CN111850158B - Specific SNP locus combination for purity identification of common wheat conventional variety and identification method - Google Patents
Specific SNP locus combination for purity identification of common wheat conventional variety and identification method Download PDFInfo
- Publication number
- CN111850158B CN111850158B CN202010815168.3A CN202010815168A CN111850158B CN 111850158 B CN111850158 B CN 111850158B CN 202010815168 A CN202010815168 A CN 202010815168A CN 111850158 B CN111850158 B CN 111850158B
- Authority
- CN
- China
- Prior art keywords
- sequence
- snp
- forward primer
- formula
- wheat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of variety purity identification, in particular to a specific SNP locus combination for identifying the purity of a conventional variety of wheat and an identification method. The SNP site combination comprising WSNP 01-WSNP 24 was determined. Based on the specific SNP locus combination, the high-throughput detection of the purity of the conventional wheat variety can be realized, and the method has the advantages of high accuracy, good stability, low cost, simple operation, convenience, rapidness and the like, and has a very wide application prospect.
Description
Technical Field
The invention relates to the field of variety purity identification, in particular to a specific SNP locus combination and an identification method for identifying the purity of a common wheat conventional variety.
Background
Wheat is one of important grain crops in China, the quality of wheat seeds is directly related to the vital interests of farmers and the national grain safety, the seed quality is monitored in various links such as seed production, processing, storage, sale and the like, and the method has important social and economic significance for ensuring the grain safety in China and protecting the vital economic interests of breeders and farmers. In recent years, with the adjustment of the grain structure of the planting industry in China and the development of market economy, the seed consumption for wheat precision seeding is obviously reduced, and higher requirements on seed quality and variety purity are provided in production. The purity of the variety is one of important indexes for measuring the quality of the seeds, and the identification methods specified by the related national standards at present are a morphology identification method, a phenol dyeing method, a sodium hydroxide determination method, a prolamin method and a field plot planting identification method. The morphological identification method, the phenol dyeing method, the sodium hydroxide determination method, the alcohol soluble protein method and the like have the advantages of high speed, low cost, simple operation and the like, but the distinguishing capability is very limited, and the accuracy of the identification result is reduced. The field planting and identification has large occupied area, is time-consuming and labor-consuming, is easily influenced by environmental factors, and is difficult to distinguish individuals with similar phenotypes. In conclusion, the above methods have not been able to meet the requirement of accurate and rapid identification, and bring great difficulty to the supervision of seed quality.
With the development of molecular biology, the DNA fingerprint detection technology represented by SSR and SNP markers has the advantages of co-dominance, high polymorphism, uniform distribution on a genome, high accuracy, better repeatability, higher flux, easy realization of automation and the like, so that atypical individuals can be quickly and accurately identified, and the accurate and effective supervision of seed quality is realized. These two markers have been successively recommended by the international association for plant new variety protection (UPOV), international seed consortium (ISF) and international seed inspection association (ISTA) as preferred markers for crop variety identification and fingerprint database construction. At present, research and application of an SSR marker method in variety identification basically tend to be mature, but the SSR marker method has the defects of difficulty in realizing data integration, low flux and the like. The SNP marker is a allele II, the data statistics is simple, and meanwhile, various SNP high-throughput detection platforms are successively developed by large companies at home and abroad, so that the technical defects of the SNP marker can be well compensated. The current high-throughput SNP detection method mainly comprises DNA chip, site-directed sequencing and competitive Allele Specific PCR (KASP) technology and the like. The chip technology is a site high-flux detection technology, has higher cost and is suitable for detecting a large number of sites in a small amount of samples; the fixed-point sequencing technology has high cost and long detection time and is suitable for constructing a large amount of sample fingerprint databases; the KASP technology is a sample high-throughput detection technology, can be used for carrying out accurate double allele judgment on SNPs, has the advantages of high throughput, high quality, accuracy, low cost, simple and flexible operation and the like, is suitable for detecting a large number of samples with a small number of loci, and is particularly suitable for the requirement of a variety purity detection technology.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to provide a group of specific SNP locus combinations developed based on KASP technology and used for identifying the purity of common wheat varieties, and based on the specific SNP locus combinations, high-throughput SNP detection on the purity of the common wheat varieties can be realized.
The invention further aims to provide a method for identifying the purity of the conventional wheat variety.
The specific SNP locus combination for identifying the purity of the conventional wheat variety comprises 24 SNP loci of a wheat genome, wherein the number of the SNP loci is
The above-mentioned
The site details are shown in Table 1.
TABLE 1 specific SNP sites for purity identification of wheat conventional species
The above-mentioned
The physical position and the flanking sequence of the SNP locus are determined based on the whole genome sequence of the wheat, Chinese spring, wherein the whole genome sequence version of the wheat, Chinese spring is IWGSC RefSeq v1.0。
Each SNP locus in the specific SNP locus combination is distributed on 21 chromosomes of a wheat genome, the number of the SNP loci on each chromosome is 1-2, and 24 SNP loci are provided. Based on the special SNP locus combination, the high-throughput SNP typing detection of the purity of the conventional wheat variety can be realized, and the method has the advantages of high accuracy, good repeated stability, high efficiency, convenience and rapidness.
