KR101913627B1 - Variant Tomato Discrimination composition - Google Patents

Abstract

The present invention relates to a composition for distinguishing a variant tomato. The composition for distinguishing a variant tomato comprises: a primer set of SEQ ID NO: 13 and 14; a primer set of SEQ ID NO: 17 and 18; a primer set of SEQ ID NO: 23 and 24; a primer set of SEQ ID NO: 37 and 38; a primer set of SEQ ID NO: 43 and 44; a primer set of SEQ ID NO: 49 and 50; and a primer set of SEQ ID NO: 67 and 68. A genetic variation in tomato testing varieties can be detected. Genetically distant cystic, cherry, and jujube varieties can be distinguished, and genetically close cherry and jujube varieties can also be distinguished. A tomato with a genetic variation and testing varieties can be distinguished. Genetic variations in most tomato testing varieties sold in the market can be distinguished. The composition can be used to distinguish between tomato varieties for the purpose of efficient protection of plant breeder rights. A genetic variation between tomato varieties can be inexpensively and quickly distinguished. Tomato varieties can be distinguished.

Description

[0001] The present invention relates to a variant Tomato Discrimination composition,

The present invention relates to a composition capable of discriminating variant tomatoes, and more specifically, it relates to a composition for distinguishing varieties of tomatoes, including a set of primers capable of complementarily binding with a certain portion of tomato genomic DNA, The present invention relates to a distinguishable composition.

Tomato ( Solanum lycopersicum L.) is a high value-added global vegetable crop with a global seed market amounting to about KRW 1 trillion, and its seed market has grown to 18.6 billion in 2012 due to increased consumption in Korea. The expansion of the domestic tomato market led to the activation of new varieties, and the importance of the right to protect varieties of intellectual property rights is emphasized. The screening of new varieties of tomatoes is carried out on 38 traits which are expressed in leaves, flowers, fruit, etc. However, this morphological characterization is time consuming and costly, and in some cases it is difficult to evaluate accurately. To overcome this problem, there is a method of evaluating with a DNA marker.

DNA marker is a specific nucleotide sequence that can judge polymorphism on the genome of a species. It is used in genetic mapping, gene discovery and trait marker generation, genetic diversity analysis, and purity assay in the field of plant genetic breeding . The method of distinguishing the varieties by DNA markers is advantageous in that they are quick and accurate because they are not influenced by the cultivation environment and the growth stage of the crop compared to the method based on the trait characterization.

Since the first genetic map of tomatoes was reported in 1992, a number of markers have been developed, but the developed markers are not suitable for exploring genetic variation in a wide range of commercial tomatoes.

Thus, there is a strong need for the development of markers for DNA that can be easily searched for genetic variation with high accuracy in a wide range of commercial tomato varieties.

Korean Patent No. 10-1301863

It is an object of the present invention to provide a primer set which can confirm the polymorphism of tomato varieties.

The object of the present invention is to provide a primer set, a composition and a kit for discriminating a variety which can be used for screening a new variety.

It is an object of the present invention to provide a primer set, a composition and a kit capable of detecting genetic mutations occurring in tomato varieties.

The present invention provides a primer set, a composition and a kit which can distinguish not only genetically distant foliage varieties and small fern varieties (drop and jujube) varieties, but also genetically close varieties and jujube varieties The purpose.

It is an object of the present invention to provide a primer set, a composition and a kit which can distinguish genetically mutated tomatoes and cultivars with excellent accuracy.

It is an object of the present invention to provide a primer set, a composition and a kit which can distinguish genetic mutations occurring in most commercially available tomato varieties.

It is an object of the present invention to provide a primer set, a composition and a kit which can be used for sorting tomato varieties for the purpose of efficient protection of breeder's rights.

It is an object of the present invention to provide a primer set, a composition and a kit which can discriminate the occurrence of genetic mutation between tomato varieties inexpensively and promptly, and can distinguish tomato varieties.

