CN115449563A - Multiple fluorescence detection primer probe set and kit for new coronavirus Onckrozen variant strain - Google Patents

Abstract

The invention provides a multi-fluorescence detection primer probe set and a kit aiming at new coronavirus Oncuronan variant strain. The invention has the following technical effects: 1. the cost is low, and the total reagent cost of a single specimen is 12 yuan. 2. The detection time is short, the operation is simple, the required experiment operation is simpler, the universal reagent and the primer probe working solution can be used for detecting on a computer, and whether the SARS-CoV-2 infection and the Ormcken variant infection exist can be judged simultaneously, and the total detection time is about 1.5 hours. Simple operation process, conventional fluorescence detector equipment and basic units can be developed. 3. The sensitivity is high, the kit can be applied to environmental sample detection, the environmental sample amount is large, the virus carrying capacity is low, and great difficulty is caused to detection work. High-throughput sequencing is difficult to perform due to low viral load of an environmental sample, and the method can also be characterized to Ormcken variant strains when the environmental sample is detected.

Description

Multi-fluorescence detection primer probe set and kit for new coronavirus Ormcken variant strain

Technical Field

The invention relates to a multiple fluorescence detection primer probe group and a kit aiming at an Oncorks variant strain of new coronavirus, belonging to the technical field of biology.

Background

Research shows that the Ormckron variant strain has more mutations and high variant speed (currently, four types of BA.1, BA.2, BA.3 and BA.1.1 are detected at home) compared with wild strains or other VOCs, and is likely to generate stronger infectivity and immune escape capability than Delta mutant strains, reduce the efficacy of vaccines and neutralizing antibodies and increase the risk of reinfection, thereby providing a new challenge for the prevention and control of global epidemic situation. Therefore, the rapid detection of infection of the Ormcken variant strain and the timely prevention and control become urgent problems to be solved. However, the current mainstream detection method is high-throughput sequencing, and the economic cost is high and the time is long. Meanwhile, an individual fluorescence detection kit is low in flux, high in manufacturing cost and complex in operation, new coronavirus positive needs to be detected in advance, then the kit is used for special Oncorker variant detection, many basic level detection units are difficult to carry out the Oncorker detection in the first time based on the reasons, and the precious prevention and control time and the establishment of prevention and control strategies are delayed.

The existing Onckronron fluorescence detection kit on the market detects specific several variation sites, the cost is high, about 10000 yuan for 50 people, and the reagent cost of a single specimen is 200 yuan. In addition, the high-throughput sequencing method is higher in cost, and the reagent cost of a single specimen is 2000 yuan.

The existing Ormcken fluorescence kit is complex to operate. The fluorescence detection of SARS-CoV-2 needs to be developed, when SARS-CoV-2 is positive, the specimen is detected by the kit, when several variation sites are positive, the specimen is determined to be Onckrojon infection, and the total detection time is about 4 hours. High throughput sequencing times can be as long as 20 hours.

Chinese patent CN202111497771.2 provides a new coronavirus Ormcken mutation sequence detection technology based on a multiple fluorescence quantitative ARMS-PCR technology and application thereof, and mainly aims at the specific mutation types of the S gene of the Ormcken variant strain such as sequence position 23599, sequence change T > G, sequence position 23048, sequence change G > A, sequence position 23202, sequence change C > A, sequence position 22898 and sequence change G > A to carry out single-tube or multi-tube multiple detection based on the fluorescence quantitative ARMS-PCR technology.

Although Chinese patent CN202111497771.2 provides a technical solution for detecting the mutant sequence of Ormcken based on multiple fluorescence quantitative ARMS-PCR technology, it has the following technical problems: 1) The mutation speed of Ormckren is much higher than that of other variant strains because the S region is the gene region with the most active SARS-CoV-2 mutation, so that when the nucleotide of the target site is changed, the detection only for the single site can cause false negative; 2) The patent application time is 2021, 12 months, the variation strain of Ormckron is less, and only BA.1 is one type, but four types of BA.1, BA.2, BA.3 and BA.1.1 appear globally by 2 months and 10 days in 2022, and the variation among the types is large, so that the effectiveness of the technology is difficult to ensure; 3) Other kits are needed to detect the SARS-CoV-2 positivity, and then the kit is used to judge whether the infection is Onck Ron, the operation is complicated and the cost is high.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a multiple fluorescence detection primer probe set and a kit aiming at an Ormcken variant strain of new coronavirus.

