional virus purification and immunological detection method, there are time-consumings Long, many deficiencies such as high to testing staff's technical requirements, complicated for operation and sensibility is poor；Standard PCR is complicated for operation, needs to carry out Gel electrophoresis analysis, and sensitivity is low；Real-time fluorescence PCR, which need to use, relies on standard curve progress quantitative detection, and sensitivity is still It has some limitations.Li Zhuoxin etc. establishes the real time fluorescence quantifying PCR method of quantitative detection PCV3, this method specificity By force, with the equal no cross reaction of PRRSV, FMDV, JEV, PCV2 and PRV, sensibility is 4.24 × 10¹Copy/μ l, compares Standard PCR Method is 10 times high, is detected using 155 part pig lung tissues of the real time fluorescence quantifying PCR method to acquisition, positive rate is 36.13%, higher than the 32.25% of regular-PCR positive rate, still, the realization of this method depends on fluorescence quantitative PCR instrument Device, it is expensive, be not suitable for promoting the use on a large scale in base's detection.The invention applied by China Inst. of Quarantine Inspection Sciences Patent CN201810962553.3 discloses 3 type droplet digital pcr detection primer of pig circular ring virus and probe and its application.This hair The bright cap gene order to all known 183 PCV3 is analysed and compared, and area without secondary structure and highly conserved is selected The design of Duan Jinhang primer and probe avoids the generation of false negative result.Provided primer and probe is to without PCV3 It detects sample standard deviation to occur without amplified signal, shows it with good specificity, it can be achieved that accurate detection to PCV3, sensitivity It can reach 1.6 copies.And this method also relies on expensive instrument, and higher for the operation level requirement of technical staff.

Summary of the invention:

Based on the deficiency of existing 3 type detection method of pig circular ring virus, the present invention is intended to provide a kind of 3 type of pig circular ring virus Rapid detection method and its kit solve the problems, such as that the detection method of 3 type of pig circular ring virus in the prior art is at high cost.

To achieve the purpose of the present invention, the technical problems existing in the prior art are solved, present invention employs following technologies Scheme:

A kind of PCV-3 quick detection kit, the PCV-3 quick detection kit include: probe molecule solutions, polyphenyl Ethylene nanosphere solution, positive control plasmid, negative control, wherein the structure of the probe molecule are as follows: reporter fluorescence group- tcaagcagcagctcggattctgac(SEQ ID NO:1)。

Wherein, the polystyrene nanospheres are prepared by following methods: by 0.05g ammonium persulfate and 0.05g ten Dialkyl sulfonates are dissolved into 10mL water, add 12mL styrene, by reactant heat a period of time, then by product from The heart is rinsed with methanol and removes SDS, obtains polystyrene nanospheres.

Wherein the negative control uses deionized water or SPF Swine serum, preferably deionized water.

Wherein the positive controls are by PCV3 REP CDS gene sequence that is artificial synthesized or obtaining through PCR amplification The Partial Fragment of column is cloned into the pMD18-T-PCV-3 plasmid constructed on pMD18-T plasmid, and the nucleotide sequence of the segment is such as Shown in SEQ ID NO:2.

The target gene fragment that 312bp is amplified using PCV-3 specific primer PCV-3F/PCV-3R, by target gene Segment is cloned into building pMD18-T-PCV-3 plasmid on pMD18-T plasmid, the digestion products obtained through double digestion and expected phase Symbol compares after pMD18-T-PCV-3 sequencing with the ncbi PCV-3 DNA sequence dna logged in, homology 100%.

