CN105755176A - Real-time fluorescent quantitative PCR detecting and typing diagnosis kit for pig bocavirus - Google Patents
Real-time fluorescent quantitative PCR detecting and typing diagnosis kit for pig bocavirus Download PDFInfo
- Publication number
- CN105755176A CN105755176A CN201610257262.5A CN201610257262A CN105755176A CN 105755176 A CN105755176 A CN 105755176A CN 201610257262 A CN201610257262 A CN 201610257262A CN 105755176 A CN105755176 A CN 105755176A
- Authority
- CN
- China
- Prior art keywords
- pbovg2
- pbovg1
- pbovg3
- pbov
- bocavirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a real-time fluorescent quantitative PCR detecting and typing diagnosis kit for pig bocavirus.The kit comprises the three pairs of primers of PBoV G1, PBoV G2 and PBoV G3 and further comprises PCR reaction liquid, standard substances, a positive reference substance and a negative reference substance. The standard substances are composed of the PBoV G1 standard substance, the PBoV G2 substance and the PBoV G3 substance.The positive reference substance is a positive plasmid mixed substance containing three pig bocavirus gene groups of PBoV G1, PBoV G2 and PBoV G3.By the utilization of the kit, through one-time PCR reaction, whether a sample to be detected is infected with pig bocavirus can be rapidly authenticated, and which one of the gene groups of PBoV G1, PBoV G2 and PBoV G3 the sample to be detected belongs to can be rapidly authenticated.
Description
Technical field
The invention belongs to viral nucleic acid detection field, it is specifically related to a boar bocavirus multiple real time fluorescence quantifying PCR quickly detect and classification diagnosis test kit, three genomes of pig bocavirus can be detected, it is adaptable to clinical and rapid gene typing detection by quantitative to pig bocavirus in scientific research in same reaction tube simultaneously.
Background technology
Pig bocavirus (Porcinebocavirus, PBoV) is to belong to member without cyst membrane strand linear DNA bocavirus.After within 2009, being detected in the pig body that pmws (PMWS) is suffered from by Sweden, worldwide being widely current, multiple viruses are planted or genotype is found, and can be divided into G1 according to Phylogenetic, G2, G3 tri-PBoV gene group.Although by lacking suitable cell culture system at present also without direct pathogenicity evidence, but many epidemiological investigations show pig bocavirus and cause porcine respiratory disease and diarrhoea is relevant, and this is newly sent out swine diseases poison and causes the common concern of various countries.
PBoVGroup1 (PBoVG1): at present, PBoVG1 gene group includes findings that suffers from the pig bocavirus 1 type (GenBankNumber:FJ872544) in PMWS swinery in Sweden, the PBoV1 (GenBankNumber:HQ223038) that Zeng in 2011 etc. find in Central Region, homology and the known Sweden PBOV of its display have 99-100%, and this virus was also found in other areas of China and Uganda later.Owing to this papova is first PBoV determined in pig, it is referred to as PBoVG1 according to current grouping system.PBoVG1 gene group also covers the PBoV (GenBankNumber:HQ291308) found in China and the PBoV (GenBankNumber:KF025391) detected in U.S. swinery for 2011.
It is reported that PBoV1 is very big in the prevalence rate difference of zones of different swinery, respectively 1.5% to 88%.But, this virus pathogenic still unclear, because PBoV not only detects at the tissue of the normal pig of clinic, serum and fecal specimens, and clinically sick pig (include pig circular ring virus relevant disease (PCVAD) and suffer from respiratory tract disease) sample detects.In sick pig, research worker finds and piglets, adult male pig or sow (0-13.6%, 0-3/20-26 sample) are compared firm weanling piglet and have significantly higher sickness rate (69.7%, 69/99 sample).
PBoVGroup2 (PBoVG2): PBoVG2 gene group is the gene group second largest in three branches of PBoV systematic evolution tree.PBoVG2 includes the PBoV1-ZJD (HM053693) and the PBoV2-ZJD (HM053694) that identify from the sodium selenite stool sample of China, and the NS1 gene of the two PBoV has the nucleotide homology of 94.2%.In addition, this group is additionally included in Chinese Pigs fecal specimens the PBoV2-A6 (HQ291309) identified, it also has the homology of 93.2-94.2% with HM053693 and HM053694 at NS1 gene, although it is one group that Shan etc. proposed in 2011 at first by these three virus taxis, and by they called after PoBoV3, because PPV4 has been found that and called after PoBoV2 at that time.According to from the serum of country variant, tissue, it is thus achieved that the verification and measurement ratio of sample P BoV2 from 4.8% to 64.4%.But the dependency of the disease of PBoVG2 gene group is still unclear.
PBoVGroup3 (PBoVG3): PBoVG3 gene group is current three and grows group maximum in cladogram branches, including in Northern Ireland, the U.S., and several PBOV strains such as China.Hereditary difference between PBoVG3 gene group member is at a relatively high, and homology ranges for 76% to 87.9%.Before this, PBoV3 and PBoV4 bacterial strain is divided into the 3rd group is sub-divided into 5 different subgroup PBoV3A to PBoV3E to have research worker to propose based on VP1 sequence analysis.But, bacterial strain PBoV3-22, PBoV3-23, PBoV5, PBoV-6V and PBoV-7V are not included in this research.Use ICTV (ICTV) formulate species defining standard (be defined as NS1 DNA sequence homology < 95% be new species), pig bocavirus is divided into five subgroups, but this methods of genotyping but can not include PBoV-6V and 7V.