The inventor designs a multiple fluorescence detection primer probe group and a kit aiming at the Ormcken variant strain, which can simultaneously detect three gene fragments of SARS-CoV-2, namely ORF1a/b gene and N gene for judging SARS-CoV-2 infection and S gene for judging the infection of the Ormcken variant strain. Among them, ORF1a/b gene and N gene primers for determination of SARS-CoV-2 infection were designed by researchers at the United states disease control center and university of Rousin, angria, UK, and S gene primer probes for detection of infection by Onck Ron variant were designed by the inventors. The S-F primer is located at 22976-22996 nucleotide sites of the whole genome, the S-R primer is located at 23058-23078 nucleotide sites of the whole genome, and the S-Probe primer is located at 22998-23023 nucleotide sites of the whole genome.

In the present invention, the nucleotide sequence of the multiplex fluorescence detection primer probe set for the Ormcken variant strain of the new coronavirus is shown in the following table:

name (R)	Sequence of	Decoration
			ORF1a/b-F	GGATCAAGAATCCTTTGGTGG
ORF1a/b-R	GTCACAAAATCCTTTAGGATTTGGA
			ORF1a/b-Probe	CATCGTGTTGTCTGTACTGCCGTTGCC	5’FAM/BHQ1 3’
N-F	GACCCCAAAATCAGCGAAAT
			N-R	TCTGGTTACTGCCAGTTGAATCTG
N-Probe	ACCCCGCATTACGTTTGGTGGACC	5’VIC/BHQ1 3’
			S-F	ACTGAAATCTATCAGGCCGGT
S-R	CAACACCATAAGTGGGTCGGA
			S-Probe	ACAAACCTTGTAATGGTGTTGCAGGT	5’CY5/BHQ2 3’

Wherein, the first and the second end of the pipe are connected with each other,

the fluorescent probe is an oligonucleotide probe with a fluorophore attached to the 5 'end of the probe and a quencher attached to the 3' end of the probe. The fluorescent group for detecting ORF1a/b gene is FAM, and the quenching group is BHQ1. The fluorescent group for detecting the N gene is VIC, and the quenching group is BHQ1. The fluorescent group for detecting the S gene is CY5, and the quenching group is BHQ2.

The invention also provides a multiple fluorescence detection kit for the new coronavirus Ormckh variant strain, which comprises the multiple fluorescence detection primer probe group for the new coronavirus Ormckh variant strain.

Further, the Kit also comprises a multiplex fluorescence detection reagent, and the multiplex fluorescence detection reagent can be a market universal multiplex fluorescence detection reagent, such as HiScript II U + One Step qRT-PCR Probe Kit reagent produced by Nanjing nuozokenza.

The invention also provides a preparation method of the primer probe set working solution, which comprises the following steps:

1) The synthesized primer probe dry powder and the RNase-free water are prepared into a working concentration of 10 micromoles/liter.

2) Primer probe sets for detecting ORF1a/b gene, N gene and S gene were separately identified according to the upstream primer: a downstream primer: preparing three probe primer mixed solutions according to the volume ratio of the probes as 2; in the present invention, the upstream primer: a downstream primer: the volume ratio of the probe added was 400.

3) And finally, mixing the three probe primer mixed solutions in equal volume to prepare the primer probe working solution.

During detection, the universal multiple fluorescence detection reagent and the primer probe working solution of the invention can be used for on-machine detection, and can simultaneously judge whether SARS-CoV-2 infection and Ormcken variant infection exist.

