CN109777881B - SSR molecular marker detection method for purity of conventional wheat variety, primer combination and application thereof - Google Patents

Abstract

The invention belongs to the field of agricultural biotechnology, and in particular relates to an SSR molecular marker detection method, a primer combination and an application for the purity of conventional wheat varieties. The invention uses the certified wheat varieties as materials to screen the SSR primers suitable for distinguishing the infinitely expanded certified wheat varieties, and uses the fluorescent capillary electrophoresis as the main detection platform to establish a large-scale, high-throughput, fast and accurate wheat variety purity SSR molecule Marker Detection Technology.

Description

SSR molecular marker detection method, primer combination and application for purity of conventional wheat varieties

technical field

The invention belongs to the field of agricultural biotechnology, and in particular relates to a method for detecting SSR molecular markers for the purity of conventional wheat varieties, a primer combination and applications thereof.

Background technique

With the adjustment of the grain structure of my country's planting industry and the development of the market economy, the amount of seeds used for precision sowing of wheat has been significantly reduced, and higher requirements have been placed on the quality and purity of seeds in production. Variety purity is one of the important indicators to measure the quality of seeds. The existing identification methods are field plot identification, morphological identification, biochemical method and prolamin method. Field planting identification covers a large area, is time-consuming and labor-intensive, and is easily affected by environmental factors, making it difficult to distinguish individuals with similar phenotypes. The gliadin method has the advantages of fast speed, low cost and simple operation, but the gliadin is only encoded by 6 gene loci, with few gene loci, it is difficult to separate the components with similar molecular weight, and the prolamin with low expression amount Factors such as difficulty in identification all reduce the accuracy of the test results.

With the rapid development of wheat genomics and whole-genome sequencing technology, a large number of SSR (Simple SequenceRepeat, simple sequence repeat) markers have been developed and utilized. SSR markers have the advantages of abundant markers, co-dominant inheritance, not affected by identification cycle and environment, accurate and reliable, simple and rapid, low cost, good stability, and easy to automate. However, the number of SSR markers is huge. There are more than 2,760 SSR markers published on the GrainGenes website and the Japanese wheat map website. In addition, many SSR markers have also been disclosed in the papers and research results published by other scholars.

Due to the excessive use of part of the backbone wheat germplasm in the bred wheat varieties in China, the homogenization of the bred wheat varieties is serious, and the genetic basis is relatively narrow. Most of the SSR markers have no polymorphism or low polymorphism in the bred wheat varieties. At present, the discrimination ability of high-throughput SSR genotyping platforms on the market is more than 1 bp, resulting in that the 1 bp motif SSR markers, which account for nearly 50% of wheat, cannot be used in variety identification.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide a method for detecting SSR molecular markers of the purity of conventional wheat varieties.

Another object of the present invention is to provide a combination of SSR molecular marker primers for detecting the purity of conventional wheat varieties

Another object of the present invention is to provide the application of the SSR marker primer in the detection of the purity of conventional wheat varieties.

According to the specific embodiment of the present invention, the primer names of the 10 pairs of SSR primer combinations used for the identification of the purity of conventional wheat varieties, the chromosomal location information where the SSR molecular markers are located, the allelic variation amplification interval, the primer sequences and the marker groups are shown in Table 1:

Table 1 SSR primer combinations for cultivar purity identification

The primers with the same fluorescent color need to be labeled with the same fluorescent dye at the same time. The color of the labeled dye can be selected according to the emission and absorption wavelengths of the capillary electrophoresis system used.

The SSR molecular marker detection method for the purity of conventional wheat varieties according to a specific embodiment of the present invention, the method comprises the following steps:

(1) Extract the individual DNA of the wheat variety to be tested;

(2) using the DNA extracted in step (1) as a template, using the SSR molecular marker primer pairs shown in Table 1 to carry out PCR amplification;

(3) Capillary electrophoresis detection;

(4) According to the electrophoresis result of step (3), determine the purity of the wheat variety to be tested.