People are to the research of pig bocavirus still in the primary exploratory stage, and developing effective and reliable detection technique, that PBoV is carried out epidemiological survey and analysis is extremely important.At present that the method for its detection and typing is not comprehensive.Conventional nosetiology and Serologic detection are difficult to be distinguished by identifying by these three gene group simultaneously, defects such as there is again complex operation simultaneously, waste time and energy, sensitivity is low, it is difficult to effectively carry out early stage detection, it is easy to produce erroneous judgement misjudgement.And the detection technique of PCR-based is at present mostly with single virus kind or gene group for object of study, it is impossible to include all of known pig bocavirus kind.Multiple real time fluorescence quantifying PCR technology once can detect multiple pathogens simultaneously, and has the advantages such as high specific and sensitivity, detection time is short, is a kind of ideal many Methods of Detection of Pathogens.Therefore specific detection distinguish the multiple real time fluorescence quantifying PCR quick diagnosis reagent kit of pig bocavirus gene group while of developing a kind of, contributes to promoting Viral diagnosis level, has important application prospect in medical diagnosis on disease and preventing and treating etc..
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of three boar bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kits.
In order to solve above-mentioned technical problem, the present invention provides the detection of boar bocavirus multiple real time fluorescence quantifying PCR and a classification diagnosis test kit (pig bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kit), this test kit includes following 3 pairs of primers (fluorescence quantification PCR primer is three boar bocavirus gene group group-specific primerses):
PBoVG1-F:TGAGCTAATCCCTGAACTG,
PBoVG1-R:GTCTGAGCCTGTATCACCTAT；
PBoVG2-F:GGGCACTGATTATATCTTTAC,
PBoVG2-R:CCCTGACATCTTTCCATT；
PBoVG3-F:ACTCTTTGCAGTCTGACTCTTC,
PBoVG3-R:GTTCCCCCGTGTCTTTAG.
Improvement as the three boar bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kits of the present invention:
Described test kit includes: a), fluorescence quantitative PCR reaction solution, b), positive reference substance, c), negative controls, d), quantitative PCR standard substance (standard substance), e), primer；
A), described fluorescence quantitative PCR reaction solution comprises PCR reaction buffer, EvaGreen fluorescent dye, archaeal dna polymerase (enzymatic mixture)；
Described PCR reaction buffer includes buffer, magnesium chloride and triphosphate deoxyribose nucleotide mixture；
B), described positive reference substance is: containing the positive plasmid melange (every kind of virus concentration is about 300ng/ μ L) of PBoVG1, PBoVG2, PBoVG3 these three pig bocavirus gene group；
C), described negative controls is: sterilizing distilled water ddH2O、PCV1、PCV2、PRRSV、CSFV、TGEV、PEDV；
D), described quantitative PCR standard substance are made up of following 3 kinds of standard substance:
PBoVG1 standard substance, PBoVG2 standard substance and PBoVG3 standard substance.
Described in described PBoVG1 standard substance sequence such as SEQIDNO:1, described in described PBoVG2 standard substance sequence such as SEQIDNO:2, described in described PBoVG3 standard substance sequence such as SEQIDNO:3.
E), described primer is three boar bocavirus gene group group-specific primerses.
Further improvement as the three boar bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kits of the present invention:
The same tube packaging of upstream and downstream primer of each pig bocavirus gene group group-specific primers.
Further improvement as the three boar bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kits of the present invention:
Tm value scope: PBoVG1, PBoVG2 and PBoVG3 respectively 81.3 ± 0.34 DEG C, 78.2 ± 0.37 DEG C and 85.0 ± 0.29 DEG C.
Further improvement as the three boar bocavirus multiple real time fluorescence quantifying PCR quick diagnosis reagent kits of the present invention: described test kit keeps in Dark Place and spends in-20.
The diagnostic kit of the present invention, can be used for detecting and distinguishing PBoVG1, PBoVG2 and PBoVG3.
Quick diagnosis reagent kit provided by the invention, keeps in Dark Place and spends in-20, reduce multigelation as far as possible.
The using method of test kit of the present invention specifically can be as follows:
Negative control and positive control are set up in detection according to specifically used situation every time；
The dilution of standard substance aseptic double-distilled water is 1.0 × 100～1.0 × 106copies/μL。
Virus sample DNA extraction: according to products instruction, uses AxyPrepTMBodyFluidViralDNA/RNAMiniprepKit50-prep (AXYGEN) extracts pig bocavirus DNA.
The detection of nucleic acid: the testing sample nucleic acid DNA taking 1～1.5 μ L extracting is that template carries out multiple fluorescence PCR reaction, wherein 2 × fluorescence quantitative PCR reaction solution 12.5 μ L, PBoVG1, PBoVG2 and PBoVG3 upstream and downstream fluorescent primer final concentration is respectively 0.24,0.64 and 0.12 μM in reaction system, adds ddH2O is 25 μ L to reaction system cumulative volume；Response parameter is: 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 30s, 40 circulations；Melting curve program is 95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s；Start to collect fluorescence signal from 60 DEG C.