1. A primer set of SEQ ID NOs: 13 and 14; A primer set of SEQ ID NOS: 17 and 18; A primer set of SEQ ID NOS: 23 and 24; A primer set of SEQ ID NOS: 37 and 38; A primer set of SEQ ID NOS: 43 and 44; A primer set of SEQ ID NOS: 49 and 50; And a primer set of SEQ ID NOS: 67 and 68.

2. The primer set of SEQ ID NOs: 15 and 16, A primer set of SEQ ID NOS: 51 and 52; A primer set of SEQ ID NOS: 53 and 54; A primer set of SEQ ID NOS: 57 and 58; And at least one primer set selected from the group consisting of primers set forth in SEQ ID NOs: 75 and 76.

3. The primer set according to any one of items 1 to 2 above, wherein the primer set of SEQ ID NOs: 1 and 2; A primer set of SEQ ID NOS: 3 and 4; A primer set of SEQ ID NOS: 5 and 6; A primer set of SEQ ID NOS: 7 and 8; A primer set of SEQ ID NOS: 9 and 10; A primer set of SEQ ID NOS: 11 and 12; A primer set of SEQ ID NOS: 19 and 20; A primer set of SEQ ID NOS: 21 and 22; A primer set of SEQ ID NOS: 25 and 26; A primer set of SEQ ID NOs: 27 and 28; A primer set of SEQ ID NOs: 29 and 30; A primer set of SEQ ID NOS: 31 and 32; A primer set of SEQ ID NOS: 33 and 34; A primer set of SEQ ID NOS: 35 and 36; A primer set of SEQ ID NOS: 39 and 40; A primer set of SEQ ID NOS: 41 and 42; A primer set of SEQ ID NOs: 45 and 46; A primer set of SEQ ID NOS: 47 and 48; A primer set of SEQ ID NOS: 55 and 56; A primer set of SEQ ID NOS: 59 and 60; A primer set of SEQ ID NOs: 61 and 62; A primer set of SEQ ID NOS: 63 and 64; A primer set of SEQ ID NOs: 65 and 66; A primer set of SEQ ID NOS: 69 and 70; A primer set of SEQ ID NOS: 71 and 72; A primer set of SEQ ID NOS: 73 and 74; A primer set of SEQ ID NOS: 77 and 78; A primer set of SEQ ID NOS: 79 and 80; And at least one primer set selected from the group consisting of primers set forth in SEQ ID NOS: 81 and 82.

4. The composition according to above 1, wherein the primers of SEQ ID NOS: 1 to 82 are used.

5. A kit for discriminating tomato varieties comprising any one of compositions 1 to 4 above.

6. A method for discriminating tomato varieties comprising amplifying tomato genomic DNA with any one of compositions 1 to 4 above.

According to one embodiment of the invention, primer sets, compositions and kits are capable of detecting genetic variations occurring in tomato varieties.

According to one embodiment of the present invention, primer sets, compositions and kits are capable of discriminating between genetically distant foliage species and bovine species, as well as between genetically bell-like varieties and jujube varieties.

According to one embodiment of the present invention, primer sets, compositions and kits are capable of distinguishing between genetically mutated tomatoes and cultivars with excellent accuracy.

According to one embodiment of the present invention, primer sets, compositions and kits can distinguish genetic variations occurring in commercial tomato varieties sold on the market.

According to one embodiment of the present invention, primer sets, compositions and kits can be used for the isolation of tomato varieties for the purpose of efficient protection of breeding rights.

According to one embodiment of the present invention, primer sets, compositions and kits can inexpensively and quickly determine the occurrence of genetic mutations between tomato varieties, and can distinguish tomato varieties.

