CN111676327A

CN111676327A - Dual fluorescent quantitative PCR (polymerase chain reaction) detection composition, method and kit for African swine fever virus wild virus infection and gene deletion strain

Info

Publication number: CN111676327A
Application number: CN202010707501.9A
Authority: CN
Inventors: 张改平; 郭振华; 金前跃; 孙亚宁; 李青梅; 杨继飞; 王方雨; 乔松林; 郭军庆
Original assignee: Henan Academy of Agricultural Sciences
Current assignee: Henan Academy of Agricultural Sciences
Priority date: 2020-07-21
Filing date: 2020-07-21
Publication date: 2020-09-18
Anticipated expiration: 2040-07-21
Also published as: CN111676327B

Abstract

The invention relates to a dual-fluorescence quantitative PCR detection composition, a method and a kit for African swine fever virus wild virus infection and gene deletion strains. A double fluorescent quantitative PCR detection method aiming at the B646L gene and the MGF505-2R gene is established by adopting a TaqMan probe fluorescent quantitative detection method, the wild virus infection and the vaccine strain containing MGF505 gene deletion can be effectively distinguished, the method has good specificity, sensitivity and repeatability, and good technical support is provided for the differential diagnosis of the African swine fever wild virus and the vaccine virus; clinical sample detection shows that the method has better consistency with the result of the detection of the wild virus infection by the Saimeifen African swine fever detection kit, and the method can distinguish MGF505 gene deletion strains and has good social application prospect.

Description

Dual fluorescent quantitative PCR (polymerase chain reaction) detection composition, method and kit for African swine fever virus wild virus infection and gene deletion strain

Technical Field

The invention relates to a dual-fluorescence quantitative PCR (polymerase chain reaction) detection composition, a method and a kit for African swine fever virus wild virus infection and gene deletion strains, belonging to the technical field of biology.

Background

African Swine Fever (ASF) is a highly contagious disease of domestic and wild pigs caused by African Swine Fever Virus (ASFV), and is clinically characterized by acute, febrile, hemorrhagic, high morbidity, and high mortality. The world animal health organization lists the animal as a legal report animal epidemic disease; china ranks the animal epidemic diseases as a type of animal epidemic diseases. ASFV was first reported in kenya in 1921, followed by a widespread epidemic in most african countries; historically, ASFV has been prevalent in the European regions of the Western (France, Spain, portugal, etc.) and the American (Brazil) regions, and has been subsequently controlled and decontaminated. In 2007, african swine fever entered grurgia in the caucasian area, and thereafter became prevalent in eastern european countries and russia. In 8 months in 2018, the epidemic situation of the African swine fever is reported in Shenyang areas of China for the first time, then the epidemic situation is widely prevalent in China, unprecedented heavy attacks are brought to the pig industry of China, and the epidemic situation of the African swine fever is also reported in various countries of southeast Asia in 2019, so that the development of the pig industry in the areas is severely restricted and influenced.

ASFV belongs to African swine fever virus family (Asfarviridae), African swine fever virus genus (Asfivirus), and has a genome of double-stranded DNA, a size of about 17.0 to 19.3 ten thousand bases, and encodes about 180 proteins. The African swine fever virus genome has genetic diversity, and at least 24 genotypes (based on the sequence analysis of the B646L gene) and 8 serogroups (based on the serological analysis of the CD2v protein) exist at present. Strains epidemic in China and southeast Asia and strains epidemic in eastern Europe and Russia are of genotype II, and have high genome homology with strains which have the first outbreak of African swine fever epidemic situation in Grougia in 2007.