Standard curve making: take PBoVG1, PBoVG2 and PBoVG3 recombiant plasmid serial standards 1 × 10 respectively0～1 × 106Copies/ μ L carries out real-time quantitative fluorescence PCR reaction, reaction system: 1～1.5 μ L standard substance template, 2 × fluorescence quantitative PCR reaction solution 12.5 μ L, PBoVG1, PBoVG2 and PBoVG3 upstream and downstream fluorescent primer final concentration are respectively 0.24,0.64 and 0.12 μM in reaction system, add ddH2O is 25 μ L to reaction system cumulative volume.Response parameter is: 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 30s, 40 circulations.After having expanded, with CT value for vertical coordinate, log10X (X is standard substance series concentration) is abscissa, CT value and log10X is linear, makes standard curve.
Fluorescent quantitation result is reported:
1), by the peak value height corresponding in melting curve of the amplified production of PBoVG1, PBoVG2 and PBoVG3 and with or without judging detection sample.If wherein the corresponding amplified production of PBoVG1, PBoVG2 and PBoVG3 produces special melting peak, namely corresponding Tm value is (by test of many times statistical method gained 81.3 ± 0.34 DEG C, 78.2 ± 0.37 DEG C and 85.0 ± 0.29 DEG C), then testing result is positive corresponding to this kind of virus, namely testing sample carries corresponding virus, otherwise, then feminine gender does not carry corresponding virus.
2) if testing result is positive, according to the standard curve obtained and testing sample Ct value, specimen viral level to be measured (copies/ μ L) is calculated.
Advantages of the present invention: use Real-Time Fluorescent Quantitative PCR Technique, adopt PBoVG1, PBoVG2 and PBoVG3 three specific primer of boar bocavirus gene group, develop a kind of three boar bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kits.This invention is can to detect PBoVG1, PBoVG2 and PBoVG3 from sample by PCR reaction simultaneously, sensitiveer, easy than traditional regular-PCR method, save time and fast, and virus to be detected can be carried out accurate quantitative analysis.Test kit provided by the invention can be distinguished three boar bocavirus gene group papovas and infect, there is provided rapid sensitive easy instrument for the detection of viral infection, so that pig bocavirus Epidemiological study, clinical early diagnosis and formulate therapeutic scheme in time and be possibly realized.
In sum, the present invention provides one to detect all genotypic multiple real time fluorescence quantifying PCR quick diagnosis reagent kits of known pig bocavirus simultaneously, comprise PCR reactant liquor, standard substance, reference substance, primer, box body is provided with container hole, place PCR reactant liquor pipe respectively, PBoVG1 Virus Standard QC, PBoVG2 Virus Standard QC, PBoVG3 Virus Standard QC, positive control QC, negative control QC and primer pipe, reacted by a PCR, can to testing sample whether infected pigs's bocavirus and belong to PBoVG1, which gene group of PBoVG2 and PBoVG3 carries out Rapid identification, specificity is good, highly sensitive, quickly detecting and sort research pig bocavirus suitable in clinic and scientific research, there is higher using value.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the structural representation of test kit.
Fig. 2 is that three boar bocavirus gene group group-specifics melt peak.It is followed successively by from left to right: PBoVG2, PBoVG1 and PBoVG3.That is, B represents PBoVG2, A and represents PBoVG1, C and represent PBoVG3.
Fig. 3 carries out sixfold real-time fluorescence quantitative PCR detection example for the positive mixing containing three boar bocavirus gene group (PBoVG1, PBoVG2 and PBoVG3) sources.
Remarks illustrate: upper curve is from left to right followed successively by PBoVG2, PBoVG1 and PBoVG3, and lower curve is negative control.
Fig. 4-9 is the representative positive sample testing result of part, particularly as follows:
What Fig. 4 was corresponding is PBoVG2 positive, what Fig. 5 was corresponding is PBoVG1 positive, what Fig. 6 was corresponding is PBoVG3 positive, what Fig. 7 was corresponding is PBoVG1 and PBoVG3 positive, what Fig. 8 was corresponding is PBoVG2 and PBoVG3 positive, and what Fig. 9 was corresponding is the PBoVG1 positive+PBoVG2 positive+PBoVG3 positive.
Detailed description of the invention
Below in conjunction with the drawings and specific embodiments, the invention will be further described, but protection scope of the present invention is not limited to that.
Embodiment 1, reagent cartridge configuration
Referring to Fig. 1, three pig bocavirus gene group multiple real time fluorescence quantifying PCR quick diagnosis reagent kits, are made up of fluorescence quantitative PCR reaction solution, PBoVG1 Virus Standard product, PBoVG2 Virus Standard product, PBoVG3 Virus Standard product, positive reference substance, negative controls and box body.