The invention also provides a primer combination for amplifying the specific SNP sites, which comprises the primer group with 24 SNP sites and is numbered
The primer combination
Respectively used for detecting corresponding SNP locus combinations
The sequence of the forward primer 1 of WSNP01p is: 5 'GGAGAACAAAGCAGAAAAGCTGCAA 3' of the composition,
the sequence of the forward primer 2 of WSNP01p is as follows: 5 'GAGAACAAAGCAGAAAAGCTGCAG 3' of the formula I,
the sequence of the reverse primer of WSNP01p was: 5 'GTGAACATTCAGGATATTTGTGCTGCATA 3';
the sequence of the forward primer 1 of WSNP02p is: 5 'GGCAACTCTAACAAACACACTCC 3' of the formula I,
the sequence of the forward primer 2 of WSNP02p is as follows: 5 'AGGGCAACTCTAACAAACACACTCT 3' of the formula I,
the sequence of the reverse primer of WSNP02p was: 5 'GACGAACTCGGCGGGACCATTT 3';
the sequence of the forward primer 1 of WSNP03p is: 5 'AACACATTCAGAGAATATGACTAGGG 3' of the formula I,
the sequence of the forward primer 2 of WSNP03p is as follows: 5 'ATAACACATTCAGAGAATATGACTAGGA 3' of the formula I,
the sequence of the reverse primer of WSNP03p is: 5 'GCCTGAGCGGGCGTTTGGTAA 3's;
the sequence of the forward primer 1 of WSNP04p is: 5 'CCTCCCTCCCGACCTCTG 3' of the formula I,
the sequence of the forward primer 2 of WSNP04p is: 5 'CCCTCCCTCCCGACCTCTA 3' of the formula I,
the sequence of the reverse primer of WSNP04p is: 5 'CTAGTTGGGCCGAGGCAGTTGAA 3';
the sequence of the forward primer 1 of WSNP05p was: 5 'AGTTGAAAACACCGAACCAGCGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP05p was: 5 'GTTGAAAACACCGAACCAGCGG 3' of the reaction mixture,
the sequence of the reverse primer of WSNP05p was: 5 'GGTGAGAGCAAGGATCCCAATCTAT 3';
the sequence of the forward primer 1 of WSNP06p is as follows: 5 'CATGAGATCCTAAATCAGAGTCGCA 3' of the formula I,
the sequence of the forward primer 2 of WSNP06p was: 5 'ATGAGATCCTAAATCAGAGTCGCG 3' of the formula I,
the sequence of the reverse primer of WSNP06p was: 5 'GGTCAAGTTTTCTGGACCCCATAATTATT 3';
the sequence of the forward primer 1 of WSNP07p was: 5 'CGATTGAATCTCAAGCGAACAAACG 3' of the formula I,
the sequence of the forward primer 2 of WSNP07p is as follows: 5 'GCGATTGAATCTCAAGCGAACAAACA 3' of the formula I,
the sequence of the reverse primer of WSNP07p was: 5 'TGTAGACATCTAGCAACCCCCTGAA 3';
the sequence of the forward primer 1 of WSNP08p is: 5 'GGTAAGCTTTGCCTAGCTTTCCTAT 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP08p was: 5 'GTAAGCTTTGCCTAGCTTTCCTAC 3' of the formula I,
the sequence of the reverse primer of WSNP08p was: 5 'GTTTGTCCAACTAAGATAGAGTATGGGAA 3's;
the sequence of the forward primer 1 of WSNP09p is: 5 'GTAAGGGACACACCTCCATCCAT 3' of the formula I,
the sequence of the forward primer 2 of WSNP09p was: 5 'AAGGGACACACCTCCATCCAG 3' of the formula I,
the sequence of the reverse primer of WSNP09p was: 5 'ATAGCTAGATTGTCATCTGGCCAAACAAA 3';
the sequence of the forward primer 1 of WSNP10p is: 5 'GATAACAGCGTTTTCCTGACGAGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP10p is as follows: 5 'ATAACAGCGTTTTCCTGACGAGG 3' of the reaction mixture,
the sequence of the reverse primer of WSNP10p was: 5 'CCATCCCCAACCATAGGACCGAT 3';
the sequence of the forward primer 1 of WSNP11p is: 5 'AGATTCCTGGAGCTGCGTTTGC 3' of the formula I,
the sequence of the forward primer 2 of WSNP11p was: 5 'AGATTCCTGGAGCTGCGTTTGG 3' of the formula I,
the sequence of the reverse primer of WSNP11p was: 5 'AGTTGAATTTGGCGGACGTGAGGTT 3';
the sequence of the forward primer 1 of WSNP12p is: 5 'CACAGGGATACCGAAACATGGA 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP12p was: 5 'CACAGGGATACCGAAACATGGG 3' of the reaction mixture,
the sequence of the reverse primer of WSNP12p was: 5 'TTGTTACCGATTTTGTTCTCTTTTGTCGTT 3';
the sequence of the forward primer 1 of WSNP13p is as follows: 5 'GGAGATCTGCTAGAGACGCCT 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP13p is as follows: 5 'GGAGATCTGCTAGAGACGCCG 3' of the formula I,
the sequence of the reverse primer of WSNP13p was: 5 'GGATGCCATGCCATGAGTTAGTGTT 3';
the sequence of the forward primer 1 of WSNP14p is as follows: 5 'GCGTTCGAATTAAGGAGAGAATCAG 3' of the formula I,
the sequence of the forward primer 2 of WSNP14p was: 5 'GGCGTTCGAATTAAGGAGAGAATCAA 3' of the formula I,
the sequence of the reverse primer of WSNP14p was: 5 'CAGTGTCGTAGGCTGGTCGCTT 3';
the sequence of the forward primer 1 of WSNP15p is: 5 'CAATCATATTGTTTTGGCGAGGAGC 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP15p was: 5 'AACAATCATATTGTTTTGGCGAGGAGT 3' of the formula I,
the reverse primer of WSNP15p has the sequence: 5 'CAGAGCTGAACCCCACTGGTGTA 3';
the sequence of the forward primer 1 of WSNP16p is: 5 'AGGCTGAGCAAGAGTTCTTCTG 3' of the formula I,
the sequence of the forward primer 2 of WSNP16p was: 5 'GTAGGCTGAGCAAGAGTTCTTCTA 3' of the formula I,
the sequence of the reverse primer of WSNP16p was: 5 'TATTCTTCTGCTCGACGTCGCACTT 3';
the sequence of the forward primer 1 of WSNP17p was: 5 'CCTTCCTCTCCGTGATCGTCAT 3' of the formula I,
the sequence of the forward primer 2 of WSNP17p was: 5 'CTTCCTCTCCGTGATCGTCAG 3' of the formula I,
the sequence of the reverse primer of WSNP17p was: 5 'GGTTTGCCGGCTAGACCACGTA 3';
the sequence of the forward primer 1 of WSNP18p was: 5 'GAACAAATTAGAGATGCTATTAAGTGGG 3' of the formula I,
the sequence of the forward primer 2 of WSNP18p was: 5 'GAACAAATTAGAGATGCTATTAAGTGGA 3' of the formula I,
the sequence of the reverse primer of WSNP18p was: 5 'CCAAGTTATCGTGGCGTACAAGACAT 3';
the sequence of the forward primer 1 of WSNP19p is as follows: 5 'CATCTCTTCACGGTACATCAACTCAT 3' of the formula I,
the sequence of the forward primer 2 of WSNP19p was: 5 'ATCTCTTCACGGTACATCAACTCAC 3' of the reaction mixture,
the sequence of the reverse primer of WSNP19p was: 5 'GTGGCCATCCGACAGAAAAAGTATTAATT 3';
the sequence of the forward primer 1 of WSNP20p was: 5 'ATGGGCCTGTTGAACTAGCCAC 3' of the formula I,
the sequence of the forward primer 2 of WSNP20p was: 5 'CATGGGCCTGTTGAACTAGCCAT 3' of the formula I,