In addition to establishing a high-level biosafety system, the development of a safe and efficient African swine fever vaccine plays a decisive role in the prevention and control of the African swine fever. The existing research shows that MGF360 and MGF505 are key virulence genes of African swine fever virus, Vivian O' Donnell et al reports that Georgia 2007 isolate strain which knocks out MGF360 and MGF505 has obviously reduced virulence, and can provide good protection against virulent infection; recently, a multigene-deleted African swine fever virus virulence attenuated strain and application thereof as a vaccine (publication number: CN110093324A) are reported by a team leading to high researcher rate in Harbin veterinary institute, the obtained MGF360-505R deletion and gene deletion strains jointly deleted by CD2V and MGF360-505R have good safety through experiments, 100% protection effect can be provided for the infection of epidemic virulent strains in China, and vaccine products developed by the strains enter a clinical test stage and progress smoothly. Therefore, the gene deletion vaccine based on MGF360 and MGF505 gene deletion has a great social application prospect, but the existing detection methods are developed and established based on African swine fever virus infection, and after the gene deletion vaccine is put into use in the future, the existing detection methods cannot distinguish the positive wild virus infection and the positive vaccine immunity, so that the early differential diagnosis of the African swine fever virus infection is seriously influenced. Therefore, a detection method aiming at the African swine fever virus wild virus infection and gene deletion strain is urgently needed to be researched.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a dual-fluorescence quantitative PCR detection composition, a detection method and a kit for African swine fever virus wild virus infection and MGF505 gene deletion strain.

In order to achieve the purpose, the invention adopts the technical scheme that:

a dual-fluorescence quantitative PCR detection composition for African swine fever virus wild virus infection and MGF505 gene deletion strain comprises an upstream primer B646L-F1, a downstream primer B646L-R1 and a probe B646L-P1 of a B646L gene; an upstream primer MGF505-2R-F1, a downstream primer MGF505-2R-R1 and a probe MGF505-2R-P1 of the MGF505-2R gene;

the sequences of the primers and probes are as follows:

the upstream primer B646L-F1: GGGTGCATGTCATTCATCCT, respectively;

the downstream primer B646L-R1: GTCATATCCGTTGCGAGGAA, respectively;

probe B646L-P1: FAM-AGGATGCTCCGATTCAGGGCACGTCCCA-BHQ 1;

the upstream primer MGF 505-2R-F1: AGCTCTTGTTACTGTGGAAGG, respectively;

the downstream primer MGF 505-2R-R1: AAAACGTTCTAAAGCGTGGC, respectively;

probe MGF 505-2R-P1: VIC-ACGCCGTCATAGGAGCCTTGCAGGGTGA-BHQ 1.

The double fluorescence quantitative PCR detection kit for detecting the composition.

Comprises a probe method fluorescence quantitative detection reagent; reference Dye ROX Reference Dye II; an upstream primer B646L-F1, a downstream primer B646L-R1, a probe B646L-P1, an upstream primer MGF505-2R-F1, a downstream primer MGF505-2R-R1 and a probe MGF 505-2R-P1; positive control: the standard plasmids pUC57-B646L and pUC57-MGF 505-2R; negative control: double distilled water.

The probe method fluorescent quantitative detection reagent is a probe method qPCR reaction premixed reagent PremixEx Taq.

The gene copy number of the standard plasmid pUC57-B646L is 2.9 × 10⁹Copy/microliter, the gene copy number of the standard plasmid pUC57-MGF505-2R is 1.5 × 10⁹Copy/microliter.

The double fluorescent quantitative PCR detection method comprises the following steps:

(1) extracting a DNA template of a sample to be detected;

(2) establishing a double fluorescent quantitative PCR reaction system;

(3) performing fluorescent quantitative PCR detection and generating a standard curve;

(4) and analyzing the result of the sample to be tested.

The dual fluorescent quantitative PCR reaction system is 25 mu L, the mixture of an upstream primer B646L-F1, a downstream primer B646L-R1, an upstream primer MGF505-2R-F1 and a downstream primer MGF505-2R-R1 is 2 mu L in total, the mixture of a probe B646L-P1 and a probe MGF505-2R-P1 is 1 mu L in total, a probe method qPCR reaction premixing reagent PremixEx Taq 12.5 mu L, an internal Reference Dye ROX Reference Dye II 0.2 mu L, the mixture of a standard plasmid 57-B646L and pUC57-MGF505-2R is 2 mu L or a DNA template of a sample to be detected is 5 mu L, and double distilled water is added to make up to 25 mu L.