It is provided with cell therefor hole, for placing quantitative PCR reactant liquor pipe, PBoVG1 Virus Standard QC, PBoVG2 Virus Standard QC, PBoVG3 Virus Standard QC, positive control QC and negative control QC etc. respectively at box body.Wherein fluorescence quantitative PCR reaction solution (comprising PCR reaction buffer, archaeal dna polymerase and fluorescent dye) totally 3 pipes (are labeled as), PBoVG1 Virus Standard product are 1 pipe (being labeled as ▲), PBoVG2 Virus Standard product be 1 pipe (being labeled as ●), PBoVG3 Virus Standard product is 1 pipe (being labeled as ■), positive reference substance 5 totally 3 pipes (are labeled as), the some pipes of negative controls 6 (being labeled as), three boars bocavirus gene group's quantitative fluorescent PCR primer (upstream and downstream primer fills with pipe) are that 3 pipes (are labeled as)。
Specific as follows:
1), described PCR reactant liquor includes 2 × PCRbuffer (Shanghai Sheng Gong company), 5m Μ magnesium chloride and 0.4m Μ triphosphate deoxyribose nucleotide mixture (Shanghai Sheng Gong company), 2 × EvaGreen fluorescent dye (Biotum company), 3UDNATaq polymerase (Shanghai Sheng Gong company).
2), each viral gene group fluorescence quantification PCR primer (upstream and downstream primer) respectively fills 1 pipe.The often upper concentration marking primer of pipe.The concentration of primer is 10uM.
3), positive reference substance is PBoVG1, PBoVG2 and PBoVG3 three positive plasmid melange (every kind of virus concentration is about 300ng/ μ L) of boar bocavirus gene group；
4), negative controls is sterilizing distilled water ddH2O, PCV1, PCV2, PRRSV, CSFV, TGEV and PEDV.
Prepared by embodiment 2, plasmid standard
The first step: primer synthesizes
By 3 pigs bocavirus gene group papova common PCR primers sequence (see table 1) designed by the present invention, technical service company of Chinese Shanghai Sheng Gong biotech firm synthesizing, synthetic quantity is every primer 2 OD.
The primer that in table 1 present invention, plasmid standard builds and regular-PCR detection is used
Second step: virus STb gene/RNA extracts
50mg will be respectively weighed containing PBoVG1, PBoVG2 and PBoVG3 three pig bocavirus gene group positive, resuspended according to 1g:10ml (w/v) ratio with PBS, vortex oscillation 30S, then centrifugal 10 minutes of 1500g, draw centrifugal rear gained supernatant 200 μ L, use AxyPrepTMBodyFluidViralDNA/RNAMiniprepKit50-prep (AXYGEN), is operated according to the operation instructions of kit manufacturers, extracts pig bocavirus DNA.
3rd step: regular-PCR expands
PCR reaction system (total reaction volume 25 μ L): 10 × PCRbuffer2.5 μ L, 2.5mMofdNTPs1.2 μ L, 25mMMgCl22.5 μ L, (primer concentration is 10 μMs to the pig bocavirus gene group upstream and downstream common PCR primers mixture of synthesis in the 0.5 μ L first step；Use any pair in these 3 pairs of primers every time), 2UTaqDNA polymerase (5U/ μ L) (Sangon), extracts pig bocavirus DNA profiling (about 200ng), adds ddH in 2 μ L second steps2O to 25.0 μ l.Reaction reacts parameter at Bio-RadS1000PCR amplification instrument and is: response procedures: 95 DEG C of 5min, 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s, 35 circulations, 72 DEG C of 10min.
4th step: prepared by plasmid standard
The amplified production that 3rd step obtains is carried out agarose gel electrophoresis, purpose fragment is reclaimed according to DNAGelExtractionKit operational approach, recovery product is connected on PMD18-T carrier, converted by bacillus coli DH 5 alpha competence, the single bacterium colony of picking wherein white is identified, recombiant plasmid sequence entrusts Shanghai Sheng Gong biotech firm to carry out sequencing.Utilize PlasmidMiniprepKit to extract the correct recombinant plasmid dna of order-checking, utilize the quantitative PBoVG1 of Nanodrop2000, PBoVG2 and PBoVG3 recombiant plasmid respectively 2.3 × 1011copies/μL、4.9×1012Copies/ μ L and 1.8 × 1011Copies/ μ L, with aseptic double-distilled water by recombiant plasmid according to 1.0 × 106～1.0 × 100L10 times of gradient dilution of copies/ μ prepares plasmid standard.
Embodiment 3, the present invention detect three pig bocavirus gene group group-specific experiments
The first step: primer synthesizes
Transferring to Shanghai technical service company of Sheng Gong biotech firm to synthesize three boars bocavirus gene group's fluorescence quantification PCR primer sequence (such as table 2) designed by the present invention, synthetic quantity is every primer 2 OD.
Fluorescence PCR primer designed in table 2, the present invention
Second step: single virus specific detection in multiple system
According to the reactant liquor that the preparation of EvaGreen multiple real time fluorescence quantifying PCR reaction system is 3 parts identical, it is added separately to the 1.0 × 10 of 1 μ L6The PBoVG1 of copies/ μ L, PBoVG2 and PBoVG3 plasmid standard, that is, reaction system is 2 × fluorescence quantitative PCR reaction solution 12.5 μ L, and wherein PBoVG1, PBoVG2 and PBoVG3 upstream and downstream fluorescence quantification PCR primer final concentration is respectively 0.24,0.64 and 0.12 μM, 1 μ L template, adds ddH2O is 25 μ L to reaction system cumulative volume；Response parameter is: 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 30s, 40 circulations；Melting curve program is 95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s；Start to collect fluorescence signal from 60 DEG C.Carry out the multiple real time fluorescence quantifying PCR specific detection test of PBoVG1, PBoVG2 and PBoVG3 Mei Zhong viral gene group simultaneously.