The wherein PCV-3F are as follows: 5 '-TTATCGGCAAAGAGGTTGGAA-3 ' (SEQ ID NO:3)；PCV-3R are as follows: 5’-CGCCCATAGCGTATAAATACTGC-3’(SEQ ID NO:4)。

The invention further relates to a kind of PCV-3 rapid detection methods, use PCV-3 quick detection reagent of the present invention Box, specific method include the following steps:

Step 1 prepares probe molecule: according to the genome structure and conserved sequence of PCV-3, choosing PCV3 REP CDS Gene order is as detection target fragment, the PCV3 REP CDS gene order according to disclosed in GenBank:KX778720, design Probe molecule, the probe molecule sequence are 5 '-tcaagcagcagctcggattctgac-3 ', 5 ' ends of the probe molecule It is marked using reporter fluorescence group, i.e. probe molecule structure are as follows: reporter fluorescence group- tcaagcagcagctcggattctgac；

Step 2, by probe molecule obtained by polystyrene nanospheres solution and step 1: reporter fluorescence group- Tcaagcagcagctcggattctgac mixing, is then added sample to be tested, detects fluorescence.

Wherein, reporter fluorescence group described in step 1 is preferably fluorescein isothiocynate (FITC), hydroxyl fluorescein (FAM), tetrachlorofluorescein (TET), tetramethylrhodamine (TAMRA), ROX, CY3, CY5, CY5.5, CAL red, Red640 or Texas Red etc..

During result judgement of the present invention, positive controls and negative control group are respectively set, it is glimmering according to sample detection With the presence or absence of PCV-3 virus in the intensity judgement sample of light, detection method of the invention can be used for diagnostic purpose detection, or The detection of non-disease diagnostic purpose, such as viral diagnosis, parting, virus titer measurement are carried out based on scientific research or determine pig With the presence or absence of PCV-3 pollution etc. in blood product.

The invention has the advantages that: above technical scheme is based on, the detection method of PCV-3 used in the present invention is at low cost It is honest and clean, it is that target nucleic acid molecule specific binding probe molecule is adsorbed on polystyrene nanospheres surface, quenching probes molecule Fluorescence, then, when probe molecule is mixed with the DNA molecular in sample to be tested, when hybridization forms double-strand, probe molecule is from polyphenyl second Alkene nanometer ball surface is detached from, and fluorescent quenching effect disappears, and the detection to sample to be tested is realized by detection fluorescence signal, according to glimmering The Strength Changes of light may further determine that the content of target nucleic acid molecule in sample to be tested.This method implements very simple, does not need Use the ELISA detection reagent of expensive PCR instrument and valuableness, it is only necessary to which result can be realized in simple fluorescence detection device Detection and analysis, detection time is short, high sensitivity, can be widely applied to scene, clinical or laboratory testing, especially pig farm On-site test.

Detailed description of the invention:

Fig. 1: detection test result；Wherein a is the fluorescence emission spectrum of DNA probe (50nM)；B be DNA probe (50nM)+ The fluorescence emission spectrum of positive control plasmid；C is DNA probe (50nM)+polystyrene nanospheres solution+deionized water fluorescence Emission spectrum；D is DNA probe (50nM)+polystyrene nanospheres solution+positive control plasmid fluorescence emission spectrum；E is poly- The fluorescence emission spectrum of styrene nanosphere solution itself.

Specific embodiment:

Embodiment 1: a kind of PCV-3 rapid detection method includes the following steps:

Step 1 prepares probe molecule: according to the genome structure and conserved sequence of PCV-3, choosing PCV3 REP CDS Gene order is as detection target fragment, the PCV3 REP CDS gene order according to disclosed in GenBank:KX778720, design Probe molecule, the probe molecule sequence are 5 '-tcaagcagcagctcggattctgac-3 ', 5 ' ends of the probe molecule It is marked using reporter fluorescence group FAM, i.e. probe molecule structure are as follows: FAM-tcaagcagcagctcggattctgac；

Step 2, by probe molecule obtained by polystyrene nanospheres solution and step 1: FAM- Tcaagcagcagctcggattctgac mixing, is then added sample to be tested, detects fluorescence.