the reverse primer of WSNP20p has the sequence: 5 'GGAGTAAATCGCATAGAACCACCATAAAT 3';
the sequence of the forward primer 1 of WSNP21p is: 5 'CGCACGGGACTCTGTCCACA 3' of the formula I,
the sequence of the forward primer 2 of WSNP21p was: 5 'GCACGGGACTCTGTCCACC 3' of the formula I,
the sequence of the reverse primer of WSNP21p was: 5 'GGACTGTCTAGTTGTTGCAATCGCAT 3';
the sequence of the forward primer 1 of WSNP22p is: 5 'GCCAAAAGCCCAACACAGAGGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP22p is: 5 'CCAAAAGCCCAACACAGAGGC 3' of the reaction mixture,
the reverse primer sequence of WSNP22p was: 5 'GCTTCAAGCTGTGGATCGCTATCTA 3';
the sequence of the forward primer 1 of WSNP23p is: 5 'CAGGGAAAGATCATTAACGTCAACC 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP23p is: 5 'GCAGGGAAAGATCATTAACGTCAACT 3' of the formula I,
the sequence of the reverse primer of WSNP23p was: 5 'GTCCCGACTTCGAATTAATGAAGCCAT 3's;
the sequence of the forward primer 1 of WSNP24p is: 5 'AGGGAATTCTTCTACTTTTCTAAACCG 3' of the formula I,
the sequence of the forward primer 2 of WSNP24p was: 5 'TAGGGAATTCTTCTACTTTTCTAAACCA 3' of the formula I,
the sequence of the reverse primer of WSNP24p was: 5 'GTTCAGTGTTGGGTCCGTCTGTAAA 3';
the invention also provides a kit for identifying the purity of the conventional wheat variety, which comprises mixed solution or powder of the primer combination, wherein each primer group consists of a forward primer 1, a forward primer 2 and a reverse primer of the same primer group.
The kit for identifying the purity of the wheat conventional variety is characterized in that the 5' ends of the two forward primers respectively carry different sequence tags, and the nucleotide sequences of the sequence tags are different from each other and are different from the wheat genome sequence.
The kit for identifying the purity of the conventional wheat variety is characterized in that the molar ratio of the two forward primers to the reverse primers is 2:2: 5.
The kit for identifying the purity of the conventional wheat variety further comprises a PCR (polymerase chain reaction) premixed solution, wherein the PCR premixed solution contains a fluorescent probe and a quenching probe, the nucleotide sequence of the fluorescent probe is consistent with that of a sequence label, and the 5' end of the fluorescent probe is connected with a fluorescent group; the nucleotide sequence of the quenching probe is reversely complementary with the nucleotide sequence of the sequence tag, and the 3' end of the quenching probe is connected with a quenching group.
The method for identifying the purity of the conventional variety of wheat comprises the following steps:
(1) extracting DNA of a wheat variety to be detected;
(2) genotyping was performed using KASP technology: adding each group of primer mixed liquor and PCR premixed liquor in the SNP primer combination by taking the DNA in the step (1) as a template to perform PCR amplification; detecting a fluorescent signal of the PCR amplification product by using a fluorescent detector, and obtaining the genotype of the wheat variety to be detected at the SNP marker site corresponding to the primer combination according to the color of the fluorescent signal;
(3) calculating the purity of the variety: and (3) carrying out statistical analysis on the genotype of the individual to be detected sample obtained in the step (2), identifying the atypical individual, and calculating the purity of the variety.
According to the method for identifying the purity of the conventional wheat seed, in the step (3), whether each SNP locus is a non-homozygous locus is judged, after the non-homozygous SNP loci are eliminated, if the genotype of a certain wheat individual to be detected is different from that of other individuals to be detected on more than 2 SNP loci, the wheat individual to be detected is judged to be an atypical individual.
According to the method for identifying the purity of the conventional wheat variety, in the step (3), when a certain locus has two kinds of allelic variation from parents in a sample group to be detected and is randomly distributed in different wheat individuals to be detected, the locus is judged to be a non-homozygous SNP locus.
The technical scheme of the invention has the advantages and benefits that:
1. the 24 specific SNP loci provided by the invention are determined by multiple tests of multiple samples, have good repeatability and stability and are convenient to popularize and apply;
2. the specific SNP locus combination provided by the invention has the advantages that the identification efficiency of 1433 examined wheat varieties can reach 95.67%, the resolution is high, and the detection cost is greatly reduced on the basis of ensuring the accuracy of the variety purity identification result;
3. the method for identifying the purity of the conventional variety of wheat solves the interference of non-homozygous SNP sites on the accurate judgment of atypical individuals, and ensures the accuracy of the identification result of the purity of the variety;
4. the specific SNP locus combination and the identification method for identifying the purity of the conventional wheat variety provided by the invention only need to add the specific SNP primer mixed solution and the universal PCR premixed solution into a PCR micropore reaction plate containing a DNA sample for PCR amplification, and a fluorescence detector is adopted for analyzing PCR products, so that the purity detection of 1 variety can be completed within 1 person and half a day. The method has the advantages of simple and convenient operation, high flux, accuracy, high efficiency, low cost, manpower and material resource saving and the like.
Drawings
FIG. 1 shows the variety discrimination for different combinations of SNP sites;
FIG. 2 shows a genotyping map for 24 SNP sites.