Remarks illustrate: in each reaction system, contain above-mentioned 3 pairs of fluorescence quantification PCR primers simultaneously.
Specific test result shows: be added separately to PBoVG1 under multiple reaction system, the plasmid standard of PBoVG2 and PBoVG3 carries out real-time fluorescence quantitative PCR reaction, the amplified production of Mei Zhong viral gene group has special purpose peak to produce (referring to Fig. 2) in its corresponding purpose Tm value position, it was shown that the EvaGreen multiple real time fluorescence quantifying PCR reaction system specificity built in the present invention is better.PBoVG1, PBoVG2 and PBoVG3 Tm scope be by detecting the Tm value determined of 10 parts of positive, average and standard deviation is calculated again with statistical method, gained PBoVG1, PBoVG2 and PBoVG3Tm value respectively 81.3 ± 0.34 DEG C, 78.2 ± 0.37 DEG C and 85.0 ± 0.29 DEG C.
Embodiment 4, the present invention detect three pig bocavirus gene group organizing, stability experiments
The first step: primer synthesizes
With the first step in embodiment 3.
Second step: Detection of Stability
By PBoVG1, PBoVG2 and PBoVG3, proceed as follows respectively:
Take 3 part 1.0 × 106The plasmid standard of copies/ μ L (that is, PBoVG1, PBoVG2 and PBoVG3 plasmid standard respectively take 1 part) and a negative controls (that is, for ddH2O, PCV1, PCV2, PRRSV, CSFV, TGEV and PEDV), in carrying out batch respectively, batch between repeated trials.In batch, repeated trials is to be repeated 3 times with in a real-time fluorescence by 3 parts of samples；Between batch, repeated trials is that (3 days, interval) carries out real-time fluorescence quantitative PCR test in the test of 3 different times.3 pig bocavirus gene groups batch between, batch in the average coefficient of variation CV value of repeated trials be respectively less than 1%, it was shown that the present invention detects process and has good stability.
Embodiment 5, the present invention detect 3 pig bocavirus gene group sensitivity experiments
The first step: primer synthesizes
With the first step in embodiment 3.
Second step: sensitivity Detection
PBoVG1, PBoVG2 and PBoVG3 plasmid standard (1.0 × 10 with 10 times of serial dilutions6～1.0 × 100Copies/ μ L) as template, each dilution factor sets up 3 repetitions, carries out real-time fluorescence quantitative PCR, regular-PCR detection sensitivity respectively, compares sensitivity.
Result of the test shows, the present invention can detect that 100copies/ μ LPBoVG1,50copies/ μ LPBoVG2 and 100copies/ μ LPBoVG3 virus quantity, and Standard PCR is only able to detect 1.0 × 103PBoVG1, PBoVG2 and the PBoVG3 virus quantity of copies/ μ L, it can be seen that the present invention detects the sensitivity of virus higher than Standard PCR about 10～20 times.
Embodiment 6, the present invention are to 3 triple real-time PCR detection examples of pig bocavirus gene group
The first step: primer synthesizes
With the first step in embodiment 3.
Second step: virus STb gene/RNA extracts
50mg will be respectively weighed containing PBoVG1, PBoVG2 and PBoVG3 three pig bocavirus gene group positive, resuspended according to 1:10 (w/v) ratio with PBS, vortex oscillation 30S, then centrifugal 10 minutes of 1500g, draw centrifugal rear supernatant 200 μ L, operation instructions according to kit manufacturers are operated, and use AxyPrepTMBodyFluidViralDNA/RNAMiniprepKit50-prep (AXYGEN) extracts pig bocavirus DNA.
3rd step: multiple fluorescence quantitative PCR expands
Reactant liquor is prepared according to EvaGreen multiple real time fluorescence quantifying PCR reaction system, including 2 × fluorescence quantitative PCR reaction solution 12.5 μ L, PBoVG1, PBoVG2 and PBoVG3 upstream and downstream fluorescence quantification PCR primer final concentration is respectively 0.24,0.64 and 0.12 μM, three bocavirus gene group papova DNA (every kind of virus concentration is each about 150ng/ μ L) that 1 μ L second step extracts, add ddH2O is 25 μ L to reaction system cumulative volume；Response parameter is: 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 30s, 40 circulations；Melting curve program is 95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s；Start to collect fluorescence signal from 60 DEG C.
4th step: testing result judges
According to the melting curve figure that ABI7300 quantitative real time PCR Instrument automatically generates, carry out analysing amplified result.
Remarks illustrate: PBoVG1, PBoVG2 and PBoVG3Tm value respectively 81.3 ± 0.34 DEG C, 78.2 ± 0.37 DEG C and 85.0 ± 0.29 DEG C.
Result shows: the present invention can go out corresponding 3 pig bocavirus gene groups by pcr amplification well simultaneously, and different by amplified production melting curve peak, is substantially made a distinction by 3 kinds of products.The result of the test of the present embodiment is shown in Fig. 3.