Embodiment 2: a kind of PCV-3 quick detection kit, the PCV-3 quick detection kit includes: probe molecule Solution, polystyrene nanospheres solution, positive control plasmid, negative control, wherein the structure of the probe molecule are as follows: FAM- tcaagcagcagctcggattctgac(SEQ ID NO:1)。

Wherein, the polystyrene nanospheres are prepared by following methods: by 0.05g ammonium persulfate and 0.05g ten Dialkyl sulfonates are dissolved into 10mL water, add 12mL styrene, by reactant heat a period of time, then by product from The heart is rinsed with methanol and removes SDS, obtains polystyrene nanospheres.

Wherein the negative control uses deionized water.

Wherein the positive controls are the Partial Fragment clones of the PCV3 REP CDS gene order obtained through PCR amplification The pMD18-T-PCV-3 plasmid constructed on to pMD18-T plasmid, the nucleotide sequence of the segment as shown in SEQ ID NO:2, The target gene fragment that 312bp is specifically amplified using PCV-3 specific primer PCV-3F/PCV-3R, by target gene piece Section is cloned into building pMD18-T-PCV-3 plasmid on pMD18-T plasmid, and the digestion products obtained through double digestion are consistent with expection, It is compared after pMD18-T-PCV-3 sequencing with the ncbi PCV-3 DNA sequence dna logged in, homology 100%.The wherein PCV- 3F are as follows: 5 '-TTATCGGCAAAGAGGTTGGAA-3 ' (SEQ ID NO:3)；PCV-3R are as follows: 5 '- CGCCCATAGCGTATAAATACTGC-3’(SEQ ID NO:4)。

The application method of the kit includes the following steps:

Step 1 prepares probe molecule: according to the genome structure and conserved sequence of PCV-3, choosing PCV3 REP CDS Gene order is as detection target fragment, the PCV3 REP CDS gene order according to disclosed in GenBank:KX778720, design Probe molecule, the probe molecule sequence are 5 '-tcaagcagcagctcggattctgac-3 ', 5 ' ends of the probe molecule It is marked using reporter fluorescence group FAM, i.e. probe molecule structure are as follows: FAM-tcaagcagcagctcggattctgac；

Step 2, by probe molecule obtained by polystyrene nanospheres solution and step 1: FAM- Tcaagcagcagctcggattctgac mixing, is then added sample to be tested, detects fluorescence.

The detection method of specific step 2 are as follows: polystyrene nanospheres are added to fluorescence probe FAM- first In the solution of tcaagcagcagctcggattctgac (50nM), single-stranded DNA probe can be adsorbed onto polystyrene nanospheres Surface causes fluorescent quenching, reacts by 15min, after fluorescent quenching reaches balance (59%), test sample is added, with spy Needle DNA forms double-strand, can separate from polystyrene nanospheres surface, so that fluorescence is restored, carries out after waiting 15min Fluoremetry.

Embodiment 3: detection test

Positive control and negative control are tested using the method for embodiment 2, to verify the accurate of detection method Property, testing result is corresponding to Figure of description Fig. 1, and wherein a is the fluorescence emission spectrum of DNA probe (50nM)；B is probe DNA (50nM)+positive control plasmid fluorescence emission spectrum；C be DNA probe (50nM)+polystyrene nanospheres solution+go from The fluorescence emission spectrum of sub- water；D is DNA probe (50nM)+polystyrene nanospheres solution+positive control plasmid fluorescent emission Spectrum；E is the fluorescence emission spectrum of polystyrene nanospheres solution itself.

The above testing result shows in the presence of no detection template, probe molecule and polystyrene nanospheres Be combined with each other, fluorescent quenching effect occur, the fluorescence intensity (c) that detects at 522nm is insufficient probe molecule solutions (a) or Person's DNA probe (50nM)+positive control plasmid (b) fluorescence intensity half, and after adding template (d), corresponding fluorescence Value is the fluorescent value being restored to close to probe molecule solutions, the above result shows that method testing result of the invention is accurate, it can Effectively judged in sample to be tested by fluorescence with the presence or absence of PCV-3.