The purpose of the invention is realized by the following technical scheme: PCR primers and fluorescent Taqman probes were designed for the gene-conserved sequence of the specific Ormckrolon variant. A nucleotide probe with two ends marked with fluorescent dye groups is added on the basis of conventional PCR, wherein the fluorescent group is at the 5 'end, the quenching group is at the 3' end, and the fluorescent group and the quenching group form an energy transfer structure. When the probe is complete, the fluorescent group is inhibited by the quenching group and does not generate fluorescence, when the probe is combined with the target sequence, the upstream primer extends to the position, the probe is hydrolyzed under the action of exoenzyme, and the fluorescent signal of the fluorescent group is released and collected and detected by an instrument, so that the existence of the target sequence is prompted. The inventor also adds the fluorescent probe primer sequence of ORF1a/b gene and N gene for determining SARS-CoV-2 infection, thereby forming a combination, and by utilizing the real-time property, high sensitivity and good specificity of the fluorescent PCR technology, the SARS-CoV-2 infection and the infection of Onck Rongron variant strain can be determined intuitively and rapidly at the end of the reaction and even before the reaction is ended. In addition, CY5 is selected as the fluorescent group of the S gene, BHQ2 is selected as the quenching group instead of BHQ1, and the stability and the amplification efficiency of the S gene are improved.

The multi-fluorescence detection primer probe group and the kit aiming at the Ormcken variant strain have the following technical effects:

1. the manufacturing cost is low.

In the primer synthesis, only the price of the probe is slightly high, the three genes consist of 6 primers and 3 probes, each primer only needs dozens of yuan, the number of the probes is about 1500 yuan, the total synthesis cost is about 5000 yuan, 1200 specimens can be detected by calculating the lowest synthesized 1 OD, and the cost of each specimen is about 4 yuan. The kit is a universal multiple fluorescence detection kit, the 100 persons are about 800 yuan, and the cost of each specimen is about 8 yuan. Therefore, the overall reagent cost for a single specimen is 12 dollars. The Onckronjon fluorescence detection kit on the market at present detects specific several variation sites, the cost is expensive, about 10000 yuan for 50 persons, and the cost of the reagent for a single specimen is 200 yuan, which is 16 times of that of the invention. In addition, the high-throughput sequencing method is more expensive, and the reagent cost of a single sample is 2000 yuan. In the present invention, hiScript II U + One Step qRT-PCR Probe Kit produced by Nanjing Novozam was selected. The kit is 100 parts, and the result is still not obviously changed when the inventor reduces one third of the original amount, so that the kit for 100 parts can detect 300 specimens, and the actual cost is lower.

2. Short detection time and simple operation

The existing Ormcken fluorescence kit is complex to operate. The fluorescence detection of SARS-CoV-2 needs to be developed, when SARS-CoV-2 is positive, the specimen is detected by the kit, when several variation sites are positive, the specimen is determined to be Onckrojon infection, and the total detection time is about 4 hours. Compared with a fluorescence kit for detecting the mutant site of the Onckrojon, the invention has the advantages that the required experimental operation is simpler and more convenient, the universal reagent and the primer probe working solution can be used for on-machine detection, the SARS-CoV-2 infection and whether the mutant strain of the Onckrojon is infected can be judged simultaneously, and the total detection time is about 1.5 hours. High throughput sequencing times can be as long as 20 hours. It is also clear from the result judgment that only the cycle numbers (Ct values) of three channels need to be considered. Simple operation process, conventional fluorescence detector equipment and basic units can be developed.