The volume of each primer and probe was 0.5. mu.L, the final concentration of each primer and probe was 0.2. mu.M, and the volume of each standard plasmid pUC57-B646L, pUC57-MGF505-2R was 1. mu.L.

The reaction conditions of the reaction system are pre-denaturation at 95 ℃ for 20s, denaturation at 95 ℃ for 3s, annealing at 60 ℃ for 30s and 40 cycles.

The invention has the beneficial effects that:

the invention adopts TaqMan probe fluorescent quantitative detection method widely used in ASFV nucleic acid detection diagnosis at present, establishes a double fluorescent quantitative PCR detection method aiming at B646L gene and MGF505-2R gene, can effectively distinguish field virus infection and vaccine strain containing MGF505 gene deletion, has good specificity, sensitivity and repeatability, and provides good technical support for the differential diagnosis of African swine fever field virus and vaccine virus; clinical sample detection shows that the method and the Sammerfei African swine fever detection kit (Vetmax)^TMASFV Detection Kit) has good consistency in the result of detecting wild virus infection, and the method can further distinguish MGF505 gene deletion strains, thereby having good social application prospect.

Drawings

FIG. 1 shows the conservation of the primer and probe sequences of the present invention in an epidemic strain of ASFV;

A) B646L gene primer and probe sequence alignment; B) MGF505-2R gene primer and probe sequence alignment;

FIG. 2 is a standard curve for the dual fluorescent quantitative PCR assay of the present invention;

A) template concentration of 5.8 × 10⁷-5.8×10¹Copy B) template concentration of 3.0 × 10⁷-3.0×10¹Copying;

FIG. 3 is a specific analysis curve of the dual fluorescent quantitative PCR detection method of the present invention;

FIG. 4 is a graph of sensitivity analysis of the dual fluorescent quantitative PCR detection method of the present invention;

A) pUC57-B646L gene amplification sensitivity analysis, 1-9: 5.8 × 10⁸-5.8×10⁰Copying;

B) pUC57-MGF505-2R gene amplification sensitivity analysis, 1-9: 3.0 × 10⁸-3.0×10⁰And (6) copying.

Detailed Description

The following examples further illustrate the embodiments of the present invention in detail.

Experimental materials used in the practice of the invention:

(1) viral nucleic acids

Porcine Epidemic Diarrhea Virus (PEDV) cDNA, porcine transmissible gastroenteritis virus (TGEV) cDNA, Classical Swine Fever Virus (CSFV) cDNA, Japanese Encephalitis Virus (JEV) cDNA, porcine pseudorabies virus (PRV) DNA, porcine circovirus type 2 (PCV2) DNA, porcine reproductive and respiratory syndrome virus HN07-1(Accession No. KX766378) and HNhx (Accession No. KX766379) cDNA, porcine Seneca virus cDNA (Accession No. MK357116) were stored by the laboratory.

(2) Main reagent and instrument

Virus nucleic acid Extraction kit (TaKaRa MiniBEST Viral RNA/DNA Extraction KitVer.5.0), reverse transcription reagent (PrimeScript)^TMRT Master Mix), DNA polymerase (Prime)

MaxAxAymerase) and probe-based fluorescent quantitative detection reagent (PremixEx Taq^TM) And reference dye ROX referenceDyeII were purchased from TaKaRa, Inc. (Beijing). African Swine Fever fluorescent quantitative Detection Kit (VetMAXTM African Swine river Virus Detection Kit) was purchased from Saimer Feishi Scientific Co., Ltd (Thermo Fisher Scientific). Fluorescent quantitative PCR detection was performed using ABI7500Fast Real-Time PCR System.

Example 1 design and Synthesis of primers and probes

According to the published ASFV genome sequence in NCBI GenBank data, B646L and MGF505-2R gene sequences (table 1) of China epidemic strain Pig/HLJ/2018(Accession No. MK333180) are selected, and Primer3Plus (http:// www.primer3plus.com) software is used for designing primers and probes. The primers and probes were synthesized by Biotechnology engineering (Shanghai) Ltd, and the primers and probes were diluted to 10. mu. mol/L with sterile water and stored at-20 ℃.