In Fig. 3: upper curve is from left to right followed successively by PBoVG2, PBoVG1 and PBoVG3, lower curve is negative control (sterilizing distilled water ddH2O)；
Remarks illustrate: when negative control is PCV1, PCV2, PRRSV, CSFV, TGEV and PEDV, curve obtained is equal to sterilizing distilled water ddH2Curve corresponding to O.
According to Fig. 3, we can be drawn a conclusion: 3 pig bocavirus gene groups can simultaneously by a multiple real time fluorescence PCR reaction, amplify corresponding purpose product, and can by the difference of Tm on melting curve, 3 pig bocavirus gene groups are effectively made a distinction, the melting curve that result of the test produces with positive reference substance is very identical, and negative control melting curve does not melt peak, very intuitively can judge result of the test by melting curve, it was demonstrated that detected virus PBoVG1, PBoVG2 and PBoVG3 just.
Embodiment 7 present invention detects 3 pig bocavirus gene group's tests of clinical sample and Clinical detection positive is carried out accurate quantitative analysis
The first step: primer synthesizes
With the first step in embodiment 3.
Second step: sample collection
227 parts of clinical samples are collected in zhejiang and other places pig farm, including 200 pig manure samples, 22 pig anteserum samples, 5 Pulmonis Sus domestica tissue samples.
3rd step: STb gene/RNA extracting
50mg will be respectively weighed containing PBoVG1, PBoVG2 and PBoVG3 three pig bocavirus gene group positive, resuspended according to 1:10 (w/v) ratio with PBS, vortex oscillation 30S, then centrifugal 10 minutes of 1500g, draw centrifugal rear supernatant 200 μ L, use AxyPrepTMBodyFluidViralDNA/RNAMiniprepKit50-prep (AXYGEN), is operated according to the operation instructions of kit manufacturers, extracts pig bocavirus DNA.
4th step: regular-PCR detection and multiple fluorescence quantitative PCR
1, regular-PCR detection
With the 3rd step in embodiment 2；
2, multiple fluorescence quantitative PCR
With the 3rd step in embodiment 5.
5th step: testing result
Regular-PCR result is detected by agarose gel electrophoresis；Multiple fluorescence quantitative PCR detects with the 4th step in embodiment 5.Fig. 4-9 is part representative sample multiple fluorescence quantitative PCR testing result.
The detection of regular-PCR method is as follows with testing result of the present invention: regular-PCR detects PBoVG11 part, and the present invention detects 7 parts of positives (wherein 1 part with regular-PCR testing result)；Regular-PCR detects PBoVG23 part, and the present invention detects 13 parts (wherein 3 parts with regular-PCR testing result)；Regular-PCR detects PBoVG324 part, and the present invention detects 45 parts of positives (wherein 24 parts with regular-PCR testing result)；Wherein regular-PCR detects mixed infection 4 parts, and the present invention detects mixed infection 57 parts (wherein 4 parts with regular-PCR testing result).
Result shows that Detection results of the present invention is significantly better than regular-PCR Detection results, it is possible to reduce false-negative generation, once can detect mixed infection simultaneously, reduces secondary PCR checking and does not need pcr amplification subsequent treatment, being greatly saved the time, improving work efficiency.
6th step: positive test symbol is carried out accurate quantitative analysis
Take PBoVG1, PBoVG2 and PBoVG3 recombiant plasmid serial standards 1 × 10 respectively0～1 × 106Copies/ μ L carries out real-time quantitative fluorescence PCR reaction, reaction system: 1～1.5 μ L standard substance template, 2 × fluorescence quantitative PCR reaction solution 12.5 μ L, PBoVG1, PBoVG2 and PBoVG3 upstream and downstream fluorescent primer final concentration are respectively 0.24,0.64 and 0.12 μM in reaction system, add ddH2O is 25 μ L to reaction system cumulative volume.Response parameter is: 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 30s, 40 circulations.After having expanded, with Ct value for vertical coordinate, log10X (X is standard substance series concentration) is abscissa, Ct value and log10X is linear, makes standard curve.
According to the standard curve obtained and testing sample Ct value, calculate specimen viral level to be measured.The DNA content of three viral gene groups of PBoVG1, PBoVG2 and PBoVG3 is calculated in institute's collecting sample substantially all 10 by interpretation of result2～103Between copies/ μ L, and these samples person to be regular-PCR detection be negative by testing result of the present invention is positive sample.
Remarks illustrate: above-mentioned these " regular-PCR detection is negative by the sample that testing result of the present invention is the positive " are verified through substance quantitative real-time PCR, and DNA content is substantially all 102～103Between copies/ μ L.
Comparative example 1, the specific primer of the present invention is made into as described below:
PBoVG1-F1:5 '-AATCCCTGAACTGCCAGGG-3 '
PBoVG1-R1:5 '-GTCTGAGCCTGTATCACCT-3 '
PBoVG2-F1:5 '-GCACTGATTATATCTTTACC-3 '
PBoVG2-R1:5 '-CGAACATGATCTCCCTGA-3 '
PBoVG3-F1:5 '-TATCGACTCTTTGCAGTCTGA-3 '
PBoVG3-R1:5 '-GGAGGTTCCCCCGTGTC-3 '.