, 대목용 품종 (Rootstock)은

로 나타냈다.
도 3는 NTSYSpcv2.02에서 구현한 UPGMA (unweighted pair group mean algorithm)을 사용하여 62종의 F1 토마토 공시품종의 유전적 관계에 대한 dendrograms을 나타낸 것이다. UPGMA 분석은 본 발명에 따른 마커인 6 개의 SSR과 35 개의 InDel 마커를 포함한 41개의 마커를 사용하여 수행하였다. 도면의 오른쪽에 있는 숫자 (1 내지 62)는 표 1의 No 하위 목록에 기재되어 있는 숫자를 의미한다. 도면의 아래쪽의 눈금은 Jaccard의 유사도 계수를 나타낸다.
도 4는 10개의 염색체에 위치하는 12개의 InDel 마커를 사용하여 62개의 상업용 토마토 재배 품종에 대한 UPGMA dendrogram을 도시한 것이다.
도 5는 7개의 염색체에 위치하는 7개의 InDel 마커를 사용하여 62개의 상업용 토마토 재배 품종에 대한 UPGMA dendrogram을 도시한 것이다.FIG. 1 shows the results of encoding the presence or absence of alleles identified using the primer set according to the present invention in 61 F1 tomato cultivars.
FIG. 2 shows results of PCA (Principal Component Analysis) analysis based on the markers according to the present invention for 62 F1 tomato cultivars. The PCA results are visualized by plotting scores representing 49.57% and 12.11% for the first two components, PC1 and PC2, respectively. The fresh market is ▲, the jujube (Grape) is ■, the berry type (Cherry) is

, Rootstock varieties (Rootstock)

Respectively.
FIG. 3 shows dendrograms of genetic relationships of 62 species of F1 tomato varieties using UPGMA (unweighted pair group mean algorithm) implemented in NTSYSpcv2.02. UPGMA analysis was performed using 41 markers including 6 SSRs and 35 InDel markers, which are markers according to the present invention. The numbers (1 to 62) on the right side of the figure mean the numbers listed in the No sub-list of Table 1. [ The scale at the bottom of the figure shows the similarity coefficient of Jaccard.
Figure 4 shows a UPGMA dendrogram for 62 commercially available tomato cultivars using 12 InDel markers located on 10 chromosomes.
Figure 5 shows UPGMA dendrograms for 62 commercially available tomato cultivars using 7 InDel markers located on 7 chromosomes.

The present invention relates to a composition for discriminating variant tomatoes, comprising a primer set of SEQ ID NOS: 13 and 14; A primer set of SEQ ID NOS: 17 and 18; A primer set of SEQ ID NOS: 23 and 24; A primer set of SEQ ID NOS: 37 and 38; A primer set of SEQ ID NOS: 43 and 44; A primer set of SEQ ID NOS: 49 and 50; And SEQ ID NOS: 67 and 68, it is possible to detect the genetic mutation occurring in the tomato varieties and to distinguish genetically distant females from bovine species, as well as to distinguish genetically distant varieties Can identify the genetic variants of the jujube cultivars, distinguish genetically mutated tomatoes from published varieties with excellent accuracy, distinguish genetic variations in most commercially available tomato varieties sold, The present invention relates to a composition for discriminating tomato varieties which can be used for distinguishing tomato varieties for the purpose of efficient protection of rights, can discriminate occurrence of genetic mutation between tomato varieties inexpensively and quickly, and can distinguish tomato varieties.

Hereinafter, the present invention will be described in detail.

A " primer " refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be amplified, i.e., a template strand, and may serve as a synthetic start point for cloning template strands. The length and sequence of the primer should allow the template strand to begin replication. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In the present specification, "primer of SEQ ID NO: x to y" is used in the same sense as "primer consisting of polynucleotide of SEQ ID NO: x to y". Here, x and y are each independently an integer of 1 to 20.

&Quot; Polynucleotide " means a polymer in which several or more deoxyribonucleotides or ribonucleotides are polymerized in the form of a single strand or a double strand, and unless otherwise specified, an analog of a natural polynucleotide Phosphorothioates, alkylphosphorothioates or peptide nucleic acids), intercalators, and the like. &Quot; Polynucleotide " has the same meaning as " base sequence ".

The sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient if the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer set provided in the present invention does not need to have a perfectly complementary sequence to the nucleotide sequence of the tomato variant discrimination marker, and it is sufficient that the complementary set within the range capable of hybridizing to the primer function in this sequence is sufficient.

The term " complementary " when used in reference to a nucleic acid means a nucleic acid having a polarity in one direction containing a polynucleotide sequence in which the bases bind to bases of a polynucleotide of another nucleic acid of opposite polarity . For example, a nucleic acid having a sequence GCAT in the 5 'to 3' direction is complementary to a nucleic acid having a sequence CGTA in the 3 'to 5' direction. As used herein, the term complementary is used to include substantially complementary nucleic acids. Substantially complementary means that not all nucleotides are paired with the nucleotides of another nucleic acid, but nevertheless both nucleic acids have a sequence capable of forming a stable hybrid under certain conditions.

The present invention relates to a primer set of SEQ ID NOs: 13 and 14; A primer set of SEQ ID NOS: 17 and 18; A primer set of SEQ ID NOS: 23 and 24; A primer set of SEQ ID NOS: 37 and 38; A primer set of SEQ ID NOS: 43 and 44; A primer set of SEQ ID NOS: 49 and 50; And a primer set of SEQ ID NOS: 67 and 68. The present invention also provides a composition for identifying a variant tomato.

Variant tomatoes are tomatoes that have natural or artificially generated genetic mutations in the 62 disclosed tomato varieties of the present invention.

The primer set is a primer capable of complementarily binding to sli2887, sli2792, sli2495, sli2311, sli583, sli608 or sli1920 among the Indel markers of the tomato according to the present invention. By determining whether these markers are amplified, Can be distinguished.

When the composition of the present invention is used, the discrimination of the presence or absence of the tomato variant can be carried out inexpensively and promptly, and the genetic variation occurring in the disclosed tomato variety can be discriminated. In addition, the discrimination kit of the present invention can distinguish between tomato varieties.

According to one embodiment of the present invention, the composition of the present invention not only distinguishes the species that are genetically distant from the major species, but also distinguishes the berry type and the jujube type genetically close to each other. useful.

The composition of the present invention comprises a primer set of SEQ ID NOs: 13 and 14; A primer set of SEQ ID NOS: 17 and 18; A primer set of SEQ ID NOS: 23 and 24; A primer set of SEQ ID NOS: 37 and 38; A primer set of SEQ ID NOS: 43 and 44; A primer set of SEQ ID NOS: 49 and 50; And the primer set of SEQ ID NOS: 67 and 68, the discrimination of tomato varieties or the division of varieties of tomatoes can be performed with excellent accuracy.

However, in the case of using only the above-mentioned seven primer sets, for example, in the case of clinical use in which a large number of tomato varieties are discriminated over a long period of time, unexpected new tomato varieties appear, It is not possible to completely exclude the possibility that a false negative reaction may occur in only by

The possibility of the false negative reaction can be complemented by an additional primer set according to the present invention, so that it is possible to more accurately discriminate between the cultivars or whether or not the varieties are different from the known varieties.

According to one embodiment of the present invention, the composition of the present invention comprises a primer set of SEQ ID NOs: 15 and 16; A primer set of SEQ ID NOS: 51 and 52; A primer set of SEQ ID NOS: 53 and 54; A primer set of SEQ ID NOS: 57 and 58; And a primer set of SEQ ID NOs: 75 and 76. The primer set of SEQ ID NOs: 75 and 76 may further comprise at least one primer set.

A primer set according to an embodiment of the present invention is a primer capable of complementarily binding with indel markers SL10126i, sli2792, sli1019, sli1285, sli3013 or sli1962 capable of discriminating a variant tomato according to the present invention (see Table 3) ), sli2887, sli2792, sli2495, sli2311, sli583, sli608 and sli1920 in addition to confirming whether these markers are further amplified.