Detailed Description
The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The test materials or reagents used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The PCR master mix used in the following examples was purchased from LGC, British under the trade designation KBS-1016-003-
Example 1, 24 specific SNP sites for purity identification of wheat conventional varieties developed based on KASP technology
189 samples with extensive heredity representativeness are taken as materials, 420 SNP loci which have high typing quality (PHR type), less than 10 percent of deletion rate, more than 0.3 of minimum allelic variation frequency (MAF), less than 0.8 of linkage disequilibrium value (LD), more than 2M of physical distance and are uniformly distributed on a chromosome are screened out, locus flanking sequences are obtained, and KASP primers are designed and synthesized.
95 samples of 189 samples were genotyped by using KASP primers, and 282 SNP sites with good automatic typing effect and low deletion rate were selected.
1433 wheat approval standard samples in China are used as materials to evaluate 282 SNP sites, and 112 SNP sites with good repeatability and stability and small deletion rate are screened out. Based on fingerprint data of 112 SNP sites of 1433 wheat standard samples, the optimal site combination of 24 SNPs is determined, the recognition efficiency of the combination on wheat varieties can reach 95.67%, the requirements on detection efficiency and accuracy are met, the detection cost is obviously reduced, and the operation is convenient.
The small varieties which cannot be distinguished by the 24 SNP locus combinations have high spectral correlation or are substantively derived varieties.
The genotyping results of the 24 SNP loci of the invention are shown in figure 2, and each primer group can obtain good genotyping effect in individual samples of varieties to be detected.
The polymorphism information of the 24 SNP sites of the invention is shown in Table 3.
TABLE 224 polymorphism information for the dedicated SNP sites
According to the flanking sequences of 24 SNP sites, aiming at each SNP site, two forward primers are designed at the upstream of the SNP site, and a reverse primer is designed at the downstream. The sequence information of the designed primers for the 24 SNP sites is shown in Table 3. The primer groups WSNP01 p-WSNP 24p are respectively used for detecting the markers WSNP 01-WSNP 24.
The MAF and PIC values of the 24 special SNP loci are calculated according to 1433 examined wheat varieties.
TABLE 3 primer set for SNP marker specific for PCR amplification
Example 2 detection of purity of conventional variety Jinghua No. 10 of wheat to be detected by using specific SNP marker combination of the invention
The detection method comprises the following steps:
1. DNA preparation
95 seeds of the variety to be detected, namely Jinghua No. 10, are randomly picked, and DNA is extracted. Ensuring that the quantity and quality of the extracted DNA meet the requirement of PCR amplification, no degradation of the DNA and ultraviolet light of the solutionAbsorbance OD 260 And OD 280 The ratio of (A) to (B) is preferably 1.70-2.0, the concentration of DNA is above 30 ng/. mu.L, and the total amount of DNA is at least 2 ug. The DNA of each seed was diluted to 30 ng/. mu.L and stored at 4 ℃ for further use.
2. Genotyping Using the KASP technique
Primers specific to the 24 SNP sites (WSNP 01 p-WSNP 24p) in example 1 were selected and detected. Sequence tags A and B are respectively added to the 5' ends of the forward primer 1 and the forward primer 2
Sequence tag A: GAAGGTGACCAAGTTCATGCT, respectively;
sequence tag B: GAAGGTCGGAGTCAACGGATT, respectively;
the sequence tag A and the sequence tag B are suitable for KASP Master mix (PCR premix) of LGC company, UK. After the primers are synthesized, dissolving the three primers to 100 mu M by using 10mM Tris-HCl with pH 8.3, respectively taking 18 mu L of two forward primer solutions, 45 mu L of reverse primer solution and 69 mu L of 10mM Tris-HCl with pH 8.3, and mixing to obtain 150ul of primer mixed solution for later use;
KASP Master mix (PCR premix) contains fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, ROX internal reference dye, KlearTaq DNA polymerase, dNTP and MgCl 2 Supplied by LGC corporation, uk.
The fluorescent group A carried by the fluorescent probe A is FAM, and the fluorescent signal is blue; the fluorescent group B carried by the fluorescent probe B is HEX, and the fluorescent signal is red in particular; the quenching probe is provided with a quenching group BHQ.
The genotyping detection procedure was as follows:
(1) 95 seed DNAs and ddH 2 O (negative control, NTC) was dispensed into 96 PCR microwells of 384-well plates, respectively;
(2) add primer mix and general KASP Master mix, plate and centrifuge for 1min to each well and perform water bath PCR according to the following reaction system and reaction conditions:
the reaction system of the PCR is as follows: 1.5. mu.L of template DNA at 30 ng/. mu.L; 1.5 mu L of PCR premix; the primer mixture was 0.042. mu.L, wherein the final concentration of both forward primers was 0.504nM and the final concentration of reverse primer was 1.26 nM.
The reaction conditions of the PCR are as follows: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, annealing extension at 61-55 ℃ for 60s, and annealing extension in each cycle is reduced by 0.6 ℃ for 10 cycles; denaturation at 94 ℃ for 20s, annealing and extension at 55 ℃ for 60s, and 26-36 cycles.
(3) After the step (2) is completed, when the temperature of the PCR amplification product is reduced to be below 40 ℃, a qPCR instrument or a FRET-function enzyme-labeling instrument is used for reading fluorescence signals, and the genotyping results of 95 individuals of the sample to be detected at the SNP marker sites with the numbers of WSNP 01-WSNP 24 are obtained according to the colors of the fluorescence signals (see tables 4-1 and 4-2).
If the fluorescence signal is weak after the end of PCR amplification, which affects data analysis, the number of cycles needs to be increased until the result is satisfactory. The program for each additional cycle was 94 ℃ for 20s, 57 ℃ for 60s, 3 cycles, with scans after each additional cycle.
TABLE 4-1
TABLE 4-2
3. Calculation of variety purity
(1) And (3) carrying out statistical analysis on the genotypes of the 24 SNP loci of 95 individuals of the sample to be detected, and firstly judging whether the 24 SNP loci are non-homozygous loci.