Embodiment 4: sensitivity technique

Standard items plasmid pMD18-T-PCV-3 plasmid is subjected to 10 times of doubling dilutions, selects therein 4 × 10¹-4×10⁸ Copy/μ L plasmid solution, is respectively adopted detection method, Li Zhuoxin of the embodiment of the present invention 2 etc. and establishes quantitative detection PCV3 Real time fluorescence quantifying PCR method (with reference to Li Zhuoxin etc., the I real-time fluorescence quantitative PCR side 3 type SYBR-Green of pig circular ring virus The foundation and application of method, " Chinese Pathogen Biology magazine ", volume 13, the 9th phase) and conventional PCR method (with reference also to Li Zhuo The PCR method recorded in sunrise document, page 937) and the method for following check experiment detected:

Wherein check experiment are as follows: the structure of probe molecule are as follows: FAM-acctcgagattggcgaagattc (SEQ ID NO: 5), other are the same as embodiment 2.

Specific sensitivity technique result see the table below 1:

1 sensitivity technique result of table

Note :+represent the positive；- represent feminine gender.

By the result of the above table 1 it is found that the detection method of the embodiment of the present invention 2 may be implemented positive granulation concentration be 4 × 10¹Plasmid solution positive sample detection, the sensitivity of detection and Li Zhuoxin etc. establish the real-time of quantitative detection PCV-3 The detection sensitivity of fluorescence quantifying PCR method is suitable, higher than conventional PCR method and the method for check experiment group, especially originally For the detection method of inventive embodiments 2 compared with the method for check experiment group, sensitivity improves 100 times, illustrates institute of the present invention The probe molecule sequence of selection has higher sensitivity, can preferably detect PCV-3 virus.

Embodiment 5: sample detection

Pig lung tissue and 50 parts of slaughterhouse health pig lung tissues to 50 parts of pig farms for picking up from Tianjin for 2018 is as inspection Object is surveyed, the kit and method that the embodiment of the present invention 2 is respectively adopted detected, Li Zhuoxin etc. establishes quantitative detection PCV3 Real time fluorescence quantifying PCR method (with reference to Li Zhuoxin etc., the I real-time fluorescence quantitative PCR side 3 type SYBR-Green of pig circular ring virus The foundation and application of method, " Chinese Pathogen Biology magazine ", volume 13, the 9th phase) and conventional PCR method (with reference also to Li Zhuo The PCR method recorded in sunrise document, page 937) it is detected, the positive rate that wherein embodiment of the present invention 2 detects is 28%, glimmering The positive rate of Fluorescent Quantitative PCR method detection is 29%, and the positive rate of Standard PCR detection is 18%, and the embodiment of the present invention 2 detects Positive sample and fluorescence quantifying PCR method detection positive sample have high consistency (fluorescence quantifying PCR method is more Detect a positive sample).It can be seen that the quick and accurate detection of PCV-3, detection knot may be implemented in mode of the invention Fruit and fluorescence quantifying PCR method have preferable consistency, and compare fluorescence quantifying PCR method, and it is fixed that the present invention gets rid of fluorescence Dependence of the PCR method to expensive instrument is measured, on-site test is more suitable for.