According to one embodiment of the present invention, the discriminating kit of the present invention comprises the primer set of SEQ ID NOS: 1 and 2; A primer set of SEQ ID NOS: 3 and 4; A primer set of SEQ ID NOS: 5 and 6; A primer set of SEQ ID NOS: 7 and 8; A primer set of SEQ ID NOS: 9 and 10; A primer set of SEQ ID NOS: 11 and 12; A primer set of SEQ ID NOS: 19 and 20; A primer set of SEQ ID NOS: 21 and 22; A primer set of SEQ ID NOS: 25 and 26; A primer set of SEQ ID NOs: 27 and 28; A primer set of SEQ ID NOs: 29 and 30; A primer set of SEQ ID NOS: 31 and 32; A primer set of SEQ ID NOS: 33 and 34; A primer set of SEQ ID NOS: 35 and 36; A primer set of SEQ ID NOS: 39 and 40; A primer set of SEQ ID NOS: 41 and 42; A primer set of SEQ ID NOs: 45 and 46; A primer set of SEQ ID NOS: 47 and 48; A primer set of SEQ ID NOS: 55 and 56; A primer set of SEQ ID NOS: 59 and 60; A primer set of SEQ ID NOs: 61 and 62; A primer set of SEQ ID NOS: 63 and 64; A primer set of SEQ ID NOs: 65 and 66; A primer set of SEQ ID NOS: 69 and 70; A primer set of SEQ ID NOS: 71 and 72; A primer set of SEQ ID NOS: 73 and 74; A primer set of SEQ ID NOS: 77 and 78; A primer set of SEQ ID NOS: 79 and 80; And a primer set of SEQ ID NOs: 81 and 82. In this case, even if there arises a problem in discrimination or discrimination by the other primer set, it can be supplemented, and a high accuracy To identify variant tomatoes, and to distinguish varieties of tomatoes.

A primer set according to an embodiment of the present invention is a primer capable of complementarily binding SSR or Indel markers capable of discriminating a variant tomato according to the present invention (see Table 3) It is possible to more accurately determine the presence or absence of the variant tomato.

According to a specific embodiment of the present invention, the kit for variant tomato discrimination of the present invention comprises a primer of SEQ ID NOS: 1 to 82 capable of complementarily binding with an SSR or Indel marker capable of discriminating a variant tomato according to the present invention .

Amplification of the genetic markers by the composition of the present invention is carried out with two or more sets of primers contained in the composition of the present invention and the amplification may be performed independently by each set of primers or simultaneously with two or more sets of primers, , And when two or more primer sets are used together in one amplification reaction when they are carried out at the same time.

The composition of the present invention can be used in a variety of fields such as polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Amplification (strand displacement amplification) or amplification through Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art.

The composition of the present invention may include all of the substances further included in the following kit.

In another aspect, the present invention provides a kit for discriminating tomato varieties comprising the composition of the present invention.

The kit of the present invention may include all the substances included in the composition of the present invention described above.

In addition, the discriminating kit of the present invention may be a kit including essential elements necessary for performing the microarray. The microarray kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and may also include a cDNA corresponding to a quantitative control gene or a fragment thereof.

According to one embodiment of the present invention, the discriminating kit of the present invention further comprises a binding agent such as reverse transcriptase, a polymerase, a reaction buffer, a polymerase, dNTP (dATP, dCTP, dGTP and dTTP), Mg ^{2 +} . As the reaction buffer, a conventional buffer solution containing components such as Tris-HCl, KCl, (NH ₄ ) ₂ SO ₄ , MgCl ₂ and the like can be suitably modified and used. The reverse transcriptase, the polymerase, and the buffer may be contained in separate containers. A mixture of the reverse transcriptase and the polymerase may be contained in one container, the buffer may be contained in a separate container, and the reverse transcriptase, They may all be mixed and contained in one container.

According to one embodiment of the present invention, the discriminating kit of the present invention can be used for general polymerase chain reaction or real-time PCR.

