CN109781981A

CN109781981A - Detect molecular probe, kit and its application of African swine fever virus

Info

Publication number: CN109781981A
Application number: CN201910088473.4A
Authority: CN
Inventors: 王爱萍; 张改平; 刘运超; 贾蕊; 刘东民; 赵建国; 祁元明; 石海宁
Original assignee: Henan Ze Ze Biological Engineering Co Ltd; Zhengzhou University
Current assignee: Henan Ze Ze Biological Engineering Co Ltd; Zhengzhou University
Priority date: 2019-01-30
Filing date: 2019-01-30
Publication date: 2019-05-21
Anticipated expiration: 2039-01-30
Also published as: CN109781981B

Abstract

The invention discloses a kind of molecular probe, kit and its applications for detecting African swine fever virus, it is intended to solve the technical problem of existing detection technique dependable with function difference.The present invention detects the nucleotide sequence of the molecular probe of African swine fever virus as shown in SEQ ID NO.2.The present invention has prepared a kind of RT-PCR reaction solution for detecting African swine fever virus, it is prepared for a kind of detection African swine fever virus RT-PCR reaction solution freeze-dried powder, a kind of African swine fever virus detection kit, and provides the qualitative and quantitative detecting method of African swine fever virus.It molecular probe that the present invention designs and establishes RT-PCR detection method and has the characteristics that sensitivity is high, reproducible, high specificity, improve the reliability and ease for use of round pcr detection ASFV, it realizes pollution-free, high-throughput detection, can be used for detecting ASFV nucleic acid in susceptible animal and relevant animal product.

Description

Detect molecular probe, kit and its application of African swine fever virus

Technical field

The present invention relates to technical field of gene detection, and in particular to it is a kind of detect African swine fever virus molecular probe, examination Agent box and its application.

Background technique

African swine fever virus (ASFV) infection domestic animal or wild boar cause African swine fever (ASF), can lead to high incidence and dead Rate is died, and causes huge economic loss to pig breeding industry.ASFV is found in nineteen twenty-one in Kenya for the first time, then in African south Many countries of portion and east find the presence of ASFV.ASF propagates rapid, rapid onset, and short decades just reach from Africa All over the world, it almost have swepts the globe.When afternoon 17 on the 2nd of August in 2018, diagnosed through China Animal Health and Epidemiology Center, Doubtful African swine fever epidemic situation occurs for Shenyang City, the street Shen Bei, Shenbeixin District (new city) five or five communities, and when the August morning 11 on the 3rd It makes a definite diagnosis.When on August 3,15 2018, in epidemic place 913 first-born pigs all slaughtered with it is innoxious.Then Heilungkiang, river There is ASF epidemic situation in succession in the provinces such as Soviet Union, Anhui.Therefore, the task of top priority at present is the quarantine and prevention and control reinforced to ASF.

Some features of ASFV are similar to irido virus and poxvirus, but it is non-for African swine fever virus category (Asfivirus) The unique member of continent swine fever virus section (Asfarviridae).ASFV genome be double-stranded DNA, size 170 to 190 kb it Between.ASFV is a kind of unique known DNA arboviruse, can infect porcine, such as domestic pig and wild boar, shrub pig, warthog and huge Type forest pig and tick insects.Tick propagation is considered as main infection approach of the ASFV in African Territories.However, in southern Europe and Meat products and the subsequent virus infection locality tick class close phase of the outburst of endemic areas of Latin America ASF with import infection ASFV It closes.

The Clinical symptoms that pig infects ASFV is high fever, diarrhea, bleeding and heat flush.Some clinical symptoms and postmortem knot Fruit infects the symptom and indistinction of classic swine fever virus (CSFV) with pig such as splenomegaly, lymph node and kidney hemorrhagic disease.Therefore, The quick detection that is quick, reliably detecting most important-ASFV of ASFV is not only necessary to ASF prevention and control, and clinical with it The similar pig disease of symptom carries out necessary to antidiastole.