3. High sensitivity, good specificity and good repeatability, and can be applied to environmental sample detection

The present invention is designed based on the S-region sequences of all Onckrojon genotypes that are present globally, and all Onckrojon variants of all types can be detected theoretically. In practical application, the inventors tested all the ormikrong variants in Jiangsu (including three types BA.1, BA.2 and BA.1.1), and compared the Alpha (B.1.1.7) variant and Delta (B.1.617.2) variant, it was shown that the sensitivity and specificity were 100%. When the weekly new coronavirus specimen is subjected to rechecking, the result is found to be completely consistent with the sequencing result, and the good stability and repeatability are shown. In addition, the environment sample is detected in the place which can best show the advantage of sensitivity. The environmental sample amount is large, the virus carrying capacity is low, and great difficulty is caused to the detection work. Environmental sample is difficult to carry out high-throughput sequencing due to low virus load, but the current situation is that the infected places basically have environmental pollution, and whether the infection of the Onckronen variant strain is provided or not cannot be provided due to the failure of sequencing. The method can detect the infection of the Ormcken variant strain when detecting the environmental sample, the detection result is completely consistent with the epidemiology traceability investigation result, and the sensitivity and the specificity are both 100 percent.

Drawings

FIG. 1 shows the results of the detection of a sample of a patient of type B.1.1.7 of Alpha variant.

FIG. 2 shows the results of testing samples of patients of type B.1.617.2 with Delta variant.

FIG. 3 shows the results of the sample examination of Ormckrolon variant strain BA.1 type patient.

FIG. 4 shows the results of the specimen examination of Ormcken variant BA.2 type patients.

FIG. 5 shows the results of the sample examination of Ormcken variant strain BA.1.1 type patient.

FIG. 6 shows the results of detection of environmental samples 1 (infection with Delta variant).

FIG. 7 shows the results of environmental sample test 2 (infection by Ormckrolon variant strain).

FIG. 8 shows the results of specificity tests (influenza virus, enterovirus, rotavirus and norovirus).

FIG. 9 shows the results of a comprehensive comparison of Delta variant B.1.617.2 type patient samples, onckronk variant BA.1.1 type patient samples and Onconk variant infection environment samples.

Detailed Description

The following are specific embodiments of the present invention and are further described with reference to the accompanying drawings, but the present invention is not limited to these embodiments.

Example 1

1. Designing a primer probe:

the inventor searches and downloads the fluorescence detection literature about the new coronavirus in 2020, synthesizes corresponding probe primers to carry out experimental detection, and finally screens 11 groups of amplification primers of ORF1a/b and N genes for ORF1a/b gene primers designed by the American center for disease control and N gene primers designed by researchers at the university of Roche of Angria, england.

The primers for detecting the mutant strain of Onckrojon designed by the inventor are obtained by downloading the sequences of the Onckrojon of all gene types (including four types of BA.1, BA.2, BA.3 and BA.1.1), comparing and analyzing 26 gene fragments, and finally designing 20 pairs of primer probes in the S region and 10 pairs of primer probes in the N region. The primer probes were subjected to specific alignment analysis by NCBI BLAST online database. The primers with high PCR efficiency, high sensitivity, good specificity and good stability are screened, and finally 1 pair of primers of the S region which can be used for judging the infection of the Ormcken variant strain and the corresponding probe sequence are obtained. Meanwhile, the quenching group is changed from BH1 to BH2, so that the stability and the amplification efficiency are improved.

TABLE 1 primer Probe sequences for multiplex fluorescence detection of Ormcken variant strains

2. Kit for multiple fluorescence detection of Ormcknon variant strain

The Kit for multiple fluorescence detection of the Ormcken variant strain comprises the primer Probe set and multiple fluorescence detection reagents, wherein the multiple fluorescence detection reagents can be selected from currently-used multiple fluorescence detection reagents in the market, and the Kit for HiScript II U + One Step qRT-PCR Probe produced by Nanjing Nuozhen is selected by the inventor.

The primer probe group is used as primer probe working solution by the following preparation method:

1) The primer probe synthetic dry powder is added with RNase-free water to prepare a working concentration of 10 micromoles/liter.

2) According to an upstream primer: a downstream primer: the probe-primer mixture was prepared at a probe volume ratio of 2.

3) And finally, mixing the three mixed solutions in equal volume to prepare the primer probe working solution.

During detection, the universal multiple fluorescent detection reagent and prepared primer probe working solution can be used for on-machine detection, and can simultaneously judge SARS-CoV-2 infection and whether Onck Ron variant strain infection exists.