Comparative example 2, the specific primer of the present invention is made into as described below:
PBoVG1-F2:5 '-CTAATCCCTGAACTGCCAGG-3 '
PBoVG1-R2:5 '-CTGTATCACCTATGTCACCT-3 '
PBoVG2-F2:5 '-TGATTATATCTTTACCGAGGG-3 '
PBoVG2-R2:5 '-CCGAACATGATCTCCCTGA-3 '
PBoVG3-F2:5 '-ATCGACTCTTTGCAGTCTGA-3 '
PBoVG3-R2:5 '-CCCCCGTGTCTTTAGGCT-3 '.
Contrast experiment, specific primer method described in above-described embodiment 5 of above-mentioned comparative example 1 and comparative example 2 gained is detected, acquired results is: comparative example 1 can only detect 1000copies/ μ LPBoVG1,500copies/ μ LPBoVG2 and 1000copies/ μ LPBoVG3 virus quantity；Comparative example 2 can only detect 1000copies/ μ LPBoVG1,500copies/ μ LPBoVG2 and 1000copies/ μ LPBoVG3 virus quantity.
Finally, in addition it is also necessary to be only several specific embodiments of the present invention it is noted that listed above.It is clear that the invention is not restricted to above example, it is also possible to there are many deformation.All deformation that those of ordinary skill in the art can directly derive from present disclosure or associate, are all considered as protection scope of the present invention.
<110>Institutes Of Technology Of Zhejiang
<120>pig bocavirus real-time fluorescence quantitative PCR detection and classification diagnosis test kit
<160>3
<210>1
<211>531
<212>DNA
<213>artificial sequence
<220>
<223>PBoVG1
<400>1
aatacccatactcacaaagtggatgggacagtgagctaatccctgaactgccagggatga60
tttataaactaccaaactattgctacttccaggaactaggtgacataggtgatacaggct120
cagacttaagagaatcatggctagggacagcatgtcccttattctttcttgaaagctcct180
cacatgaggtactaagaacaggagaagaaacaggatttgaatttgattttgattgtggat240
gggtacataatgacagagcattttgtccaccacaatgcgactttaatcccctaatcaaaa300
ccaggcgaagcagaataataatgggttcttcaggaaacacatcagaaccatactatgact360
acaaaaaacctagcaattggatgccaggaccaggaactcgactaaacggacaccaatcag420
gaagcaatctaaaaacatcttctgggccctttaacacatcatgggcaccaccaggggtaa480
cacagggaagtgacacaacctacctaaactcaccagcaatgaatcaatcac531
<210>2
<211>291
<212>DNA
<213>artificial sequence
<220>
<223>PBoVG2
<400>2
tccactgcttcgagaacatcccgagtgacttcagcgacatggaggagaccgaatgactct60
cgggacggggggaaaatatggggaaataaaaataaaaagaataaaacaaacccttacgag120
gtattcagccagcacatggccaggttcaagccagataaaagctattgtggcttctactgg180
cacagctgccggatggctcgtaagggcacagattatatctttaccgagggaatgagggat240
ttccaaaaacgctgtaaagacaataaatgtgagtggaaagatgtcagggag291
<210>3
<211>384
<212>DNA
<213>artificial sequence
<220>
<223>PBoVG3
<400>3
gaaatgctagaagctgttgaatcaatgaatgagtcttaagcgcggtcagttccgcggtgt60
tctgtttcctggttataattatttgggtccttttaatcctttggaaaacggtgatcctgt120
caataaagccgacgaggccgcaaaaaaacacgatcaagcttataataattatatcaataa180
aggtttaaatccctacctgaaatttaataaaggtgatcaagactttatcgactctttgca240
gtctgactcttctgtgggcggtaactttgcgcgtgccgtctttcatttgaaaaaacaaat300
tgcgcctgcgctcaacgagcctaaagacacgggggaacctccggcgaaaaaggacaaacg360
cgcgggcaataaacgtcacctgta384
Claims (6)
1. the detection of pig bocavirus multiple real time fluorescence quantifying PCR and classification diagnosis test kit, is characterized in that this test kit includes following 3 pairs of primers:
PBoVG1-F:5 '-TGAGCTAATCCCTGAACTG-3 '
PBoVG1-R:5 '-GTCTGAGCCTGTATCACCTAT-3 '
PBoVG2-F:5 '-GGGCACTGATTATATCTTTAC-3 '
PBoVG2-R:5 '-CCCTGACATCTTTCCATT-3 '
PBoVG3-F:5 '-ACTCTTTGCAGTCTGACTCTTC-3 '
PBoVG3-R:5 '-GTTCCCCCGTGTCTTTAG-3 '.
2. pig bocavirus multiple real time fluorescence quantifying PCR according to claim 1 detection and classification diagnosis test kit, is characterized in that this test kit also includes PCR reactant liquor, standard substance, positive reference substance, negative controls；
Described standard substance are made up of PBoVG1 standard substance, PBoVG2 standard substance, PBoVG3 standard substance.
3. pig bocavirus multiple real time fluorescence quantifying PCR according to claim 2 detection and classification diagnosis test kit, is characterized in that:
Described positive reference substance is: containing the positive plasmid melange of PBoVG1, PBoVG2, PBoVG3 these three pig bocavirus gene group.