According to the SSR molecular marker detection method for the purity of conventional wheat varieties according to the specific embodiment of the present invention, in step (4), first determine whether the variant site is a non-homozygous SSR molecular marker site, and the non-homozygous SSR molecular marker site After exclusion, if a certain wheat individual to be tested has at least 2 SSR molecular marker sites that are different from most of the other tested individuals, the individual to be tested is determined to be a hybrid.

According to the SSR molecular marker detection method for the purity of conventional wheat varieties according to the specific embodiment of the present invention, in step (4), when the same locus of different wheat individuals to be tested carries two allelic variations or two allelic variations If it is heterozygous and randomly distributed in different wheat individuals to be tested, it is determined that the locus is a non-homozygous SSR molecular marker locus.

Beneficial effects of the present invention:

The 10 SSR markers and corresponding primer combinations of the present invention have the following characteristics in the identification of bred wheat varieties:

1. The abundance of allelic variation at each SSR locus is high. A total of 141 allelic variants were detected in 1463 approved wheat varieties of my country by 10 SSR markers, and an average of 14.1 allelic variants were detected at each locus. The average PIC value of each marker is 0.69, which has a high resolution for wheat varieties;

2. The allelic variation frequency of each locus in the bred wheat varieties is relatively uniform;

3. With positioning information and single point, single copy;

4. All 10 SSR markers and their primer combinations can specifically amplify, and the band patterns are simple and easy to read by capillary peaks;

5. The motif of the screening SSR marker site is more than 2bp;

6. The 10 SSR markers of the one-time electrophoresis mark all the allelic variations amplified by the same fluorescent dye primer that do not cross the overlapping region and differ by more than 15bp;

7. The 10 SSR markers screened are finally determined after genotyping all currently known varieties in my country;

8. The 10 SSR markers have good stability and repeatability, which is convenient for popularization and application;

9. There is no interlocking relationship between the 10 SSR markers;

10. Using the SSR marker and primer combination of the present invention, the identification of variety purity can be completed in an indoor laboratory in 3 days, and the cost of manpower, material resources, financial resources, time and land resources can be greatly saved.

Description of drawings

Figure 1 shows the distribution characteristics of non-homozygous sites, wherein, lanes 1-20 are the individual numbers of the A1202-32 samples;

Figure 2 shows the banding characteristics of the miscellaneous strains, No. 1-10 are 10 individuals of Suxu No. 2, and the No. 1 individual is a miscellaneous strain;

Figure 3 shows the characteristics of the partial uniparental non-homozygous SSR site (Xgwm294);

Figure 4 shows the electrophoresis results of 10 pairs of SSR primer combinations, Figure 4-1 is the electrophoresis peak map of barc164, Figure 4-2 is the electrophoresis peak map of barc324, Figure 4-3 is the electrophoresis peak map of barc80, and Figure 4-4 is the electrophoresis peak map of cfa2028 , Figure 4-5 is the electrophoresis peak map of gwm161. Figure 4-6 is the electrophoresis peak figure of cfa2123, Figure 4-7 is the electrophoresis peak figure of gwm610, Figure 4-8 is the electrophoresis peak figure of gwm304, Figure 4-9 is the electrophoresis peak figure of gwm155, such as 4-10 is the electrophoresis peak figure of gwm294;

Detailed ways

Example 1

1. Determination of molecular markers of the present invention

The SSR molecular markers for the purity identification of conventional wheat varieties finally determined by the present invention are shown in Table 2.