3. The detection process is as follows:

3.1 preparation of the system

The experimental system formulation was carried out in the system formulation laboratory. The present inventors selected the HiScript II U + One Step qRT-PCR Probe Kit produced by Nanjing Novozan. The system formulation is shown in table 2:

TABLE 2 PCR reaction System

After the system is prepared, the mixture is shaken, evenly mixed and centrifuged, and the mixture is subpackaged into PCR reaction tubes according to 10 mu L/person.

3.2 sample handling

The sample nucleic acid to be tested, the positive control and the negative control are added into the prepared PCR reaction tube in a sample adding chamber, the volume is respectively 2.5 mu L, the final volume is 12.5 mu L, a tube cover is tightly covered, and the tube cover is vibrated and centrifuged. Wherein the sample is new coronavirus nucleic acid owned by the inventor's laboratory, the types include Oncurong variant strains BA.1, BA.2 and BA.1.1, other types include Alpha variant strain B.1.1.7 and Delta variant strain B.1.617.2, and the source includes patient sample and external environment sample. In addition, the kit also comprises nucleic acid samples such as influenza virus, enterovirus, rotavirus, norovirus and the like for specific detection. The positive control is an Ormcken Ron variant strain BA.1 nucleic acid which is successfully sequenced. Negative control was rnase-free water.

3.3 PCR amplification

And (3) putting the PCR reaction tube into an ABI QuantStudio Q5 fluorescent quantitative PCR instrument for amplification detection without ROX correction. The fluorophores are FAM, VIC and CY5 respectively. The cycle parameter settings are shown in table 3:

TABLE 3 reaction procedure

3.4. Analysis of results

The negative control had no fluorescence curve and the positive control had three smooth curves. The specimen fluorescence curve is smooth, and the cycle number (Ct value) is less than 38, so that the specimen is judged to be positive, otherwise, the specimen is negative. When only one of FAM and VIC is Ct ≦ 38, retesting is required regardless of whether CY5 has Ct ≦ 38. The specific determination results are shown in table 4:

TABLE 4 determination of results

(1) As a result of the sample detection of the Alpha variant B.1.1.7 type patient, the curves of FAM and VIC channels and Ct less than or equal to 38 indicate that the strain is SARS-CoV-2 infection, but not an Onckrojon variant. See FIG. 1

(2) The detection result of sample of Delta variant B.1.617.2 type patient shows that FAM and VIC channels have curves and Ct is less than or equal to 38, which indicates SARS-CoV-2 infection, but not Ormcken variant. See FIG. 2

(3) The result of the sample test of the Ormckhen variant strain BA.1 type patient shows that the FAM, VIC and CY5 channels have curves and Ct is less than or equal to 38, which indicates that the Ormckhen variant strain is infected by SARS-CoV-2 and is the Ormckhen variant strain. See FIG. 3

(4) The result of the sample test of the Ormckhen variant strain BA.2 type patient shows that the FAM, VIC and CY5 channels have curves and Ct is less than or equal to 38, which indicates that the Ormckhen variant strain is SARS-CoV-2 infection and is the Ormckhen variant strain. See FIG. 4

(5) The result of sample test of the Ormckhen variant strain BA.1.1 type patient shows that the FAM, VIC and CY5 channels all have curves and Ct is less than or equal to 38, which indicates that the Ormckhen variant strain is SARS-CoV-2 infection and is the Ormckhen variant strain. See FIG. 5

(6) The result of environmental sample detection 1 (Delta variant infection), FAM and VIC channels appeared and Ct is less than or equal to 38, which indicates SARS-CoV-2 infection, but not Onckrojon variant. See FIG. 6

(7) The result of environmental sample detection 2 (infection of Ormcken variant), curves appeared in FAM, VIC and CY5 channels and Ct is less than or equal to 38, which indicates SARS-CoV-2 infection and is Ormcken variant. See FIG. 7