4. the pig bocavirus multiple real time fluorescence quantifying PCR according to Claims 2 or 3 detects and classification diagnosis test kit, it is characterized in that:
Described negative controls is sterilizing distilled water ddH2O、PCV1、PCV2、PRRSV、CSFV、TGEV、PEDV。
5. the pig bocavirus multiple real time fluorescence quantifying PCR according to Claims 2 or 3 detects and classification diagnosis test kit, it is characterized in that:
The same tube packaging of upstream and downstream primer of every pair of primer.
6. the pig bocavirus multiple real time fluorescence quantifying PCR according to Claims 2 or 3 detects and classification diagnosis test kit, it is characterized in that:
Tm value scope: PBoVG1, PBoVG2 and PBoVG3 respectively 81.3 ± 0.34 DEG C, 78.2 ± 0.37 DEG C and 85.0 ± 0.29 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257262.5A CN105755176A (en) | 2016-04-22 | 2016-04-22 | Real-time fluorescent quantitative PCR detecting and typing diagnosis kit for pig bocavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257262.5A CN105755176A (en) | 2016-04-22 | 2016-04-22 | Real-time fluorescent quantitative PCR detecting and typing diagnosis kit for pig bocavirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105755176A true CN105755176A (en) | 2016-07-13 |
Family
ID=56325610
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610257262.5A Pending CN105755176A (en) | 2016-04-22 | 2016-04-22 | Real-time fluorescent quantitative PCR detecting and typing diagnosis kit for pig bocavirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755176A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106435027A (en) * | 2016-09-30 | 2017-02-22 | 广东省农业科学院动物卫生研究所 | General type PCR (polymerase chain reaction) detection primer, kit and detection method for canine bocavirus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450969A (en) * | 2014-12-19 | 2015-03-25 | 广东省农业科学院动物卫生研究所 | Method for detecting porcine bocavirus type 1, type 2 and type 3 by multiple PCR |
| CN105219887A (en) * | 2015-11-09 | 2016-01-06 | 北京市农林科学院 | For the primer sets of typing detection of porcine bocavirus, test kit and detection method |
-
2016
- 2016-04-22 CN CN201610257262.5A patent/CN105755176A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450969A (en) * | 2014-12-19 | 2015-03-25 | 广东省农业科学院动物卫生研究所 | Method for detecting porcine bocavirus type 1, type 2 and type 3 by multiple PCR |
| CN105219887A (en) * | 2015-11-09 | 2016-01-06 | 北京市农林科学院 | For the primer sets of typing detection of porcine bocavirus, test kit and detection method |
Non-Patent Citations (1)
| Title |
|---|
| 饶品彬: "EVAGreen多重实时荧光定量PCR同时检测多种猪病毒研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106435027A (en) * | 2016-09-30 | 2017-02-22 | 广东省农业科学院动物卫生研究所 | General type PCR (polymerase chain reaction) detection primer, kit and detection method for canine bocavirus |
| CN106435027B (en) * | 2016-09-30 | 2019-07-09 | 广东省农业科学院动物卫生研究所 | A kind of universal PCR detection primer, kit and the detection method of dog bocavirus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107513584B (en) | A kind of five heavy fluorescence quantitative kits detecting enterovirus | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| CN104561368B (en) | Six boar virus multiple real-time fluorescence quantitative PCR quick diagnosis reagent kits | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| CN107475459A (en) | Differentiate the detection method of american type PRRSV classical strainses, variation strain and new virus class NADC30 strains simultaneously | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN103509877B (en) | A kind of PCR kit for fluorescence quantitative for detecting PRV and application thereof | |
| CN111172321B (en) | Fluorescent PCR detection kit for identifying African swine fever infection and immunity | |
| CN113215312A (en) | Coronavirus SARS-CoV-2 digital PCR multiple detection kit and its application | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN110229932B (en) | African swine fever virus nucleic acid extraction-free fluorescent isothermal amplification detection kit | |
| CN107365862A (en) | For detecting the primer and probe and its kit of Echinococcus granulosus in dog excrement | |
| CN107190104A (en) | Five boar diarrhea virus multiple real time fluorescence quantifying PCR quick diagnosis reagent kits and application | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN107988433A (en) | Double PCR primer, detection method and the kit of a kind of grouper irido virus | |
| CN109913591A (en) | A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method | |
| CN105624303A (en) | Bovine, goat, porcine and canine brucella typing fluorescent PCR (polymerase chain reaction) detection reagent kit and preparation and application thereof | |
| CN102586473A (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN113846191B (en) | Primer and probe for detecting novel coronavirus and application of primer and probe | |
| CN101550455A (en) | Human parainfluenza virus distinguishing and quantitative detection regent kit | |
| CN103725794A (en) | Fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) primers, probes and method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) | |
| CN103014135B (en) | A kind of method identifying mycobacterium tuberculosis | |
| CN105803114A (en) | Porcine bocavirus detection and parting enrichment multiple PCR rapid diagnostic kit | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN108359743A (en) | A kind of HRM primer group for differentiating FPV and CPV, the kit containing the primer sets and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160713 |