The non-homozygous SNP locus is characterized in that the locus has two kinds of allelic variation from parents in a sample group to be detected, and when the locus is randomly distributed in different wheat individuals to be detected, the locus is judged to be the non-homozygous SNP locus. As shown in Table 4, 95 individuals of 'Jinghua No. 10' carry genotypes from a parent and a mother or heterozygous genotypes of the parent and the mother at a site WSNP20, namely 55 individuals carry AA genotypes, 39 individuals carry GG genotypes, 1 individual carries AG genotypes, and two allelic variations A and G are randomly distributed in different wheat individuals to be detected and are judged to be non-homozygous SNP sites.
(2) After non-homozygous SNP sites are eliminated, if 2 or more sites in a certain individual to be detected are different from other individuals to be detected, the wheat individual to be detected is judged to be an atypical individual. As shown in Table 4, after excluding the non-homozygous site WSNP20, 93 individuals had the same genotype at the remaining 23 SNP sites, and were normal strains; the individual with the number of 25 is judged as an atypical individual by being different from other 93 individuals at 8 SNP sites such as WSNP02, WSNP10, WSNP13, WSNP15, WSNP18 and WSNP 19; the individual with the number 81 was judged as an atypical individual, differing from the other 93 individuals at 8 SNP sites such as WSNP02, WSNP07, WSNP10, WSNP15, WSNP18 and WSNP 19.
(3) And (3) calculating the purity of the variety according to the number of the atypical individuals and the total number of the detected samples in the step (2).
The purity of the variety is expressed as the percentage of the number of normal individuals (total number of test samples minus the number of atypical individuals) to the total number of test samples. The variety purity of the variety to be detected, namely 'Jinghua No. 10', is as follows:
(95-2)/95*100％＝97.9％。
sequence listing
<110> agriculture and forestry academy of sciences of Beijing City
<120> specific SNP locus combination for purity identification of common wheat conventional variety and identification method
<160> 30
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggagaacaaa gcagaaaagc tgcaa 25
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gagaacaaag cagaaaagct gcag 24
<210> 3
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtgaacattc aggatatttg tgctgcata 29
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggcaactcta acaaacacac tcc 23
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
agggcaactc taacaaacac actct 25
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gacgaactcg gcgggaccat tt 22
<210> 7
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aacacattca gagaatatga ctaggg 26
<210> 8
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ataacacatt cagagaatat gactagga 28
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gcctgagcgg gcgtttggta a 21
<210> 10
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cctccctccc gacctctg 18
<210> 11
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ccctccctcc cgacctcta 19
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ctagttgggc cgaggcagtt gaa 23
<210> 13
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
agttgaaaac accgaaccag cga 23
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gttgaaaaca ccgaaccagc gg 22
<210> 15
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ggtgagagca aggatcccaa tctat 25
<210> 16
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
catgagatcc taaatcagag tcgca 25
<210> 17
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
atgagatcct aaatcagagt cgcg 24
<210> 18
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
ggtcaagttt tctggacccc ataattatt 29
<210> 19
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cgattgaatc tcaagcgaac aaacg 25
<210> 20
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gcgattgaat ctcaagcgaa caaaca 26
<210> 21
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tgtagacatc tagcaacccc ctgaa 25
<210> 22
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ggtaagcttt gcctagcttt cctat 25
<210> 23
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
gtaagctttg cctagctttc ctac 24
<210> 24
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gtttgtccaa ctaagataga gtatgggaa 29
<210> 25
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gtaagggaca cacctccatc cat 23
<210> 26
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
aagggacaca cctccatcca g 21
<210> 27
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
atagctagat tgtcatctgg ccaaacaaa 29
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
gataacagcg ttttcctgac gaga 24
<210> 29
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
ataacagcgt tttcctgacg agg 23
<210> 30
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
ccatccccaa ccataggacc gat 23
Claims (1)
1. The method for identifying the purity of the conventional wheat variety is characterized by comprising the following steps of:
(1) extracting DNA of a wheat variety seed sample to be detected;
(2) taking the DNA in the step (1) as a template, adding a specific primer combination and a PCR premix solution of the SNP locus combination for detecting the purity identification of the conventional wheat variety, carrying out PCR amplification, detecting a fluorescent signal of a PCR amplification product, and obtaining the genotype of the wheat variety to be detected at the SNP locus corresponding to the specific primer of the PCR amplification product according to the color of the fluorescent signal;
(3) calculating the purity of the variety, performing statistical analysis on the genotype of the individual to be detected at the SNP site of the sample obtained in the step (2), identifying the atypical individual, and calculating the purity of the variety according to the number of the atypical individual and the total number of the detected samples;