Table 2 SSR primer polymorphism information for cultivar purity identification

The primers screened by the present invention are barc80, which is a 3bp motif, and there are 9 allelic variations in 1463 known varieties, with a PIC value of 0.61; barc324 is a 3bp motif, and there are 13 alleles in 1463 known varieties Variation, PIC value is 0.66; barc164 is 3bp motif, there are 15 allelic variations in 1463 known varieties, PIC value is 0.77; cfa2028 is 2bp motif, there are 7 alleles in 1463 known varieties Variation, PIC value is 0.63; gwm161 is 2bp motif, there are 17 allelic variations in 1463 known varieties, PIC value is 0.65; gwm610 is 2bp motif, there are 7 alleles in 1463 known varieties Variation, the PIC value is 0.60; cfa2123 is a 2bp motif, there are 19 allelic variations in 1463 known varieties, and a PIC value is 0.71; gwm294 is a 2bp motif, and there are 24 alleles in 1463 known varieties Variation, PIC value is 0.72; gwm155 is 2bp motif, there are 12 allelic variations in 1463 known varieties, PIC value is 0.75; gwm304 is 2bp motif, there are 18 alleles in 1463 known varieties variation, the PIC value was 0.76.

2. Correct distinction between atypical strains (hybrid strains) and non-homozygous SSR loci

The characteristics of non-homozygous SSR loci are that the same locus in different individuals carries two allelic variants or heterozygotes of two allelic variants, and their distribution in different individuals is random, as shown in Figure 1. Twenty individuals of Huaimai 23 carried the genotype from the parental parent or the heterozygous genotype from the parental parent at the Xcwm65 locus (individual No. 14). The characteristic of the hybrid genotype is that the allelic variation carried by the same individual at more than 2 different loci is different from that of the normal individual. Take 10 individuals of the line A1203-32 participating in the regional test as an example, as shown in Figure 2 , the genotypes of individual No. 1 at the loci Xgwm155, Xgwm610, Xgwm294 and Xgwm437 are different from those of individuals 2-9, so individual No. 1 is a hybrid.

As shown in Figure 3, most individuals of sample 1 Nongda 211 and sample 2 Luohan 7 have the same allelic variation at locus Xgwm294, only individuals 25 and 31 of sample 1, and 28 and 34 of sample 2 are the same as most individuals. The allelic variation is different. After 29 loci were added to these individuals, it was determined that the difference was caused by factors such as partial segregation, rather than mixed strains (atypical strains). Among the non-homozygous SSR loci, partial The uniparental non-homozygous site is a key factor causing misjudgment of the results.

Using the above 10 SSR markers to analyze and approve wheat varieties, including 321 varieties of wheat varieties in 10 major ecological regions such as Yangfumai No. 2, Huaimai No. 18, Xuzhou No. 24, Yanzhan 4110, and participating in Henan Province, Beijing , the genotypes of the tested wheat varieties in the regional experiment in Hebei Province, the results show that the use of 10 SSR markers is more obvious for the ecological type division of wheat varieties. The tested varieties in the northern winter wheat area, Hebei area and Beijing area were clustered into a large group, indicating that the 10 SSR markers have strong discriminative ability.

By labeling the 5' ends of the upstream primers of sites Xbarc80, Xbarc324, Xbarc164 with NED dye, the 5' ends of the upstream primers of sites Xcfa2028 and Xgwm161 with PET dye, and the 5' ends of the upstream primers of sites Xgwm610 and Xcfa2123 The ' end was labeled with FAM dye, and the 5' end of the upstream primers of the sites Xgwm294, Xgwm155 and Xgwm304 were labeled with VIC dye, because the allelic variation amplification fragment size interval of several sites marked with the same dye differed by more than 15bp, Therefore, these 10 pairs of SSR primers can be combined for electrophoresis. The electrophoresis results are shown in Figure 4.

Accuracy of Example 2 Compared with the Prolamin Method

Eight wheat varieties (Jingdong No. 8, Jingdong 18, Shi 4185, Henong 825, Bao 5067, Yunhan 618, Luohan No. 11, Taishan 257) were selected from the varieties in Beijing, Hebei, Henan and Shandong. 100 individuals were randomly selected from each variety, and a total of 800 individuals were used as samples. From sowing to tillering stage, a leaf was taken from each individual to extract its genomic DNA, and the genotypes of 10 SSR loci per plant were detected, and the seeds were harvested per plant. The grain gliadin was analyzed; the following year, plants were planted in the field, and the heading stage, maturity stage, growth stage, seedling habit, leaf color at seedling stage, flag leaf length, flag leaf width, flag leaf type, and maturity were compared between the lines. Plant leaf color, plant type, waxy stem and sheath, waxy ear, ear type, awn type, plant height, ear length, number of spikelets per ear, grain shape, grain color, grain quality, 1000-grain weight, disease resistance, etc. Main agronomic traits.

Taking the majority of individual plants with the same phenotype as the control, among the 800 plants, there were 55 plants with a number of loci different from the control genotype greater than 1. Among them, the SSR marker genotype, gliadin banding, and phenotypic traits 41 individual plants that were all different from the control were judged as miscellaneous plants; as shown in Table 3, the other 14 plants were divided into three types: (1) The 1st to 8th plants in Table 3, the SSR marker genotype and the table (2) In the 9th to 11th strains in Table 3, the SSR marker genotype and gliadin band type are different from the control; (3) In the 12th to 14th strains in Table 3, there are a large number of heterozygous strains in the SSR locus. conjugation point.

Table 3 Comparison of SSR marker genotypes, gliadin bands and phenotypic traits between 14 individual plants and control varieties

Among the 55 strains, the phenotype of 50 strains was significantly different from that of the control, and the 10th to 14th strains in Table 3 had no significant difference or little difference. There are 4 heterotypic sites among the 10 sites of the 11th strain in Table 3, and the band patterns of the 10 prolamin components are different from the control, indicating that the difference between this strain and the control is mainly in the grain protein. Among the 10 loci of the 12th to 14th plants, although there are not many heterozygous loci, there are as many as 6 to 9 heterozygous loci. Such plants are caused by cross-pollination, and the phenotype of the offspring will be separated, so it is judged as Miscellaneous.

There are two differences between the above 55 strains and the control genotype in the 10 SSR loci:

1) There are more than 2 heterotypic sites (strains 1-8 and 11), and the phenotype is significantly different;

2) There are 1-2 heterozygous sites and multiple heterozygous sites (individuals 9, 10, 12-14), and the phenotypic difference is not significant.

Summarizing the above two points, when there are more than 2 heterozygous loci (including heterozygous loci) in the 10 SSR loci of an individual, it can be clearly judged as a heterozygous strain from the perspective of phenotype and molecular markers. In this experiment, a total of 55 single plants conformed to this principle, but only 44 plants were identified as miscellaneous plants by the prolamin method. The number of miscellaneous plants identified by the method of the present invention was 11 more than that of the prolamin method. There is a certain defect in distinguishing cross-pollinated hybrid plants, which makes it impossible to distinguish. It showed that the identification accuracy of gliadin and field phenotype was not enough, and there was a certain error, while the SSR marker method was more accurate and effective in identifying hybrid plants, and could accurately distinguish the types of hybrid plants (exogenous hybrid, cross-pollination).

In order to further test the accuracy of the method for judging miscellaneous plants, the present invention carried out field identification of 21 individual plants among the above 55 miscellaneous plants. Plant each hybrid in 2 rows adjacent to its control varieties. Record the sowing date, emergence date, heading date, maturity date, seedling habit, flag leaf length, flag leaf width, flag leaf type, plant type, waxy stem and sheath, ear type, awn type, plant height, ear type of each material Length, number of fruiting spikelets per ear, grain shape, grain color, thousand-grain weight, the verification results are shown in Table 4:

Table 4 Field identification results of miscellaneous plants

The test results show that both heterozygous loci and heterozygous loci can be used as markers for heterozygous plants. Can be judged as miscellaneous.

sequence listing

<110> Beijing Academy of Agriculture and Forestry

<120> SSR molecular marker detection method, primer combination and application of purity of conventional wheat varieties

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 1

gcgaattagc atctgcatct gtttgag 27

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 2

cggtcaacca actactgcac aac 23

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 3

ccaattctgc ccataggtga 20

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 4

gaggaaataa gattcagcca actg 24

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 5

tgcaaactaa tcaccagcgt aa 22

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 6

cgctttctaa aactgttcgg gatttctaa 29

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

tgggtatgaa aggctgaagg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

atcgcgacta ttcaacgctt 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

gatcgagtga tggcagatgg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

tgtgaattac ttggacgtgg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

ctgccttctc catggtttgt 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 12

aatggccaaa ggttatgaag g 21

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 13

cggtctttgt ttgctctaaa cc 22

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 14

accggccatc tatgatgaag 20

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 15

ggattggagt taagagagaa ccg 23

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

gcagagtgat caatgccaga 20

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 17

caatcatttc cccctccc 18

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 18

aatcattgga aatccatatg cc 22

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 19

aggaaacaga aatatcgcgg 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 20

aggactgtgg ggaatgaatg 20

Claims (7)

1. the SSR molecular marker primer combination used for detecting the purity of conventional varieties of wheat is characterized in that, the primer combination is made up of following 10 pairs of primers: barc80-F:GCGAATTAGCATCTGCATCTGTTTGAG, barc80-R:CGGTCAACCAACTACTGCACAAC; barc324-F:CCAATTCTGCCCATAGGTGA, barc324-R:GAGGAAATAAGATTCAGCCAACTG; barc164-F:TGCAAACTAATCACCAGCGTAA, barc164-R:CGCTTTCTAAAACTGTTCGGGATTTCTAA; cfa2028-F:TGGGTATGAAAGGCTGAAGG, cfa2028-R:ATCGCGACTATTCAACGCTT; gwm161-F:GATCGAGTGATGGCAGATGG, gwm161-R:TGTGAATTACTTGGACGTGG; gwm610-F:CTGCCTTCTCCATGGTTTGT, gwm610-R: AATGGCCAAAGGTTATGAAGG; cfa2123-F:CGGTCTTTGTTTGCTCTAAACC, cfa2123-R:ACCGGCCATCTATGATGAAG; gwm294-F:GGATTGGAGTTAAGAGAGAACCG, gwm294-R:GCAGAGTGATCAATGCCAGA; gwm155-F: CAATCATTTTCCCCCTCCC, gwm155-R:AATCATTGGAAATCCATATGCC; gwm304-F:AGGAAACAGAAAATATCGCGG, gwm304-R:AGGACTGTGGGGAATGAATG. 2. The application of the combination of SSR molecular marker primers for detecting the purity of conventional wheat varieties according to claim 1 in the detection of the purity of conventional wheat varieties. 3. The SSR molecular marker detection method for the purity of conventional wheat varieties, characterized in that, the detection method comprises the step of using the primer combination according to claim 1 to carry out PCR amplification of the DNA of the wheat variety to be tested. 4. the SSR molecular marker detection method of wheat conventional variety purity according to claim 3, is characterized in that, described detection method comprises the following steps: (1) Extract the DNA of the wheat to be tested; (2) using the DNA extracted in step (1) as a template, using the primer combination according to claim 1 to carry out PCR amplification; (3) Capillary electrophoresis detection; (4) According to the capillary electrophoresis result in step (3), determine the purity of the wheat to be tested. 5. the SSR molecular marker detection method of wheat conventional variety purity according to claim 4, is characterized in that, in step (4), at first judge whether the variation site is the non-homozygous SSR molecular marker site, and the non-homozygous SSR molecular marker site is determined. After the combined SSR molecular marker sites are excluded, if there are at least 2 SSR molecular marker sites in a tested individual wheat individual that are different from most of the other tested individual individuals, the tested individual wheat individual is determined to be a hybrid. 6. the SSR molecular marker detection method of wheat conventional variety purity according to claim 4, is characterized in that, in step (4), when carrying two kinds of allelic variation on the same site of different wheat individuals to be tested If it is heterozygous and randomly distributed in different wheat individuals to be tested, it is determined that the site is a non-homozygous SSR molecular marker site. 7 . The SSR molecular marker detection method for the purity of conventional wheat varieties according to claim 3 , wherein the end of each primer in the primer combination is marked with a fluorescent group. 8 .

Images