The result of the polymerase chain reaction can be separated by agarose gel electrophoresis or capillary electrophoresis, and DNA having a length corresponding to the DNA polymerized by the primer set used , And it is possible to distinguish the varieties of tomato varieties and the varieties of varieties.

When the discriminating kit of the present invention is used in a real-time PCR, a probe may be additionally used in addition to the primer set according to the present invention. Preferably, the probes are designed to be suitable for use with each primer set. For example, each probe preferably comprises a sequence corresponding to a portion of the DNA fragment amplified by the primer set to be used with the probe. Each of the probes may have a fluorescent substance bound to the 5 'end and a quencher to the 3' end.

According to a more specific embodiment, a fluorescent material that emits a specific wavelength such as red, green, and blue is bound to the 5'-end of each probe, and a black hole quencher (BHQ) is bonded to the 3'- have. In the state where the fluorescent substance and the quencher are bonded to the probe, the quencher absorbs the light emitted by the fluorescent substance, so that the fluorescent signal is not detected. On the other hand, fluorescence signals can be detected when a probe having a fluorescent substance bound to a quencher is separated by a DNA polymerase in DNA synthesis and elongation. During the course of the polymerase chain reaction, the fluorescence signal can be measured in real time, and the presence or absence of the virus can be determined based on the increased fluorescence signal. The use of such probes can be useful for real-time PCR reactions.

The identification kit of the present invention may be prepared by separately preparing a reaction mixture and a reverse reaction and a polymerase chain reaction separately. One reaction mixture may be prepared and subjected to one-step reverse transcription polymerase chain reaction (one- step RT-PCR).

The discriminating kit of the present invention may include an internal control. In the case where the marker according to the present invention is not present in the sample, gene amplification does not occur. In order to distinguish the case where the gene amplification does not occur due to a problem in this case and the polymerase chain reaction itself, A primer set that specifically amplifies the gene and an internal control containing the foreign gene DNA can be used. The amplification of the internal control can be used to confirm the effectiveness of the polymerase chain reaction.

The identification kit of the present invention is not limited to a particular form, but may be embodied in various forms. According to one embodiment, the discriminating kit may comprise a lyophilized primer contained in a container (e.g., a disposable PCR tube, etc.). In the case of containing two or more primer sets, a plurality of primer sets may be mixed and contained in a PCR tube, and each primer set may be individually contained in each PCR tube. For example, in the case of a discriminating kit including a plurality of primer sets, a disposable PCR tube in which one primer set is contained in the form of a lyophilized powder, and a disposable PCR tube in which a primer set different from the primer set is contained in a lyophilized powder form PCR tubes may be included in the discrimination kit. Also, a disposable PCR tube in which several primer sets are mixed and contained in the form of a lyophilized powder may be included in the discriminating kit.

Also, according to one embodiment of the present invention, the discriminating kit may include a reverse transcriptase, a polymerase, a buffer, and the like. The reverse transcriptase, the polymerase, and the buffer may be contained in separate containers. A mixture of the reverse transcriptase and the polymerase may be contained in one container, the buffer may be contained in a separate container, and the reverse transcriptase, They may all be mixed and contained in one container.

According to another embodiment, a reaction kit comprising the above primers, reverse transcriptase, a polymerase and a buffer may be contained in a container (for example, a disposable PCR tube) in the form of a liquid in the discriminating kit of the present invention. It can be stored frozen and thawed if necessary. In the case of such a discriminating kit, since a separate mixing process is not required except for adding a sample at the time of discrimination, the convenience of discrimination and quickness can be increased.

In another aspect, the present invention provides a method of identifying a variant tomato, comprising amplifying a target sequence into at least one of a primer set according to the present invention that binds complementarily to genomic DNA extracted from tomato.

Tomato genomic DNA can be obtained by a method commonly used in the art such as phenol / chloroform extraction method and SDS extraction method, and can be obtained by a commercially available DNA extraction kit.