TABLE 1 primer and Probe information

Primers and probes were further evaluated for sequence conservation in the circulating strains using the DNAstar Megalign software, the selected strains are shown in Table 2, and the results are shown in FIG. 1. The gene sequence comparison analysis of the gene sequences of the MGF505-2R and the gene sequences of the B646L in the figure 1 shows that the primer and the probe sequences designed by the invention are highly conserved in gene II type ASFV strains prevalent in China and eastern Europe. However, compared with the genotype I ASFV strain, there were 1-base mutations in the upstream primer and probe for the B646L gene (A345G, T376G), and 1-base mutation in the probe for the MGF505-2R gene (T265C). Therefore, the primer and probe combination can be used for detecting the main epidemic strain of ASFV.

Table 2 reference strain sequence information

Example 2 selection of Positive control in kit

Standard plasmids pUC57-B646L and pUC57-MGF505-2R were synthesized by Biotechnology, Inc. (Shanghai), stored in the laboratory, and the concentration of the standard plasmid was measured by NanoDrop One (Thermo Fisher Scientific) and the gene copy number was calculated as Y (copies/. mu.L) ═ concentration of plasmid DNA (ng/. mu.L) × 10^-9/(plasmid DNA length bp × 660)]×6.02×10²³. Determined, the base of the standard plasmidSince the copy numbers are respectively 2.9 × 10⁹copies/. mu.L (pUC57-B646L) and 1.5 × 10⁹copies/μL(pUC57-MGF505-2R)。

Example 3 establishment of Dual fluorescent quantitative PCR detection method

(1) Composition of double fluorescent quantitative PCR detection kit

The double fluorescence quantitative PCR detection kit comprises a probe method fluorescence quantitative detection reagent (a probe method qPCR reaction premixed reagent Premix Premix Ex Taq); reference Dye ROX Reference Dye II; an upstream primer B646L-F1, a downstream primer B646L-R1, a probe B646L-P1, an upstream primer MGF505-2R-F1, a downstream primer MGF505-2R-R1 and a probe MGF 505-2R-P1; positive control: the standard plasmids pUC57-B646L and pUC57-MGF 505-2; negative control: double distilled water.

(2) Establishment of a Standard Curve

Through preliminary screening, the reaction system of the double fluorescent quantitative PCR is determined to be 25 muL, and comprises 2 muL of the primer mixture, 1 muL of the probe mixture (the final reaction concentration of each primer and probe is 0.2 muM, and the volume of each primer and probe is 0.5 muL), 12.5 muL of PremixEx Taq as a pre-mixing reagent of the probe method qPCR reaction, 0.2 muL of an internal Reference Dye ROX Reference Dye II, and 2 muL of a standard plasmid pUC57-B646L and pUC57-MGF505-2R mixture (the volume of each standard plasmid is 1 muL) diluted by 10 times, and the reaction system is filled to 25 muL by double distilled water.

The reaction conditions were pre-denaturation at 95 ℃ for 20s, denaturation at 95 ℃ for 3s, annealing at 60 ℃ for 30s, and 40 cycles. Fluorescent quantitative PCR detection was performed using ABI7500Fast Real-Time PCR System and a standard curve was generated.

As shown in FIG. 2, when the template copy number is 10⁷-10¹When the detection range is within the range, the established double fluorescence quantitative PCR detection method can obtain a good amplification kinetic curve. The standard curve for the primer probe for B646L was-3.149 x +36.146, R²0.999, the amplification efficiency was 107.764% (fig. 2A); the standard curve corresponding to the primer probe aiming at MGF505-2R is-3.223 x +37.042, R²The amplification efficiency was 104.283% (fig. 2B) at 0.999.

Example 4 specific assay experiments

cDNA of PEDV, TGEV, CSFV, JEV, PRRSV (HN07-1, HNhx) and SVA, DNA of PRV and PCV2 are used as templates, and positive control using pUC57-B646L and pUC57-MGF505-2R standard plasmids as templates and negative control using double distilled water as a template are simultaneously established. And (4) carrying out fluorescent quantitative PCR detection, and evaluating the specificity of the established detection method.