judging whether each SNP locus is a non-homozygous locus, excluding the non-homozygous SNP loci, and judging that a wheat individual to be detected is an atypical individual if the genotype of the wheat individual to be detected is different from that of other individuals to be detected on 2 or more SNP loci;
when a certain locus has two kinds of allelic variation from parents in a sample group to be detected and is randomly distributed in different wheat individuals to be detected, the locus is judged to be a non-homozygous SNP locus,
the SNP locus combination for identifying the purity of the conventional wheat variety consists of the following 24 SNP loci:
the SNP locus WSNP01 is located on the 1A chromosome of wheat, the physical position of SNP is 27215962, and the allelic gene type is A/G;
the SNP locus WSNP02 is located on the 1B chromosome of wheat, the physical position of SNP is 340381039, and the allelic gene type is T/C;
the SNP locus WSNP03 is located on the 1D chromosome of wheat, the physical position of SNP is 427323196, and the allelic gene type is A/G;
the SNP locus WSNP04 is located on the 2A chromosome of wheat, the physical position of SNP is 174150002, and the allelic gene type is A/G;
the SNP locus WSNP05 is located on the 2B chromosome of wheat, the physical position of SNP is 773821814, and the allelic gene type is A/G;
the SNP locus WSNP06 is located on the 2D chromosome of wheat, the physical position of SNP is 28783896, and the allelic gene type is T/C;
the SNP locus WSNP07 is located on a 3A chromosome of wheat, the physical position of the SNP is 25908324, and the allele type is A/G;
the SNP locus WSNP08 is located on the 3B chromosome of wheat, the physical position of SNP is 627720241, and the allelic gene type is A/G;
the SNP locus WSNP09 is located on a 3D chromosome of wheat, the physical position of SNP is 537495536, and the allelic gene type is T/G;
the SNP locus WSNP10 is located on the 4A chromosome of wheat, the physical position of SNP is 532224647, and the allele is A/G;
the SNP locus WSNP11 is located on the 4B chromosome of wheat, the physical position of SNP is 636757506, and the allelic gene type is C/G;
the SNP locus WSNP12 is located on the 4D chromosome of wheat, the physical position of SNP is 11870112, and the allelic gene type is A/G;
the SNP locus WSNP13 is located on the 5A chromosome of wheat, the physical position of SNP is 448113730, and the allelic gene type is A/C;
the SNP locus WSNP14 is located on the 5B chromosome of wheat, the physical position of SNP is 6594624, and the allelic gene type is T/C;
the SNP locus WSNP15 is located on the 5B chromosome of wheat, the physical position of SNP is 281675472, and the allelic gene type is A/G;
the SNP locus WSNP16 is located on the 5D chromosome of wheat, the physical position of SNP is 82481988, and the allelic gene type is T/C;
the SNP locus WSNP17 is located on 6A chromosome of wheat, the physical position of SNP is 457660545, and the allele type is A/C;
the SNP locus WSNP18 is located on the 6B chromosome of wheat, the physical position of SNP is 439018758, and the allelic gene type is T/C;
the SNP locus WSNP19 is located on the 6B chromosome of wheat, the physical position of SNP is 630873069, and the allelic gene type is T/C;
the SNP locus WSNP20 is located on the 6D chromosome of wheat, the physical position of SNP is 471905419, and the allelic gene type is A/G;
the SNP locus WSNP21 is located on the 7A chromosome of wheat, the physical position of SNP is 707833467, and the allelic gene type is A/C;
the SNP locus WSNP22 is located on the 7B chromosome of wheat, the physical position of SNP is 721402941, and the allelic gene type is A/C;
the SNP locus WSNP23 is located on the 7D chromosome of wheat, the physical position of SNP is 411596748, and the allelic gene type is T/C;
the SNP locus WSNP24 is located on the 7D chromosome of wheat, the physical position of SNP is 508179540, and the allelic gene type is T/C;
the physical location of the WSNP 01-WSNP 24 SNP site is determined based on the whole genome sequence version of chinese spring wheat, IWGSC RefSeq v 1.0;
the specific primer combination consists of the detection primers of the 24 SNP sites, and the specific primer for detecting each SNP site consists of two forward primers and one reverse primer, and the sequence of the specific primer is as follows:
the sequence of the forward primer 1 of WSNP01 was: 5 'GGAGAACAAAGCAGAAAAGCTGCAA 3' of the formula I,
the sequence of the forward primer 2 of WSNP01 was: 5 'GAGAACAAAGCAGAAAAGCTGCAG 3' of the formula I,
the reverse primer of WSNP01 has the sequence of 5 'GTGAACATTCAGGATATTTGTGCTGCATA 3';
the sequence of the forward primer 1 of WSNP02 was: 5 'GGCAACTCTAACAAACACACTCC 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP02 was: 5 'AGGGCAACTCTAACAAACACACTCT 3' of the formula I,
the sequence of the reverse primer of WSNP02 is: 5 'GACGAACTCGGCGGGACCATTT 3';
the sequence of the forward primer 1 of WSNP03 was: 5 'AACACATTCAGAGAATATGACTAGGG 3' of the formula I,
the sequence of the forward primer 2 of WSNP03 was 5 'ATAACACATTCAGAGAATATGACTAGGA 3',
the sequence of the reverse primer of WSNP03 was: 5 'GCCTGAGCGGGCGTTTGGTAA 3's;
the sequence of the forward primer 1 of WSNP04 is: 5 'CCTCCCTCCCGACCTCTG 3' of the formula I,
the sequence of the forward primer 2 of WSNP04 was: 5 'CCCTCCCTCCCGACCTCTA 3' of the reaction mixture,
the sequence of the reverse primer of WSNP04 was: 5 'CTAGTTGGGCCGAGGCAGTTGAA 3';
the sequence of the forward primer 1 of WSNP05 was: 5 'AGTTGAAAACACCGAACCAGCGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP05 was: 5 'GTTGAAAACACCGAACCAGCGG 3' of the formula I,
the sequence of the reverse primer of WSNP05 was: 5 'GGTGAGAGCAAGGATCCCAATCTAT 3';
the sequence of the forward primer 1 of WSNP06 is: 5 'CATGAGATCCTAAATCAGAGTCGCA 3' of the formula I,
the sequence of the forward primer 2 of WSNP06 was: 5 'ATGAGATCCTAAATCAGAGTCGCG 3' of the formula I,