In addition, the method for obtaining the tomato genome DNA may be to separately obtain a cDNA by carrying out reverse transcription reaction through the action of reverse transcriptase from the RNA genome of tomato. Extraction of RNA for obtaining tomato cDNA can be performed using various methods known to those skilled in the art. The extracted RNA can be stored at minus 70 ° C.

According to one embodiment of the present invention, genomic DNA extracted from tomatoes may be derived from at least one selected from the group consisting of leaves, stem, root, seed and fruit of tomato.

The method of the present invention may further comprise detecting the product by said amplification. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto.

The amplification product may be labeled with a detectable labeling substance. For example, the amplification product may be a fluorescent, phosphorescent, or radioactive substance, but is not limited thereto. Preferably, the labeling substance may be Cy-5 or Cy-3. When PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer upon amplification, the amplified product can be detected by fluorescence microscope. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and radioactivity may be incorporated and the amplification product may be labeled as radioactive.

The method of the present invention comprises six SSR markers (TG7-18, TG9-11, TOM196, TOM144, TG12-5, TG12-13) and 35 InDel markers (sli2887, SL10126i , sli2792, LEOH174, SL10279i, sli2495, sli2569, sli2645, SL10480i, SL10689i, sli2215, sli2238, sli2311, SL10888, sli555, sli583, SL10151i, SL10373i, sli608, sli1019, sli1285, sli1275, sli3013, sli1847, sli1864, , sli1920, sli3018, sli1809, SL10737i, sli1962, sli2009, sli2112, and LEOH301) can be identified by the amplification of all or a part thereof, and the varieties of the disclosed varieties can be identified.

Hereinafter, the present invention will be described in more detail with reference to the following examples. The following examples are of course not intended to limit the scope of the invention.

Example

1. Published varieties

Sixteen seeds of F1 varieties were collected from 16 seed companies including Nongwoo Bio, Korea-gon, Monsanto Korea, and Syngenta Korea for DNA profiling of tomato varieties filed and distributed in Korea (Table 1).

2. Genotype analysis

The DNA of the cultivars was isolated using the CTAB method and the concentration was adjusted to 20 ng / μl for PCR analysis. Genotype analysis was performed by considering the polymorphism information content (PIC), chromosomal location, and allele size of SSR and InDel markers reported in tomato. The polymorphism of these markers was investigated using eight varieties, including 'Minichal', which shows a large difference in morphology (Table 1). The PCR reaction consisted of 40 ng DNA, 0.1 μM SSR primer, 0.2 mM dNTP, 1 unit of Taq polymerase, 2 μl of 10x buffer (20 mM Tric-HCl, 1 mM dithiothreitol, 0.1 mM EDTA, 100 mM NaCl, glycerol, pH 7.5) (GenesLabs, Korea) was added sterilized distilled water to adjust the total reaction volume to 20 μl. PCR was carried out using Veriti Thermal Cycler (Applied Biosystems, USA), pre-denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, extension at 72 ° C for 45 seconds, -extension was carried out at 72 캜 for 10 minutes. The total number of cycles is 40. The PCR amplification products of the molecular markers were electrophoresed on 2-3% agarose gels and the differences of each alleles were analyzed. InDel markers showing polymorphism in 8 varieties were used to investigate the genotypes of the remaining 54 varieties.

The relationship between cultivars was analyzed using NTSYSpc v2.2 (Exter software, USA) program. The genetic distances between the cultivars were calculated according to the Jaccrad coefficient method and the dendrograms were prepared using UPGMA (Unweighted Pair-Group Method using Arithmetic Average).