As shown in FIG. 3, the positive control group using pUC57-B646L and pUC57-MGF505-2R standard plasmids as templates showed a specific amplification curve, while the samples containing other pathogenic cDNA or DNA showed no amplification curve, and the detection was negative, indicating that the dual fluorescence quantitative PCR detection method established by the invention has good specificity.

Example 5 sensitivity assay

The pUC57-B646L and pUC57-MGF505-2R recombinant plasmid standard substances are respectively diluted by 10 times, 2 mu L of each diluted group is respectively taken as a template of the double fluorescence quantitative PCR detection method, and the double fluorescence quantitative PCR established by the invention is used for amplification.

As shown in FIG. 4, when the concentration of the plasmid pUC57-B646L was as low as 5.8 copies (FIG. 4A) and the concentration of the plasmid pUC57-MGF505-2R was as low as 3.0 copies (FIG. 4B), a good specific amplification curve was still observed. According to the repeated results of 3 experiments, the judgment result is positive when the Ct value is less than or equal to 35, and the judgment result is negative when the Ct value is more than or equal to 36. When 35< Ct value <36, it is judged suspicious.

Example 6 repeatability experiments

And respectively selecting standard plasmids with 7 continuous dilutions, performing 3 batches of repeated detection by using the established double-fluorescence quantitative PCR, setting 3 repeats for each dilution in each batch, and calculating standard deviation and variation coefficient between groups to evaluate the stability of the established detection method.

The results are shown in Table 3, in which the intra-group coefficient of variation is 0.3% to 1.7%; the interclass variation coefficient is 0.1-2.4%, which shows that the established fluorescence quantitative detection method has good stability.

TABLE 3 repeatability analysis of the Dual fluorescent quantitative PCR detection method

Attached: ct mean is the average value of Ct values; ct SD is the standard deviation of Ct values; CV% is the coefficient of variation.

Example 7 clinical sample testing

A total of 26 DNA samples extracted from blood samples of suspected ASFV-infected pig farms were selected, and the DNA samples were provided by Zheng Zhongzhou Zhongdao Biotechnology Co., Ltd. The double fluorescent quantitative PCR detection method established by the invention is used for detection, wherein the reaction system is as follows: using 5. mu.L of the DNA sample to be tested as a template, 2. mu.L of the above primer mixture, 1. mu.L of the probe mixture (final reaction concentration of each primer and probe is 0.2. mu.M, and volumes of each primer and probe are 0.5. mu.L), 12.5. mu.L of Premix Ex Taq, 0.2. mu.L of ROXRference Dye II, and up to 25. mu.L of double distilled water, the reaction conditions were the same as in example 3. Meanwhile, an African swine fever detection kit of Saimer Feishale is used for parallel detection.

The results are shown in Table 4, when the method provided by the invention is used for detecting wild virus infection, the detection result of a clinical sample is better consistent with that of an African swine fever detection kit of Saimer Feishale, the method can be used for detecting the clinical sample, and the method can distinguish MGF505 gene deletion strain and has good social application prospect.

TABLE 4 clinical sample test results

Attached: "-" indicates that no detection of MGF505-2R was performed; "undetermined" means that no Ct value was detected.

Sequence listing

<110> agricultural science institute of Henan province

<120> African swine fever virus wild virus infection and gene deletion strain dual-fluorescence quantitative PCR detection composition, method and kit

<130> PCR assay

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Synthesis ()

<400>1

gggtgcatgt cattcatcct 20

<210>2

<211>20

<212>DNA

<213> Artificial Synthesis ()

<400>2

gtcatatccg ttgcgaggaa 20

<210>3

<211>28

<212>DNA

<213> Artificial Synthesis ()

<400>3

aggatgctcc gattcagggc acgtccca 28

<210>4

<211>21

<212>DNA

<213> Artificial Synthesis ()

<400>4

agctcttgtt actgtggaag g 21

<210>5

<211>20

<212>DNA

<213> Artificial Synthesis ()