the sequence of the reverse primer of WSNP06 was 5 'GGTCAAGTTTTCTGGACCCCATAATTATT 3';
the sequence of the forward primer 1 of WSNP07 was 5 'CGATTGAATCTCAAGCGAACAAACG 3',
the sequence of the forward primer 2 of WSNP07 was 5 'GCGATTGAATCTCAAGCGAACAAACA 3',
the sequence of the reverse primer of WSNP07 was: 5 'TGTAGACATCTAGCAACCCCCTGAA 3';
the sequence of the forward primer 1 of WSNP08 was: 5 'GGTAAGCTTTGCCTAGCTTTCCTAT 3' of the formula I,
the sequence of the forward primer 2 of WSNP08 was: 5 'GTAAGCTTTGCCTAGCTTTCCTAC 3' of the formula I,
the sequence of the reverse primer of WSNP08 was 5 'GTTTGTCCAACTAAGATAGAGTATGGGAA 3';
the sequence of the forward primer 1 of WSNP09 was: 5 'GTAAGGGACACACCTCCATCCAT 3' of the formula I,
the sequence of the forward primer 2 of WSNP09 was 5 'AAGGGACACACCTCCATCCAG 3',
the sequence of the reverse primer of WSNP09 was 5 'ATAGCTAGATTGTCATCTGGCCAAACAAA 3';
the sequence of the forward primer 1 of WSNP10 was: 5 'GATAACAGCGTTTTCCTGACGAGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP10 was: 5 'ATAACAGCGTTTTCCTGACGAGG 3' of the formula I,
the sequence of the reverse primer of WSNP10 was: 5 'CCATCCCCAACCATAGGACCGAT 3';
the sequence of the forward primer 1 of WSNP11 is: 5 'AGATTCCTGGAGCTGCGTTTGC 3' of the formula I,
the sequence of the forward primer 2 of WSNP11 was: 5 'AGATTCCTGGAGCTGCGTTTGG 3' of the reaction mixture,
the sequence of the reverse primer of WSNP11 was: 5 'AGTTGAATTTGGCGGACGTGAGGTT 3';
the sequence of the forward primer 1 of WSNP12 was: 5 'CACAGGGATACCGAAACATGGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP12 was: 5 'CACAGGGATACCGAAACATGGG 3' of the formula I,
the sequence of the reverse primer of WSNP12 was: 5 'TTGTTACCGATTTTGTTCTCTTTTGTCGTT 3';
the sequence of the forward primer 1 of WSNP13 was: 5 'GGAGATCTGCTAGAGACGCCT 3' of the formula I,
the sequence of the forward primer 2 of WSNP13 was: 5 'GGAGATCTGCTAGAGACGCCG 3' of the formula I,
the sequence of the reverse primer of WSNP13 was: 5 'GGATGCCATGCCATGAGTTAGTGTT 3';
the sequence of the forward primer 1 of WSNP14 is: 5 'GCGTTCGAATTAAGGAGAGAATCAG 3' of the formula I,
the sequence of the forward primer 2 of WSNP14 was: 5 'GGCGTTCGAATTAAGGAGAGAATCAA 3' of the formula I,
the sequence of the reverse primer of WSNP14 was: 5 'CAGTGTCGTAGGCTGGTCGCTT 3';
the sequence of the forward primer 1 of WSNP15 was: 5 'CAATCATATTGTTTTGGCGAGGAGC 3' of the formula I,
the sequence of the forward primer 2 of WSNP15 was: 5 'AACAATCATATTGTTTTGGCGAGGAGT 3' of the formula I,
the sequence of the reverse primer of WSNP15 was: 5 'CAGAGCTGAACCCCACTGGTGTA 3';
the sequence of the forward primer 1 of WSNP16 was: 5 'AGGCTGAGCAAGAGTTCTTCTG 3' of the formula I,
the sequence of the forward primer 2 of WSNP16 was: 5 'GTAGGCTGAGCAAGAGTTCTTCTA 3' of the formula I,
the sequence of the reverse primer of WSNP16 was: 5 'TATTCTTCTGCTCGACGTCGCACTT 3';
the sequence of the forward primer 1 of WSNP17 was: 5 'CCTTCCTCTCCGTGATCGTCAT 3' of the formula I,
the sequence of the forward primer 2 of WSNP17 was: 5 'CTTCCTCTCCGTGATCGTCAG 3' of the formula I,
the sequence of the reverse primer of WSNP17 was: 5 'GGTTTGCCGGCTAGACCACGTA 3';
the sequence of the forward primer 1 of WSNP18 was: 5 'GAACAAATTAGAGATGCTATTAAGTGGG 3' of the formula I,
the sequence of the forward primer 2 of WSNP18 was: 5 'GAACAAATTAGAGATGCTATTAAGTGGA 3' of the formula I,
the sequence of the reverse primer of WSNP18 was: 5 'CCAAGTTATCGTGGCGTACAAGACAT 3';
the sequence of the forward primer 1 of WSNP19 was: 5 'CATCTCTTCACGGTACATCAACTCAT 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP19 was: 5 'ATCTCTTCACGGTACATCAACTCAC 3' of the formula I,
the sequence of the reverse primer of WSNP19 is: 5 'GTGGCCATCCGACAGAAAAAGTATTAATT 3's;
the sequence of the forward primer 1 of WSNP20 was: 5 'ATGGGCCTGTTGAACTAGCCAC 3' of the formula I,
the sequence of the forward primer 2 of WSNP20 was: 5 'CATGGGCCTGTTGAACTAGCCAT 3' of the formula I,
the sequence of the reverse primer of WSNP20 is: 5 'GGAGTAAATCGCATAGAACCACCATAAAT 3's;
the sequence of the forward primer 1 of WSNP21 was: 5 'CGCACGGGACTCTGTCCACA 3' of the formula I,
the sequence of the forward primer 2 of WSNP21 was: 5 'GCACGGGACTCTGTCCACC 3' of the reaction mixture,
the sequence of the reverse primer of WSNP21 is: 5 'GGACTGTCTAGTTGTTGCAATCGCAT 3';
the sequence of the forward primer 1 of WSNP22 is: 5 'GCCAAAAGCCCAACACAGAGGA 3' of the formula I,
the sequence of the forward primer 2 of WSNP22 was: 5 'CCAAAAGCCCAACACAGAGGC 3' of the reaction mixture,
the sequence of the reverse primer of WSNP22 was: 5 'GCTTCAAGCTGTGGATCGCTATCTA 3';
the sequence of the forward primer 1 of WSNP23 is: 5 'CAGGGAAAGATCATTAACGTCAACC 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP23 was: 5 'GCAGGGAAAGATCATTAACGTCAACT 3' of the formula I,
the sequence of the reverse primer of WSNP23 was: 5 'GTCCCGACTTCGAATTAATGAAGCCAT 3's;
the sequence of the forward primer 1 of WSNP24 is: 5 'AGGGAATTCTTCTACTTTTCTAAACCG 3' of the reaction mixture,
the sequence of the forward primer 2 of WSNP24 was: 5 'TAGGGAATTCTTCTACTTTTCTAAACCA 3' of the formula I,
the sequence of the reverse primer of WSNP24 is: 5 'GTTCAGTGTTGGGTCCGTCTGTAAA 3'.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2020106498745 | 2020-07-08 | ||
| CN202010649874 | 2020-07-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111850158A CN111850158A (en) | 2020-10-30 |
| CN111850158B true CN111850158B (en) | 2022-09-27 |
Family
ID=72761905
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010815179.1A Active CN111778353B (en) | 2020-07-08 | 2020-08-14 | SNP molecular marker for identifying common wheat variety and SNP molecular marker detection method |