Currently, external have hemadsorption test, direct immuno fluorescence test, animal inoculation pvaccination to African swine fever diagnostic method Test, ELISA, polymerase chain reaction etc..Wherein hemadsorption test, the sensibility of direct immuno fluorescence test is not high and special Anisotropic not strong, animal inoculation pvaccination test is dangerous.The conventional method of laboratory diagnosis ASFV is in pig bone marrow (PBM) cell culture It carries out virus purification (VI), although this method is reliable and sensitive, the time required to the detection too long (6 days).Polymerase chain reaction (PCR) be a kind of quick detection ASFV for substituting VI method, it is second-rate or degradation with can not especially suitable for screening The sample of recovered virus.Round pcr enables the diagnosis of ASFV to complete in a few hours after receiving sample, shortens Diagnostic Time.PCR The method of detection African swine fever virus have the characteristics that it is special, sensitive, quick, but have it is time-consuming, easy to pollute, expand after need electrophoresis to examine The features such as sample size surveyed and detected every time is few.

Therefore, need that research and development are new, efficient detection African swine fever virus method, for detecting susceptible animal and correlation ASFV nucleic acid in animal product.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of molecular probe, reagents for detecting African swine fever virus (ASFV) Box and its application, to solve the technical problem of existing detection technique dependable with function difference.

In order to solve the above technical problems, the present invention adopts the following technical scheme:

Design a kind of molecular probe for detecting African swine fever virus, nucleotide sequence are as follows:

5'-X-CCAACCCAGTGGTCATATTAACGTATCC-3'-Y, the X are fluorescent reporter group, and Y is fluorescent quenching base Group.

Preferably, the fluorescent reporter group is any one in FAM, HEX, TET.

Preferably, the fluorescent quenching group is TAM-RA or BHQ.

A kind of RT-PCR reaction solution for detecting African swine fever virus is prepared, RT-PCR reaction solution described in every 22 μ L is by 5 pmol The molecular probe 1 μ L, 50 pmol primer ASFV-For 1 μ L, 50 pmol 1 μ L of primer ASFV-Back, 12.5 μ L and Nuclease-free water of TaqMan reaction mix, 6.5 μ L composition；

The nucleotide sequence of the primer ASFV-For is as shown in SEQ ID NO.3；The nucleotides sequence of the primer ASFV-Back Column are as shown in SEQ ID NO.4.

Prepare a kind of detection African swine fever virus RT-PCR reaction solution freeze-dried powder, preparation method are as follows:

(1) Reaction Mixer is prepared；

Every 11.5mL Reaction Mixer by 5 pmol 500 μ L, TaqMan reaction mix of the molecular probe Primer ASFV-Back 500 the μ L and Nuclease- of primer ASFV-For 500 the μ L, 50 pmol of 6250 μ L, 50 pmol 3750 μ L of free water composition；

The nucleotide sequence of the primer ASFV-For is as shown in SEQ ID NO.3；The nucleotides sequence of the primer ASFV-Back Column are as shown in SEQ ID NO.4；

(2) prepared Reaction Mixer is taken to dispense in the ampere bottle for being 10mL to capacity according to the amount of every bottle of 1 mL, then It is protected from light and is lyophilized into powder；

(3) gained powder is placed in -40~-80 DEG C of preservations.

A kind of African swine fever virus detection kit is prepared, the molecular probe, the RT-PCR reaction solution or institute are contained State RT-PCR reaction solution freeze-dried powder.

A kind of qualitative checking method of African swine fever virus is provided, comprising the following steps:

(1) measuring samples DNA is extracted；

(2) the RT-PCR reaction solution is taken or by the RT-PCR reaction solution freeze-dried powder according to 1mL Nuclease-free The amount of every bottle of water dilutes, and obtains dilute reaction solution；

(3) it takes sample DNA described in 3 μ L to be added in reaction solution described in 22 μ L or the dilute reaction solution and carries out RT-PCR reaction；

(4) RT-PCR reaction product is taken to carry out agarose gel electrophoresis；

(5) if value > 40 Ct of RT-PCR detection or electrophoresis are without amplification curve, measuring samples are feminine gender；If RT-PCR detection Value < 40 Ct and electrophoresis have the amplification curve of 258bp, then measuring samples are the positive.

Preferably, the response procedures of the RT-PCR reaction are as follows: 1 circulation, 50 DEG C of 2 min, 1 recycles 95 DEG C 10 min, 40 circulations 95 DEG C of 15 second, 58 DEG C of 1 min.

A kind of quantitative detecting method of African swine fever virus is also provided, comprising the following steps:

(1) quantitative to carry out doubling dilution with standard items；

(2) measuring samples DNA is extracted；

(3) the RT-PCR reaction solution is taken or by the RT-PCR reaction solution freeze-dried powder according to 1mL Nuclease-free The amount of every bottle of water dilutes, and obtains dilute reaction solution；

(4) take doubling dilution standard items described in 3 μ L and the measuring samples DNA that reaction solution described in 22 μ L or the dilution is added instead Answer progress RT-PCR reaction in liquid；

(5) according to known standard concentration, the corresponding nucleic acid copies of each dilution are calculated；

(6) using the logarithm of the quantitative nucleic acid copies with standard items as Y-axis, using the Ct value of RT-PCR detection as X-axis, make standard Curve；

(7) will measuring samples Ct value substitute into standard curve equation of linear regression in, that is, calculate its nucleic acid copies to get Its nucleic acid concentration.

Compared with prior art, the beneficial technical effect of the present invention lies in:

1. method of the invention compared with traditional PCR method based on agarose gel electrophoresis, has, sensitivity is high, repeats Property good, high specificity the characteristics of, detection speed is fast, result is objective, the advantages that can quantifying, is high-throughput, effectively overcomes normal PCR With nested PCR amplification product must electrophoresis detection, time-consuming, sensitivity is low and the shortcomings that without standard measure.

2. the present invention can directly detect pcr amplification product using the fluorescence model of TaqMan molecular probe, kept away without uncapping Exempt from pollution, and more quick, realizes pollution-free, high-throughput detection.

3. method of the invention can make a quantitative, objectively estimation, test sample can be carried out and accurately sentence It is fixed, and clearly defined Ct value be 40.00 be positive findings and negative findings critical value.

4. the freeze-dried powder of RT-PCR reaction mixture of the present invention can long-term preservation, be readily transported and carry.

5. method sensitivity of the invention is high, sample and the recessiveness sense of the ASFV virus of low content can be accurately detected Dye either continues the malicious host sample of band.

6. method of the invention effectively increases the reliability and ease for use of round pcr detection ASFV, can be used to separate disease The detection of the batch samples of poison, is conducive to apply and promote.

Detailed description of the invention

Fig. 1 is Realtime-PCR canonical plotting；

Fig. 2 is Realtime-PCR product agarose gel electrophoresis figure；

In figure, 1 is the ASFV VP72 amplification that marker 2000,2~12 is different copy numbers, and 13 be negative control；

Fig. 3 is Realtime-PCR sensitivity assessment figure；

Fig. 4 is the viral genes agarose gel electrophoresis figures such as CSFV；

In figure, 1 for marker 2000,2 is CSFV, and 3 be PCV2, and 4 be PRRSV (Mac145), and 5 be PRRSV (PAM), and 6 are PEDV, 7 be PPV；

Fig. 5 is Realtime-PCR Evaluation on specificity figure；

Fig. 6 is freeze-drying reaction solution Realtime-PCR canonical plotting；

Fig. 7 is now to match reaction solution Realtime-PCR canonical plotting；

Fig. 8 is commercial kit Realtime-PCR canonical plotting；

Fig. 9 is now to match reaction solution Realtime-PCR sensitivity assessment figure；

Figure 10 is freeze-dried powder reaction solution Realtime-PCR sensitivity assessment figure；

Figure 11 is commercial kit reaction solution Realtime-PCR sensitivity assessment figure.

Specific embodiment

Illustrate a specific embodiment of the invention with reference to the accompanying drawings and examples, but following embodiment is used only in detail It describes the bright present invention in detail, does not limit the scope of the invention in any way.

Related instrument and equipment is routine instrument device unless otherwise instructed in the examples below；It is related Reagent is commercially available conventional reagent unless otherwise instructed；Related test method is unless otherwise instructed conventional method.

Embodiment 1: it designs a kind of for detecting the molecular probe of ASFV

According to the upper 54 plants of African swine fever viruses VP72 gene of GeneBank, it is big that comparison filters out VP72 gene 3' terminal nucleotide sequence The small conserved sequence for 258bp, as shown in SEQ ID NO.1:

CGTATCCGATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATCTTATCGATAAAT TTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTACGGAGGCAATGCGATTAAAACCCCCGATGATCCGGG TGCGATGATGATTACCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACGTATCCAGAGCA AGAGAATTTTATATTAGTTGGGACACGGATTACG。

Using conserved sequence as target gene, comprehensively considers various factors and combine the practical experience of many years, design one point Sub- probe, as shown in SEQ ID NO.2:

5'-[6-carboxy-fluorescein(FAM)]-CCAACCCAGTGGTCATATTAACGTATCC-3'-[6- carboxy-tetramethyl-rhodamine(TAM-RA)]。

The fluorescent reporter group of the end probe 5' label is 6-carboxy-fluorescein(FAM), the end 3' of the probe The fluorescent quenching group of label is 6-carboxy-tetramethyl-rhodamine(TAM-RA).

Embodiment 2: it designs a kind of for detecting the specific primer of ASFV

Using conserved sequence shown in SEQ ID NO.1 as target gene, comprehensively considers various factors and combines the practical experience of many years, A pair of of specific primer is designed, as shown in SEQ ID NO.3 and SEQ ID NO.4:

ASFV-For:5 '-CGTATCCGATCACATTACC-3 '

ASFV-Back:5 '-CGTAATCCGTGTCCCAAC-3 '

Embodiment 3: ASFV total DNA is extracted

(1) preparation of reagents:

Dissociating buffer: 10 mmoL/L Tris-Cl pH 7.4,10mmoL/L NaCl, 25mmoL/L EDTA；

Other reagents: 10% SDS, protein kinase K (20mg/mL or pulvis), ether, phenol: chloroform: isoamyl alcohol (25:24:1), nothing Water-ethanol and 70% ethyl alcohol, 5 mol/L NaCl, 3 mol/L NaAc, TE；

(2) tissue 5g or so is cut, connective tissue is rejected, blots blood with blotting paper, shred (more more broken better), be put into mortar In；

(3) liquid nitrogen is poured into, is clayed into power, 10mL dissociating buffer is added；

(4) add 10 mL, 10% SDS, mix, sample becomes very sticky at this time；

(5) plus 50 μ L or 1mg protein kinase Ks, 37 DEG C of 1~2 h of heat preservation instruct tissue will be completely dissociated；

(6) plus 1 mL 5mol/L NaCl, mixing, 5000 rpm are centrifuged the several seconds；

(7) take supernatant in new centrifuge tube, with isometric phenol: chloroform: isoamyl alcohol (25:24:1) extracts, after being layered, 3000rpm is centrifuged 5 min；

(8) it takes upper strata aqueous phase to clean centrifuge tube, adds 2 times of volume ether extractions (operating in ventilation)；

(9) upper layer ether is removed, lower layer's water phase is retained；

(10) the 3mol/L NaAc and 2 times of volume dehydrated alcohols for adding 1/10 volume overturn hybrid dna；At room temperature stand 10~ 20min, DNA precipitate to form White Flocculus；

(11) DNA precipitating is ticked with glass bar, rinses in 70% ethyl alcohol, blotted on blotting paper, is dissolved in 1mL TE, -20 DEG C save；

(12) if there is insoluble particle in DNA solution, supernatant can be taken in 5000rpm brief centrifugation；It is therein to remove RNA can add 5 μ L RnaseA(10 μ g/ μ L), 37 DEG C of 30 min of heat preservation after being extracted with phenol, sink again according to step (10) (11) Shallow lake DNA.

Embodiment 4: the RT-PCR reaction solution of detection ASFV is prepared

Each 25 μ L of reaction system, each component and content of reaction solution are as follows:

The 1 μ L of molecular probe (5 pmol) of embodiment 1；The ASFV-For(50 pmol of embodiment 2) 1 μ L；The ASFV- of embodiment 2 Back(50 pmol) 1 μ L；TaqMan reaction mix 12.5μL；6.5 μ L of Nuclease-free water, is configured to Reaction solution.It takes the mixed liquor of 22 μ L to be added in each hole of quantitative plank when use, then the template of 3 μ L is added to every hole.

Embodiment 5: the freeze-dried powder of the RT-PCR reaction solution of preparation detection ASFV

Detect reaction mixture freeze-dried powder the preparation method is as follows:

11.5mL Reaction Mixer is prepared, is calculated according to 500 reaction systems:

The 500 μ L (1 × 500) of TaqMan Probe, 5pmol of embodiment 1；

TaqMan reaction mix 6250μL(12.5×500)；

500 μ L (1 × 500) of the ASFV-For of embodiment 2,50pmol；

500 μ L (1 × 500) of the ASFV-Back of embodiment 2,50pmol；

Nuclease-free water 3750μL(7.5×500)。

It is dispensed into 10mL ampoule bottle, every bottle of 1mL Reaction Mixer, using according to raw Co., Ltd FreeZone Stoppering Tray Dryers system is lyophilized into powder, and powder is placed in -80 DEG C of refrigerators and is saved, whole A process needs are protected from light operation.

Embodiment 6: the response procedures of setting detection ASFV

Response procedures are as follows:

1 circulation, 50 DEG C of 2 min, 1 circulation, 95 DEG C of 10 min, 40 circulations 95 DEG C of 15 second, 58 DEG C 1 min。

Embodiment 7: the method for detecting ASFV

(1) in 1.5 mL centrifuge tubes, the RT-PCR reaction solution that Example 4 is prepared, or prepared by embodiment 5 Reaction Mixer freeze-dried powder 1mL Nuclease-free water diluted；

(2) MicroAmp is added in the 22 μ L RT-PCR reaction solution prepared or the Reaction Mixer diluted In the hole optical reaction plate；

(3) template of 3 μ L is added in the hole MicroAmp optical reaction plate in (2)；

(4) reaction plate is centrifuged 1 min；

(5) according to Realtime-PCR program set by embodiment 6 and PCR amplification is carried out；

(6) Ago-Gel of configuration 1.5% identifies pcr amplification product, according to Ct value interpretation result, value > 40 Ct or without amplification song Line indicates in sample for feminine gender without African swine fever virus；Value < 40 Ct, and there is typical amplification curve, for the positive, indicate sample There are African swine fever viruses in product.

(7) method is quantitatively judged are as follows:

Production standard curve first is diluted according to standard items, is made simultaneously to after quantitatively carrying out doubling dilution of standard items with unknown sample RT-PCR detection；Then according to known mark product concentration, the corresponding nucleic acid copies of each dilution are calculated；Quantitatively to use standard The logarithm of the nucleic acid copies of product is Y-axis, and the Ct value of RT-PCR detection is that X-axis makees scatter plot, Trendline is added, to obtain Standard curve, equation of linear regression and R²；The detection Ct value of sample being substituted into the equation of linear regression of standard curve can count The nucleic acid copies of unknown sample are calculated, and then obtain nucleic acid concentration.

The drafting of embodiment 8:ASFV RT-PCR detection method standard curve, and repeatability, sensitivity and specificity are commented Valence

(1) material

RT-PCR template is ASFV VP72, CSFV, PCV2, PRRSV (Mac145), PRRSV (PAM), PEDV, PPV, pathological material of disease sample Product, standard items, dilution.

(2) drafting of standard curve

By 1 × 10¹⁹Copy/μ L plasmid gradient carries out 10 times of doubling dilutions and is diluted to 1 × 10⁰Copy/μ L, each concentration gradient It does 3 and repeats quantitative fluorescent PCR test, standard curve is automatically generated by 7500 fluorescence quantitative PCR instrument of ABI.And with 1.5% Agarose gel carries out nucleic acid electrophoresis, identifies amplified fragments.RT-PCR reaction solution is the reaction solution of embodiment 4, response procedures For the program of embodiment 6.

As a result as depicted in figs. 1 and 2.

It is that slope of a curve is -1.16 to ordinate as shown in Figure 1 by abscissa Ct value of the logarithm of plasmid concentration, intercept 22.43, related coefficient 0.997 obtains calibration curve equation are as follows: Y=- 1.16X+22.43；With 1.5% Ago-Gel into After row nucleic acid electrophoresis, there is an about 258 bp(Fig. 2 of specific band size in observation), it is consistent with expected results.

(3) reproducibility

With 1 × 10¹~1 × 10¹⁸The each concentration gradient of copy/μ L plasmid does 3 and repeats repetitive test and according to institute It obtains Ct value and calculates coefficient of variation CV.

The results are shown in Table 1 for repetitive test:

The coefficient of variation of each concentration gradient Ct value of table 1

。

Table 1 shows that the good each concentration gradient coefficient of variation Cv of the repeatability of this method is respectively less than 0.25%, illustrates that this is glimmering in real time Fluorescent Quantitative PCR detection method is with good stability.

(3) sensitivity is evaluated

With 1 × 10⁰~1 × 10²⁰The each concentration gradient of copy/μ L plasmid, which does 3 and repeats sensitivity tests, determines the party The minimal detectable concentration of method.

As a result as shown in Figure 3.

With 1 × 10²⁰To 1 × 10⁰Copy/μ L plasmid carries out sensitivity tests this method minimum detectable 1 × 10¹It copies Shellfish/μ L plasmid may occur in which amplification curve when concentration is more than or equal to 10 copies/μ L, and it is high to illustrate that the detection method has Sensitivity.

(3) Evaluation on specificity

With classic swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV) and pig epidemic diarrhea (PEDV) CDNA, DNA the and ASFV pET28a-VP72 of pig circular ring virus (PCV2) and pig parvoviral (PPV) is that template carries out Quantitative fluorescent PCR reaction has seen whether amplification curve.

As a result as shown in Figure 4 and Figure 5.

As shown in Figure 4: with CSFV, the DNA of cDNA, PCV2 and the PPV of PEDV, PRRSV (Mac145) and PSRRV (PAM) For template, corresponding specific band can be amplified by carrying out normal PCR with respective primer, illustrate the template matter extracted Amount well can be used for specificity identification.

As shown in Figure 5: with CSFV, the DNA of cDNA, PCV2 and the PPV of PEDV, PRRSV (Mac145) and PSRRV (PAM) And the plasmid pET28a-VP72 of ASFV is template, carries out quantitative fluorescent PCR with the primer of amplification ASFV, reaction result only has There is amplification curve in the pET28a-VP72 of ASFV, illustrates that this method has good specificity.

Comparative example: the kit repeatability and susceptibility comparison of ASFV are detected

(1) experimental design

The Reaction mixer and Thermo that contrast material is the Reaction mixer freeze-dried powder of embodiment 5, now prepares VetMAX African swine fever (ASF) qPCR detection kit of Fisher；

Respectively with 1 × 10⁰~1 × 10¹⁰Copy/μ L, 1 × 10⁰~1 × 10⁹Copy/μ L, 1 × 10⁰~1 × 10¹²Copy/μ L The each concentration gradient of plasmid does 3 repetitions, carries out quantitative fluorescent PCR amplification, and response procedures are the program of embodiment 6.

Compare the standard curve of three kinds of comparison material quantitative fluorescent PCRs, repeatability, sensitivity.

(2) Specification Curve of Increasing

The standard curve of Reaction mixer freeze-dried powder is as shown in Figure 6:

Using the logarithm of plasmid concentration as abscissa, Ct value is ordinate, it is known that slope of a curve is -1.6695, intercept 43.18, related coefficient 0.9934 obtains calibration curve equation are as follows: y=- 1.6695x+43.18.

The standard curve of the Reaction mixer now matched is as shown in Figure 7:

Using the logarithm of plasmid concentration as abscissa, Ct value is ordinate, it is known that slope of a curve is -1.5418, intercept 40.851, related coefficient 0.9929 obtains calibration curve equation are as follows: y=- 1.5418x+40.851.

The standard curve of commercial fluorescence immue quantitative detection reagent box is as shown in Figure 8:

Using the logarithm of plasmid concentration as abscissa, Ct value is ordinate, it is known that slope of a curve is -1.6056, intercept 38.782, related coefficient 0.993 obtains calibration curve equation are as follows: y=- 1.6056x+38.782.

(3) reproducibility

The repeatability of Reaction mixer freeze-dried powder is as shown in table 2:

Reaction solution Realtime-PCR is lyophilized in table 2

。

As shown in Table 2: the repeatability of Reaction mixer freeze-dried powder is good, and each concentration gradient coefficient of variation Cv is respectively less than 1.672%。

The repeatability of the Reaction mixer now matched is as shown in table 3:

Table 3 now matches reaction solution Realtime-PCR

。

As shown in Table 3: the repeatability of the Reaction mixer now matched is good, and each concentration gradient coefficient of variation Cv is respectively less than 1.46%。

The repeatability of commercial fluorescence immue quantitative detection reagent box is as shown in table 4:

4 commercial fluorescence quantification kit Realtime-PCR of table

。

As shown in Table 4: the repeatability of commercial fluorescence immue quantitative detection reagent box is good (table 4), each concentration gradient variation lines Number Cv is respectively less than 1.45%.

These results suggest that: it is now suitable with the commercialization stability of detection kit with Reaction mixer, and be lyophilized The stability of powder is slightly lower, and protective agent can be added.

(4) sensitivity assessment

With 1 × 10¹²To 1 × 10⁰Copy/μ L plasmid carries out sensitivity tests, Reaction mixer freeze-dried powder and now matches Reaction mixer method is minimum detectable up to 1 × 10¹Copy/μ L plasmid, when concentration is more than or equal to 10 copies/μ L Shi Jun may occur in which amplification curve (such as Fig. 9, Figure 10), and the lowest detection of commercial fluorescence quantification kit is limited to 1 × 10²It copies Shellfish/μ L(such as Figure 11), illustrate that Realtime-PCR detection method of the invention has high sensitivity, compares commercial kit It is 10 times high.

The present invention is described in detail above in conjunction with drawings and examples, still, those of skill in the art Member is it is understood that without departing from the purpose of the present invention, can also carry out each design parameter in above-described embodiment Change, forms multiple specific embodiments, is common variation range of the invention, is no longer described in detail one by one herein.

SEQUENCE LISTING

<110>Henan Zhong Ze bioengineering Co., Ltd, Zhengzhou University

<120>molecular probe, kit and its application of African swine fever virus are detected

<130> 2019

<160> 4

<170> PatentIn version 3.2

<210> 1

<211> 258

<212> DNA

<213> ASFV

<400> 1

cgtatccgat cacattacct attattaaaa acatttccgt aactgctcat ggtatcaatc 60

ttatcgataa atttccatca aagttctgca gctcttacat acccttccac tacggaggca 120

atgcgattaa aacccccgat gatccgggtg cgatgatgat tacctttgct ttgaagccac 180

gggaggaata ccaacccagt ggtcatatta acgtatccag agcaagagaa ttttatatta 240

gttgggacac ggattacg 258

<210> 2

<211> 28

<212> DNA

<213>artificial synthesized

<400> 2

ccaacccagt ggtcatatta acgtatcc 28

<210> 3

<211> 19

<212> DNA

<213>artificial synthesized

<400> 3

cgtatccgat cacattacc 19

<210> 4

<211> 18

<212> DNA

<213>artificial synthesized

<400> 4

cgtaatccgt gtcccaac 18

Claims

1. a kind of molecular probe for detecting African swine fever virus, which is characterized in that its nucleotide sequence are as follows:

2. the molecular probe of detection African swine fever virus according to claim 1, which is characterized in that the fluorescence report base Group is any one in FAM, HEX, TET.

3. the molecular probe of detection African swine fever virus according to claim 1, which is characterized in that the fluorescent quenching base Group is TAM-RA or BHQ.

4. a kind of RT-PCR reaction solution for detecting African swine fever virus, which is characterized in that RT-PCR reaction solution described in every 22 μ L is by 5 The primer ASFV- of primer ASFV-For 1 the μ L, 50 pmol of molecular probe 1 μ L, 50 pmol described in the claim 1 of pmol 1 12.5 μ L and Nuclease-free water of μ L, TaqMan reaction mix of Back, 6.5 μ L composition；

5. a kind of detection African swine fever virus RT-PCR reaction solution freeze-dried powder, which is characterized in that preparation method are as follows:

(1) Reaction Mixer is prepared；

Every 11.5mL Reaction Mixer 500 μ L, TaqMan of molecular probe as described in the claim 1 of 5 pmol The primer ASFV-Back 500 of primer ASFV-For 500 the μ L, 50 pmol of reaction mix 6250 μ L, 50 pmol 3750 μ L of μ L and Nuclease-free water composition；

(3) gained powder is placed in -40~-80 DEG C of preservations.

6. a kind of African swine fever virus detection kit, contains RT- described in molecular probe, claim 4 described in claim 1 RT-PCR reaction solution freeze-dried powder described in PCR reaction solution or claim 5.

7. the application method of African swine fever virus detection kit described in claim 6, which comprises the following steps:

(1) measuring samples DNA is extracted；

(2) RT-PCR reaction solution in African swine fever virus detection kit described in claim 6 is taken or by RT-PCR reaction solution Freeze-dried powder is diluted according to every bottle of water of 1mL Nuclease-free of amount, obtains dilute reaction solution；

8. the application method of African swine fever virus detection kit according to claim 7, which is characterized in that the RT- The response procedures of PCR reaction are as follows: 1 circulation, 50 DEG C of 2 min, 1 circulation, 95 DEG C of 10 min, 40 recycle 95 DEG C 15 second, 58 DEG C of 1 min.

9. the application method of African swine fever virus detection kit described in claim 6, which comprises the following steps:

(1) it takes and quantitatively carries out doubling dilution with standard items；

(2) measuring samples DNA is extracted；

(3) RT-PCR reaction solution in African swine fever virus detection kit described in claim 6 is taken or by RT-PCR reaction solution Freeze-dried powder is diluted according to every bottle of water of 1mL Nuclease-free of amount, obtains dilute reaction solution；

10. the application method of African swine fever virus detection kit according to claim 9, which is characterized in that the RT- The response procedures of PCR reaction are as follows: 1 circulation, 50 DEG C of 2 min, 1 circulation, 95 DEG C of 10 min, 40 recycle 95 DEG C 15 second, 58 DEG C of 1 min.