(8) Specificity tests (influenza virus, enterovirus, rotavirus and norovirus) show that FAM, VIC and CY5 channels have no curves, which indicates that the primer combination does not react with other virus nucleic acids. See fig. 8

(9) The results of the comprehensive comparison of the sample of the Delta variant B.1.617.2 type patient, the sample of the Ormcken variant BA.1.1 type patient and the sample of the infection environment of the Ormcken variant show that the FAM and VIC channels of the sample of the Delta variant B.1.617.2 type patient show curves and Ct is less than or equal to 38, which indicates SARS-CoV-2 infection; the samples of the Onckronk variant strain BA.1.1 and the samples of the Onconk variant strain infected with the environment, such as FAM, VIC and CY5 channels, have curves with Ct less than or equal to 38, which indicate that the strain is infected by SARS-CoV-2 and is the Onconk variant strain. See fig. 9

The above embodiments are merely illustrative of the technical ideas and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.

Sequence listing

<110> Jiangsu province disease prevention and control center (Jiangsu province public health research institute)

<120> a multiple fluorescence detection primer probe set and kit for new coronavirus Ormkuronan variant strain

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggatcaagaa tcctttggtg g 21

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtcacaaaat cctttaggat ttgga 25

<210> 3

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catcgtgttg tctgtactgc cgttgcc 27

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaccccaaaa tcagcgaaat 20

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctggttact gccagttgaa tctg 24

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

accccgcatt acgtttggtg gacc 24

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

actgaaatct atcaggccgg t 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caacaccata agtgggtcgg a 21

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acaaaccttg taatggtgtt gcaggt 26

Claims (6)

1. A multiplex fluorescence detection primer probe set for an olmcuronan variant of new coronavirus, wherein the nucleotide sequence of said primer probe set is as shown in the following table:

name (R) Sequence of SEQ ID NO ORF1a/b-F GGATCAAGAATCCTTTGGTGG 1 ORF1a/b-R GTCACAAAATCCTTTAGGATTTGGA 2 ORF1a/b-Probe CATCGTGTTGTCTGTACTGCCGTTGCC 3 N-F GACCCCAAAATCAGCGAAAT 4 N-R TCTGGTTACTGCCAGTTGAATCTG 5 N-Probe ACCCCGCATTACGTTTGGTGGACC 6 S-F ACTGAAATCTATCAGGCCGGT 7 S-R CAACACCATAAGTGGGTCGGA 8 S-Probe ACAAACCTTGTAATGGTGTTGCAGGT 9

The fluorescent probe is an oligonucleotide probe, the 5 'end of the probe is connected with a fluorescent group, and the 3' end of the probe is connected with a quenching group.

2. The primer probe set according to claim 1,

the 5 'end of the probe for detecting the ORF1a/b gene is connected with a fluorescent group FAM, and the 3' end is connected with a quenching group BHQ1;

the 5 'end of the probe for detecting the N gene is connected with a fluorescent group VIC, and the 3' end of the probe is connected with a quenching group BHQ1;

the 5 'end of the probe for detecting the S gene is connected with a fluorescent group CY5, and the 3' end is connected with a quenching group BHQ2.

3. A multiplex fluorescence detection kit for new coronavirus olmcornon variant strains comprising the primer probe set of claim 1 or 2.

4. The kit of claim 1, further comprising a multiplex fluorescence detection reagent.

5. The Kit of claim 4, wherein the multiplex fluorescence detection reagent is HiScript II U + One Step qRT-PCR Probe Kit reagent of Nanjing nuozokenza.

6. The method for preparing a primer probe working solution comprising the primer probe set according to claim 1 or 2, comprising the steps of:

1) Adding RNA-free enzyme water into the synthetic dry powder of each primer and probe to prepare the working concentration of 10 micromoles per liter;

2) Three primer probe sets for detecting ORF1a/b gene, N gene and S gene were separately prepared according to the upstream primer: a downstream primer: the volume ratio of the probes is 2;

3) And finally, mixing the three probe primer mixed solutions in equal volume to prepare a primer probe working solution.

Images