| CN202010815168.3A Active CN111850158B (en) | 2020-07-08 | 2020-08-14 | Specific SNP locus combination for purity identification of common wheat conventional variety and identification method |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010815179.1A Active CN111778353B (en) | 2020-07-08 | 2020-08-14 | SNP molecular marker for identifying common wheat variety and SNP molecular marker detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN111778353B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111778353B (en) * | 2020-07-08 | 2022-08-05 | 北京市农林科学院 | SNP molecular marker for identifying common wheat variety and SNP molecular marker detection method |
| CN113718052B (en) * | 2021-09-01 | 2023-11-17 | 北京市农林科学院 | Application of 5000 SNP locus combinations and method for identifying authenticity and identity of wheat variety |
| CN114107555B (en) * | 2022-01-25 | 2022-04-29 | 华智生物技术有限公司 | SNP molecular marker combination for detecting purity of wheat variety and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110872633A (en) * | 2019-11-27 | 2020-03-10 | 北京市农林科学院 | Method for identifying purity of Jingke 968 corn hybrid based on SNP marker |
| CN111850158A (en) * | 2020-07-08 | 2020-10-30 | 北京市农林科学院 | Specific SNP locus combination for purity identification of common wheat conventional variety and identification method |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002077277A2 (en) * | 2001-03-26 | 2002-10-03 | Council Of Scientific And Industrial Research | Dna markers for assessing seed purity and a method of using dna sequences for assessing seed purity |
| CN1296706C (en) * | 2004-04-30 | 2007-01-24 | 首都师范大学 | Capillary electrophoresis method for fast identification of wheat varieties |
| JP5800307B2 (en) * | 2009-04-17 | 2015-10-28 | 国立大学法人神戸大学 | Method and kit for identifying bovine samples |
| EP2781151A1 (en) * | 2013-03-18 | 2014-09-24 | Bayer CropScience AG | Methods of separating hybrid seed from a mixture of seeds |
| KR101766274B1 (en) * | 2015-06-11 | 2017-08-09 | 대한민국 | A method for identifying blueberry varieties using microsatellites markers |
| EP3978625A1 (en) * | 2016-05-12 | 2022-04-06 | Pioneer Hi-Bred International, Inc. | Methods for simultaneous pooled genotyping of plants |
| CN107034306B (en) * | 2017-06-20 | 2020-11-24 | 北京市种子管理站 | SNP locus genotyping primers and application thereof in wheat variety identification |
| CN109777881B (en) * | 2018-11-08 | 2022-04-08 | 北京市农林科学院 | SSR molecular marker detection method for purity of conventional wheat variety, primer combination and application thereof |
-
2020
- 2020-08-14 CN CN202010815179.1A patent/CN111778353B/en active Active
- 2020-08-14 CN CN202010815168.3A patent/CN111850158B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110872633A (en) * | 2019-11-27 | 2020-03-10 | 北京市农林科学院 | Method for identifying purity of Jingke 968 corn hybrid based on SNP marker |
| CN111850158A (en) * | 2020-07-08 | 2020-10-30 | 北京市农林科学院 | Specific SNP locus combination for purity identification of common wheat conventional variety and identification method |
Non-Patent Citations (1)
| Title |
|---|
| 基于SNP标记的小麦高通量身份鉴定模式;刘丽华等;《麦类作物学报》;20180508;第38卷(第5期);第529-534页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111850158A (en) | 2020-10-30 |
| CN111778353B (en) | 2022-08-05 |
| CN111778353A (en) | 2020-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111850158B (en) | Specific SNP locus combination for purity identification of common wheat conventional variety and identification method | |
| CN108998562B (en) | Grain length gene marker based on wheat 895 genetic background in wheat variety and application | |
| CN107760789B (en) | Genotyping detection kit for parent-child identification and individual identification of yaks | |
| CN109666756B (en) | Method for identifying authenticity of melon variety and special SNP primer combination thereof | |
| CN113969323B (en) | SNP molecular marker related to luffa melon length and application thereof | |
| CN111304356B (en) | Molecular marker primer combination for rapidly identifying sex traits of Chinese torreya in high throughput manner and application thereof | |
| CN111979350B (en) | Method for identifying authenticity of cucurbita pepo variety | |
| CN108103162B (en) | Core SNP marker for cabbage hybrid identification based on KASP technology development and application thereof | |
| CN115505648A (en) | Development and application of KASP molecular marker of drought-resistant gene of corn | |
| CN113249510B (en) | Method for identifying authenticity of lettuce hybrid and KASP primer combination used by method | |
| CN110846432A (en) | Codominant fluorescent molecular marker and detection method of brown planthopper resistant gene Bph3 | |
| EP3670657A1 (en) | Method for detecting variant of brassica oleracea plant | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| CN113755630A (en) | Mixed sample detection method for detecting carrot seed purity based on mSNP technology | |
| CN112195263A (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of watermelon hybrid and application | |
| CN115838820B (en) | SNP molecular marker for identification of germplasm resources of fructus aurantii and application thereof | |
| CN114058734B (en) | SNP molecular marker combination for detecting rape varieties and application thereof | |
| CN114395639B (en) | SNP molecular marker combination for identifying purity of rice strain and application thereof | |
| CN109536633A (en) | The SNP marker and application isolated with the anti-graywall main effect QTL-qRgls2 of corn | |
| CN117568520B (en) | SNP molecular marker primer set for identifying purity of Cauliflower hybrid of 'purple nepheline 65' and application thereof | |
| CN113584213B (en) | Hemp SSR molecular markers and application thereof | |
| CN110863039B (en) | Primer group, method and kit for detecting SLCO1B1 and APOE gene polymorphism based on shared primer probe | |
| CN114015797A (en) | Development and application of KASP molecular marker of purple corn leaf sheath gene | |
| KR101913627B1 (en) | Variant Tomato Discrimination composition | |
| CN118531153A (en) | QTL locus related to wheat grain SDS sedimentation value, KASP mark, primer group, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |