CN109777881B - SSR molecular marker detection method for purity of conventional wheat variety, primer combination and application thereof - Google Patents

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to an SSR molecular marker detection method for purity of a conventional wheat variety, a primer combination and application thereof. The invention takes the examined wheat variety as a material, screens the SSR primers suitable for distinguishing the examined wheat variety with infinite amplification, takes fluorescence capillary electrophoresis as a main detection platform, and establishes a large-scale, high-flux, rapid and accurate SSR molecular marker detection technology for the purity of the wheat variety.

Description

SSR molecular marker detection method for purity of conventional wheat variety, primer combination and application thereof

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a method for detecting the purity of a conventional wheat variety by using an SSR molecular marker, a primer combination and application thereof.

Background

With the adjustment of the grain structure of the planting industry in China and the development of market economy, the seed quantity for wheat precision seeding is obviously reduced, and higher requirements on seed quality and variety purity are provided in production. The purity of the variety is one of important indexes for measuring the quality of seeds, and the existing identification methods are field plot planting identification, morphological identification, biochemical method and alcohol soluble protein method. The field planting identification has large occupied area, is time-consuming and labor-consuming, is easily influenced by environmental factors, and is difficult to distinguish individuals with similar phenotypes. The alcohol soluble protein method has the advantages of high speed, low cost, simple operation and the like, but the alcohol soluble protein is coded by only 6 gene loci, the gene loci are few, the components with similar molecular weights are difficult to separate, the alcohol soluble protein with low expression quantity is difficult to identify and the like, and the accuracy of the detection result is reduced.

With the rapid development of wheat genomics and whole genome sequencing technologies, a large number of SSR (Simple Sequence Repeat) markers are developed and utilized. The SSR marker has the advantages of abundant marker quantity, codominant heredity, no influence of identification period and environment, accuracy, reliability, simplicity, rapidness, low cost, good stability, easy automation and the like. However, the number of SSR markers is huge, and the number of SSR markers published by the Granngenes website and the Japanese wheat atlas network reaches 2760, and besides, many SSR markers are also disclosed in papers and research results published by other scholars.

The bred wheat variety in China is seriously homogenized due to the fact that part of backbone wheat germplasm is excessively used, the genetic basis is relatively narrow, and most SSR markers have no polymorphism or low polymorphism in the bred wheat variety. At present, the discrimination capability of a high-throughput SSR genotyping platform in the market is more than 1bp, so that 1bp motif SSR markers accounting for nearly 50% of wheat cannot be used in variety identification.

Disclosure of Invention

The invention aims to provide a SSR molecular marker detection method for the purity of a conventional wheat variety.

The invention also aims to provide an SSR molecular marker primer combination for detecting the purity of the conventional wheat variety

The invention further aims to provide the application of the SSR marker primer in the purity detection of the conventional wheat varieties.

According to the specific implementation mode of the invention, the primer names of 10 pairs of SSR primer combinations for identifying the purity of conventional wheat varieties, the chromosome location information of SSR molecular markers, the allelic variation amplification intervals, the primer sequences and the marker groups are shown in Table 1:

TABLE 1 SSR primer combinations for variety purity identification

The primers with the same fluorescence color need to be labeled with the same fluorescent dye at the same time, and the color of the labeled dye can be selected according to the emission and absorption wavelengths of the type of the capillary electrophoresis system.

The SSR molecular marker detection method for the purity of the conventional wheat variety comprises the following steps:

(1) extracting individual DNA of the wheat variety to be detected;

(2) performing PCR amplification by using the DNA extracted in the step (1) as a template and using SSR molecular marker primer pairs shown in Table 1;

(3) detecting by capillary electrophoresis;

(4) and (4) judging the purity of the wheat variety to be detected according to the electrophoresis result of the step (3).

According to the SSR molecular marker detection method for the purity of the conventional wheat variety, in the step (4), whether the variation locus is a non-homozygous SSR molecular marker locus or not is judged, after the non-homozygous SSR molecular marker locus is eliminated, if at least 2 SSR molecular marker loci different from most other to-be-detected individuals exist in a certain to-be-detected wheat individual, the to-be-detected wheat individual is judged to be a hybrid.

According to the SSR molecular marker detection method for the purity of the conventional wheat variety, in the step (4), when the same locus of different wheat individuals to be detected carries heterozygotes of two allelic variations or two allelic variations and is randomly distributed in different wheat individuals to be detected, the locus is judged to be a non-homozygous SSR molecular marker locus.

The invention has the beneficial effects that:

the 10 SSR markers and the corresponding primer combinations have the following characteristics in the identification of the bred wheat varieties:

1. the abundance of allelic variation of each SSR locus is high, 141 allelic variations are detected in 1463 examined wheat varieties by 10 SSR markers in China, 14.1 allelic variations are detected on each locus on average, the average PIC value of each marker is 0.69, and the SSR markers have high resolution on the wheat varieties;

2. the distribution frequency of allelic variation of each locus in the bred wheat variety is relatively uniform;

3. single-site, single-copy with positioning information;

4. the 10 SSR markers and the primer combinations thereof can be specifically amplified, and the banding pattern is simple and easy for reading the capillary peak value;

5. the motif of the screening SSR marker locus is more than 2 bp;

6. 10 SSR marks which are subjected to one-time electrophoresis, and mark that all allelic variation chip selection intervals amplified by the same fluorescent dye primer do not have overlapping regions and have difference of more than 15 bp;

7. the screened 10 SSR markers are finally determined after all the currently known varieties in China are subjected to genotyping;

8. the 10 SSR markers have good stability and repeatability and are convenient to popularize and apply;

9. no interlocking relationship exists among 10 SSR markers;

10. the SSR marker and the primer combination can be used for completing the identification of the purity of the variety in 3 days in an indoor laboratory, thereby greatly saving the cost of manpower, material resources, financial resources, time and land resources.

Drawings

FIG. 1 shows the distribution characteristics of non-homozygous sites, wherein lanes 1-20 are the individual numbers of A1202-32 samples;

FIG. 2 shows the banding pattern of the hybrid, Suxu No. 2 for 10 individuals No. 1-10, and hybrid for individual No. 1;

FIG. 3 shows the characteristics of a monophylic non-homozygous SSR site (Xgwm 294);

FIG. 4 shows the results of electrophoresis of 10 pairs of SSR primer combinations, FIG. 4-1 is a peak diagram of the electrophoresis of barc164, FIG. 4-2 is a peak diagram of the electrophoresis of barc324, FIG. 4-3 is a peak diagram of the electrophoresis of barc80, FIG. 4-4 is a peak diagram of the electrophoresis of cfa2028, and FIG. 4-5 is a peak diagram of the electrophoresis of gwm 161. FIGS. 4-6 are diagrams of cfa2123 electrophoretic peaks, FIGS. 4-7 are diagrams of gwm610 electrophoretic peaks, FIGS. 4-8 are diagrams of gwm304 electrophoretic peaks, FIGS. 4-9 are diagrams of gwm155 electrophoretic peaks, e.g., FIGS. 4-10 are diagrams of gwm294 electrophoretic peaks;

Detailed Description

Example 1

1. Determination of molecular markers of the invention

The SSR molecular markers finally determined by the method for identifying the purity of the conventional wheat varieties are shown in Table 2.

TABLE 2 SSR primer polymorphism information for variety purity identification

The primer screened by the invention has barc80, is 3bp motif, has 9 allelic variation in 1463 known varieties, and has PIC value of 0.61; barc324 was a 3bp motif with 13 allelic variants in 1463 known varieties with a PIC value of 0.66; barc164 is a 3bp motif with 15 allelic variations in 1463 known varieties with a PIC value of 0.77; cfa2028 is a 2bp motif with 7 allelic variations in 1463 known varieties with PIC values of 0.63; gwm161 is a 2bp motif with 17 allelic variants in 1463 known varieties with a PIC value of 0.65; gwm610 is a 2bp motif with 7 allelic variants in 1463 known varieties with a PIC value of 0.60; cfa2123 is a 2bp motif with 19 allelic variations in 1463 known varieties with a PIC value of 0.71; gwm294 is a 2bp motif with 24 allelic variants in 1463 known varieties with PIC values of 0.72; gwm155 is a 2bp motif with 12 allelic variants in 1463 known varieties with a PIC value of 0.75; gwm304 is a 2bp motif with 18 allelic variations in 1463 known varieties with a PIC value of 0.76.

2. Accurate discrimination of atypical strains (hybrid strains) and non-homozygous SSR sites

The non-homozygous SSR locus is characterized in that the same locus of different individuals carries heterozygotes of two allelic variations or two allelic variations respectively, and the distribution of the heterozygotes in different individuals is random, as shown in figure 1, 20 individuals of Huai Mai 23 carry genotypes from parents and parents or heterozygous genotypes of parents (No. 14 individuals) at the Xcwm65 locus respectively. The genotype of the hybrid strain is characterized in that the same individual carries allelic variation at more than 2 different sites different from that of a normal individual, and taking 10 individuals of the strain A1203-32 participating in the regional test as an example, as shown in figure 2, the genotypes of the individual No. 1 at the sites Xgwm155, Xgwm610, Xgwm294 and Xgwm437 are different from those of the individual No. 2-9, so the individual No. 1 is the hybrid strain.

As shown in fig. 3, the allelic variations of the plurality of samples, famesar 211 and luohan 7, of sample 1, at the position Xgwm294, were identical, only the allelic variations of the individuals, nos. 25 and 31 of sample 1 and 28 and 34 of sample 2 were different from the allelic variations of the plurality of samples, and after 29 additional site detections were performed on these individuals, it was determined that the differences were caused by segregation-like factors, rather than mixed with a hybrid (atypical strain), and among the non-homozygous SSR sites, the segregation-like non-homozygous site was a key factor for the misjudgment of the results.

The 10 SSR markers are used for analyzing and examining wheat varieties, including 321 varieties of wheat varieties in 10 ecological zones, such as Yangmai No. 2, Huai No. 18, Xuzhou No. 24, Yizhang No. 4110 and the like, and genotypes of test-participating wheat varieties participating in regional tests in Henan province, Beijing City and Hebei province, the results show that 10 SSR markers are used for distinguishing the ecological types of the wheat varieties obviously, for example, the test-participating wheat varieties in Henan and the Huanghuainan sheet wheat varieties are clustered in a large group, and the test-participating varieties in the winter wheat zone, the Hebei district and the Beijing district are clustered in a large group, so that the distinguishing capability of the 10 SSR markers is strong.

By labeling the 5 'end of the upstream primers at Xbarc80, Xbarc324, Xbarc164 with NED dye, the 5' end of the upstream primers at Xcfa2028 and Xgwm161 with PET dye, the 5 'end of the upstream primers at Xgwm610 and Xcfa2123 with FAM dye, and the 5' end of the upstream primers at Xgwm294, Xgwm155, and Xgwm304 with VIC dye, the 10 pairs of SSR primers can be electrophoresed together because the allelic variation amplification fragment size intervals of several sites labeled with the same dye differ by more than 15 bp. The electrophoresis results are shown in FIG. 4.

Example 2 accuracy compared to prolamin method

Selecting 8 wheat varieties (No. 8 Beijing, No. 18 Beijing, No. 4185 stone, Henong 825, Bao 5067, Yunlian 618, Luohan No. 11 and Taishan 257) from the varieties of Beijing, Hebei, Henan and Shandong, randomly selecting 100 individuals from each variety, taking one leaf from each individual to extract the genome DNA of the individual when the individual is sown to the tillering stage, detecting the genotype of 10 SSR sites of each individual plant, harvesting the seeds according to the individual plants, and analyzing the gliadin of the seeds; and planting plant rows in the field in the next year, and comparing the main agronomic characters of the plant rows such as heading stage, mature stage, growth stage, seedling habit, seedling stage leaf color, flag leaf length, flag leaf width, flag leaf type, adult plant leaf color, plant type, stem sheath wax, ear type, awn type, plant height, ear length, small ear number of each ear, grain shape, grain color, grain quality, thousand grain weight, disease resistance and the like.

Taking a plurality of single plants with consistent phenotype of each variety as a contrast, in 800 plants, 55 plants with the number of different loci from that of the contrast genotype larger than 1 are obtained, wherein 41 single plants with SSR marker genotypes, prolamin band types and phenotypic characters different from that of the contrast are judged to be hybrid plants; as shown in table 3, another 14 strains were classified into three types: (1) in the 1 st to 8 th strains in the table 3, SSR marker genotypes and phenotypes are different from those of the control; (2) in the 9 th to 11 th strains in the table 3, the SSR marker genotype and the alcohol soluble protein band type are different from the control; (3) in Table 3, there are 12-14 strains, and there are a large number of heterozygous loci in SSR loci.

Comparison of SSR marker genotype, prolamin banding pattern, phenotypic traits between the 314 individuals and the control varieties

The phenotype of 50 strains in 55 strains is obviously different from that of a control, and the 10 th to 14 th strains in the table 3 have no obvious difference or smaller difference. 4 of the 10 loci of strain 11 in Table 3 were heterotypic, and the banding pattern of the 10 prolamin components was different from the control, indicating that the difference between this strain and the control was mainly manifested in the grain protein. In 10 sites of 12 th to 14 th plants, although heterotypic sites are few, the heterozygous sites are as high as 6 to 9, and the plants are caused by cross pollination, and the phenotypes of the offspring are separated, so that the plants are judged to be the hybrid plants.

There are 2 cases of differences between the above 55 strains and the control genotype in 10 SSR loci:

1) more than 2 heterotypic sites (strains 1-8 and 11) exist, and the phenotype is obviously different;

2) 1-2 heterotypic loci and a plurality of heterozygous loci (9 th, 10 th, 12 th-14 th single plants) are provided, and the phenotype difference is not obvious.

In conclusion of the above two points, when there are more than 2 heterotypic sites (including heterozygous sites) in 10 SSR sites of an individual, the individual can be clearly identified as a hybrid strain from the viewpoint of phenotype and molecular marker. In the experiment, 55 plants are contained in a single plant which accords with the principle, but the prolamin method identifies that only 44 plants are contained in the mixed plants, the number of the mixed plants identified by the method is 11 more than that of the prolamin method, and the field phenotype has certain defects for distinguishing the heteropollen mixed plants, so that the heteropollen mixed plants cannot be distinguished. The identification accuracy of the alcohol soluble protein and the field phenotype is not enough, certain errors exist, the identification of the hybrid plants by the SSR marker method is more accurate and effective, and the types of the hybrid plants (exogenous hybrid and cross pollination) can be accurately distinguished.

In order to further check and judge the accuracy of the hybrid plant method, 21 single plants in the 55 hybrid plants are subjected to field identification. Each hybrid was planted in 2 rows adjacent to its control variety. Recording the sowing period, emergence period, heading period, mature period, seedling habit, flag leaf length, flag leaf width, flag leaf type, plant type, stem sheath wax, spike type, mango type, plant height, spike length, number of spikes of each spike, seed shape, seed color and thousand kernel weight of each material, and the verification results are shown in table 4:

TABLE 4 field identification of the hybrid plants

Test results show that the mutant site and the heterozygous site can be used as markers for hybrid plant judgment, and when more than two sites are different from a plurality of individuals, phenotypes of the mutant sites have significant differences on a plurality of characters, so that the mutant plants can be judged.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

SSR molecular marker detection method for purity of conventional wheat variety, primer combination and application thereof

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcgaattagc atctgcatct gtttgag 27

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cggtcaacca actactgcac aac 23

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccaattctgc ccataggtga 20

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaggaaataa gattcagcca actg 24

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgcaaactaa tcaccagcgt aa 22

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgctttctaa aactgttcgg gatttctaa 29

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgggtatgaa aggctgaagg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atcgcgacta ttcaacgctt 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gatcgagtga tggcagatgg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgtgaattac ttggacgtgg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctgccttctc catggtttgt 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aatggccaaa ggttatgaag g 21

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cggtctttgt ttgctctaaa cc 22

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

accggccatc tatgatgaag 20

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggattggagt taagagagaa ccg 23

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gcagagtgat caatgccaga 20

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

caatcatttc cccctccc 18

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aatcattgga aatccatatg cc 22

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aggaaacaga aatatcgcgg 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

aggactgtgg ggaatgaatg 20

Claims (7)

1. The SSR molecular marker primer combination for detecting the purity of the conventional wheat variety is characterized by consisting of the following 10 pairs of primers:

barc80-F:GCGAATTAGCATCTGCATCTGTTTGAG，

barc80-R:CGGTCAACCAACTACTGCACAAC；

barc324-F:CCAATTCTGCCCATAGGTGA，

barc324-R:GAGGAAATAAGATTCAGCCAACTG；

barc164-F:TGCAAACTAATCACCAGCGTAA，

barc164-R:CGCTTTCTAAAACTGTTCGGGATTTCTAA；

cfa2028-F:TGGGTATGAAAGGCTGAAGG，

cfa2028-R:ATCGCGACTATTCAACGCTT；

gwm161-F:GATCGAGTGATGGCAGATGG，

gwm161-R:TGTGAATTACTTGGACGTGG；

gwm610-F:CTGCCTTCTCCATGGTTTGT，

gwm610-R:AATGGCCAAAGGTTATGAAGG；

cfa2123-F:CGGTCTTTGTTTGCTCTAAACC，

cfa2123-R:ACCGGCCATCTATGATGAAG；

gwm294-F:GGATTGGAGTTAAGAGAGAACCG，

gwm294-R:GCAGAGTGATCAATGCCAGA；

gwm155-F:CAATCATTTCCCCCTCCC，

gwm155-R:AATCATTGGAAATCCATATGCC；

gwm304-F:AGGAAACAGAAATATCGCGG，

gwm304-R:AGGACTGTGGGGAATGAATG。

2. the application of the SSR molecular marker primer combination for detecting the purity of the conventional wheat variety according to claim 1 in the detection of the purity of the conventional wheat variety.

3. The SSR molecular marker detection method for the purity of the conventional wheat variety is characterized by comprising the step of carrying out PCR amplification on the DNA of the wheat variety to be detected by using the primer combination according to claim 1.

4. The SSR molecular marker detection method for the purity of a conventional variety of wheat according to claim 3, characterized in that the detection method comprises the following steps:

(1) extracting DNA of wheat to be detected;

(2) performing PCR amplification by using the DNA extracted in the step (1) as a template and the primer combination of claim 1;

(3) detecting by capillary electrophoresis;

(4) and (4) judging the purity of the wheat to be detected according to the capillary electrophoresis result in the step (3).

5. The SSR molecular marker detection method for the purity of a conventional wheat variety according to claim 4, characterized in that in step (4), it is first determined whether the mutation site is a non-homozygous SSR molecular marker site, after excluding the non-homozygous SSR molecular marker sites, if at least 2 SSR molecular marker sites different from most other individuals to be detected exist in a certain wheat individual to be detected, the wheat individual to be detected is determined to be a heterozygous strain.

6. The SSR molecular marker detection method for the purity of a conventional wheat variety according to claim 4, wherein in the step (4), when the same locus of different wheat individuals to be detected carries heterozygotes with two allelic variations and is randomly distributed in different wheat individuals to be detected, the locus is determined to be a non-homozygous SSR molecular marker locus.

7. The SSR molecular marker detection method for the purity of a conventional wheat variety according to claim 3, wherein a fluorophore is labeled at the end of each primer in the primer combination.

Images