<400>5

aaaacgttct aaagcgtggc 20

<210>6

<211>28

<212>DNA

<213> Artificial Synthesis ()

<400>6

acgccgtcat aggagccttg cagggtga 28

Claims

1. A dual-fluorescence quantitative PCR detection composition for African swine fever virus wild virus infection and MGF505 gene deletion strain is characterized by comprising an upstream primer B646L-F1, a downstream primer B646L-R1 and a probe B646L-P1 of a B646L gene; an upstream primer MGF505-2R-F1, a downstream primer MGF505-2R-R1 and a probe MGF505-2R-P1 of the MGF505-2R gene;

the sequences of the primers and probes are as follows:

the upstream primer B646L-F1: GGGTGCATGTCATTCATCCT, respectively;

the downstream primer B646L-R1: GTCATATCCGTTGCGAGGAA, respectively;

probe B646L-P1: FAM-AGGATGCTCCGATTCAGGGCACGTCCCA-BHQ 1;

the upstream primer MGF 505-2R-F1: AGCTCTTGTTACTGTGGAAGG, respectively;

the downstream primer MGF 505-2R-R1: AAAACGTTCTAAAGCGTGGC, respectively;

probe MGF 505-2R-P1: VIC-ACGCCGTCATAGGAGCCTTGCAGGGTGA-BHQ 1.

2. A dual fluorescent quantitative PCR detection kit of the detection composition of claim 1.

3. The dual fluorescent quantitative PCR detection kit of claim 2, comprising a probe fluorescent quantitative detection reagent; reference Dye ROX Reference Dye II; an upstream primer B646L-F1, a downstream primer B646L-R1, a probe B646L-P1, an upstream primer MGF505-2R-F1, a downstream primer MGF505-2R-R1 and a probe MGF 505-2R-P1; positive control: the standard plasmids pUC57-B646L and pUC57-MGF 505-2R; negative control: double distilled water.

4. The dual fluorescent quantitative PCR detection kit of claim 3, wherein the probe method fluorescent quantitative detection reagent is a probe method qPCR reaction premixed reagent PremixEx Taq.

5. The dual fluorescent quantitative PCR detection kit of claim 3, wherein the gene copy number of the standard plasmid pUC57-B646L is 2.9 × 10⁹Copy/microliterThe gene copy number of the standard plasmid pUC57-MGF505-2R is 1.5 × 10⁹Copy/microliter.

6. The dual fluorescent quantitative PCR detection method of claim 1, comprising the steps of:

(1) extracting a DNA template of a sample to be detected;

(2) establishing a double fluorescent quantitative PCR reaction system;

(4) and analyzing the result of the sample to be tested.

7. The dual fluorescent quantitative PCR detection method of claim 6, wherein the dual fluorescent quantitative PCR reaction system is 25 μ L, 2 μ L of the mixture of the upstream primer B646L-F1, the downstream primer B646L-R1, the upstream primer MGF505-2R-F1 and the downstream primer MGF505-2R-R1, 1 μ L of the mixture of the probe B646L-P1 and the probe MGF505-2R-P1, 12.5 μ L of the premixed reagent PremixEx Taq for probe qPCR reaction, 0.2 μ L of the internal Reference Dye ROX Reference Dye II, 2 μ L of the mixture of the standard plasmids pUC57-B646L and pUC57-MGF505-2R or 5 μ L of the DNA template of the sample to be detected, and adding double distilled water to make up to 25 μ L.

8. The method for detecting double fluorescent quantitative PCR of claim 7, wherein the volume of each primer and probe is 0.5. mu.L, the final concentration of each primer and probe in the reaction is 0.2. mu.M, and the volume of each standard plasmid pUC57-B646L, pUC57-MGF505-2R is 1. mu.L.

9. The dual fluorescent quantitative PCR detection method of claim 7, wherein the reaction conditions of the reaction system are pre-denaturation at 95 ℃ for 20s, denaturation at 95 ℃ for 3s, annealing at 60 ℃ for 30s, and 40 cycles.