<110>University Of Tianjin

<120>a kind of 3 rapid detection method of pig circular ring virus and its kit

<130>

<160> 5

<170>

<210> 1

<211> 24

<212> DNA

<213>artificial sequence

<400> 1

tcaagcagca gctcggattc tgac 24

<210> 2

<211> 313

<212> DNA

<213>artificial sequence

<400> 2

ttatcggcaa agaggttgga aaaagcggta ccccacactt gcaagggtac gtgaatttca 60

agaacaaaag gcgactcagc tcggtgaagc gcttacccgg atttggtcgg gcccatctgg 120

agccggcgag ggggagccac aaagaggcca gcgagtattg caagaaagag ggggattacc 180

tcgagattgg cgaagattcc tcttcgggta ccagatcgga tcttcaagca gcagctcgga 240

ttctgacgga gacggcggga aatctgactg aagttgcgga gaagatgcct gcagtattta 300

tacgctatgg gcg 313

<210> 3

<211> 21

<212> DNA

<213>artificial sequence

<400> 3

ttatcggcaa agaggttgga a 21

<210> 4

<211> 23

<212> DNA

<213>artificial sequence

<400> 4

cgcccatagc gtataaatac tgc 23

<210> 5

<211> 24

<212> DNA

<213>artificial sequence

<400> 5

acctcgagat tggcgaagat tc 22

Claims (7)

1. a kind of PCV-3 quick detection kit, which is characterized in that the PCV-3 quick detection kit includes: probe molecule Solution, polystyrene nanospheres solution, positive control plasmid, negative control, wherein the structure of the probe molecule are as follows: report is glimmering Light group-tcaagcagcagctcggattctgac (SEQ ID NO:1).

2. detection kit according to claim 1, which is characterized in that the polystyrene nanospheres are by following methods It is prepared: 0.05g ammonium persulfate and 0.05g dodecyl sodium sulfate is dissolved into 10mL water, add 12mL styrene, Reactant is heated into a period of time, is then centrifuged product, is rinsed with methanol and removes SDS, obtain polystyrene nanospheres.

3. detection kit according to claim 1, which is characterized in that the negative control using deionized water or SPF Swine serum.

4. detection kit according to claim 1, which is characterized in that the positive controls be by artificial synthesized or The Partial Fragment of the PCV3 REP CDS gene order that person obtains through PCR amplification is cloned into be constructed on pMD18-T plasmid PMD18-T-PCV-3 plasmid, the nucleotide sequence of the segment is as shown in SEQ ID NO:2.

5. detection kit according to claim 4, which is characterized in that utilize PCV-3 specific primer PCV-3F/PCV- 3R amplifies the target gene fragment of 312bp, and target gene fragment is cloned on pMD18-T plasmid and constructs pMD18-T-PCV- 3 plasmids, the digestion products obtained through double digestion are consistent with expection, the PCV- logged in after pMD18-T-PCV-3 sequencing with ncbi 3DNA sequence alignment, homology 100%, wherein the PCV-3F are as follows: 5 '-TTATCGGCAAAGAGGTTGGAA-3 ' (SEQ ID NO:3)；PCV-3R are as follows: 5 '-CGCCCATAGCGTATAAATACTGC-3 ' (SEQ ID NO:4).

6. a kind of PCV-3 rapid detection method, which is characterized in that it is quick using the described in any item PCV-3 of claim 1-5 Detection kit, specific method include the following steps:

Step 1 prepares probe molecule: according to the genome structure and conserved sequence of PCV-3, choosing PCV3 REP CDS gene For sequence as detection target fragment, the PCV3 REP CDS gene order according to disclosed in GenBank:KX778720 designs probe Molecule, the probe molecule sequence are 5 '-tcaagcagcagctcggattctgac-3 ', and 5 ' ends of the probe molecule use Reporter fluorescence group is marked, i.e. probe molecule structure are as follows: reporter fluorescence group-tcaagcagcagctcggattctgac；

Step 2, by probe molecule obtained by polystyrene nanospheres solution and step 1: reporter fluorescence group- Tcaagcagcagctcggattctgac mixing, is then added sample to be tested, detects fluorescence.

7. PCV-3 rapid detection method according to claim 6, which is characterized in that reporter fluorescence base described in step 1 Group be fluorescein isothiocynate (FITC), hydroxyl fluorescein (FAM), tetrachlorofluorescein (TET), tetramethylrhodamine (TAMRA), ROX, CY3, CY5, CY5.5, CAL red, Red640 or Texas Red.