3. Development of markers for discrimination of new varieties

To develop a new marker for the identification of tomato varieties, 242 tomato SSR markers were selected based on the PIC value and the number of alleles from 2,687 tomato SSR markers retrieved from the SGN database (DB). 76 of the 2,272 tomato InDels were selected considering the PIC value, chromosomal location and allele size. Eight varieties of varieties (Table 2) were selected from the varieties.

number kind Fruit size Fruit color Oversize One Minichal Cattle species Red Jujube type 2 Pink top Major species pink High sphere 3 Tenten Cattle species Red circle 4 B blocking Heavy and species Red circle 5 Gold Sugar Cattle species Orange Jujube type 6 Rokusanmaru Major species Red Required type 7 Madison Major species Red High sphere 8 Blackrich Cattle species Brown circle

Six SSR markers (TG7-18, TG9-11, TOM196, TOM144, TG12-5, TG12-13) and 35 InDel markers (sli2887, , SL10126i, sli2792, LEOH174, SL10279i, sli2495, sli2569, sli2645, SL10480i, SL10689i, sli2215, sli2238, sli2311, SL10888, sli555, sli583, SL10151i, SL10373i, sli608, sli1019, sli1285, sli1275, sli3013, sli1847, sli1864, sli1817 , sli1820, sli1920, sli3018, sli1809, SL10737i, sli1962, sli2009, sli2112 and LEOH301) were selected.

Table 3 below shows the PIC values of 41 markers (6 SSR markers and 35 InDel markers) for the analysis of 62 F1 tomato varieties and the primer sequences to detect them.

In 62 tomato varieties, the PIC values of 41 markers ranged from 0.243 to 0.375, with an average of 0.350. The PIC values of the six SSR markers ranged from 0.301 (TG12-13) to 0.374 (TOM196), with an average of 0.355. The SSR markers were distributed on chromosomes (Chr) 7 (TG7-18), 9 (TG9-11), 11 (TOM196 and TOM144) and 12 (TG12-5 and TG12-13). The PIC values of 35 InDel markers ranged from 0.243 (sli1817) to 0.375 (SL10279i, sli2311, sli583, sli1285 and sli3013), and the average of the InDel markers was 0.349, Were distributed on chromosomes.

Marker name Marker
Kinds chr Physical map position
(Mbp) Tm (占 폚) PIC value Primer sequence
(5 '- >3') TG7-18 SSR 7 60.9 55.0 0.368 SEQ ID NO: 1
F: GTTTCCCCAAATTAAAGCAAAAA
SEQ ID NO: 2
R: CAAACAACATGAGAAGCAGCA TG9-11 SSR 9 0.7 55.0 0.368 SEQ ID NO: 3
F: GGACCAAGCGAAGTTGGATA
SEQ ID NO: 4
R: CGAGTGTTTCGCTTCTCCTC TOM196 SSR 11 5.9 51.3 0.374 SEQ ID NO: 5
F: CCTCCAAATCCCAAAACTCT
SEQ ID NO: 6
R: TGTTTCATCCACTATCACGA TOM144 SSR 11 14.5 51.3 0.366 SEQ ID NO: 7
F: CTGTTTACTTCAAGAAGGCTG
SEQ ID NO: 8
R: ACTTTAACTTTATTATTGCGACG TG12-5 SSR 12 1.5 55.0 0.353 SEQ ID NO: 9
F: GAAACAACAAGTGCTGCATGG
SEQ ID NO: 10
R: CTTTTCCATTTATCCCGTAAAA TG12-13 SSR 12 1.8 55.0 0.301 SEQ ID NO: 11
F: GAAAGAGGTAAAATCGCGGGT
SEQ ID NO: 12
R: CCTTTACGATTTCGCCTACG sli2887 InDel One 83.8 55.0 0.362 SEQ ID NO: 13
F: AAGTGGCATGGGGACAGTAG
SEQ ID NO: 14
R: ATTCTCTGAAGACCCAGCCA SL10126i InDel One 97.1 55.4 0.374 SEQ ID NO: 15
F: ATGACTGAGCATCTGCGTTC
SEQ ID NO: 16
R: GCCGCCACTTATTGTAGGAT sli2792 InDel 2 53.6 51.9 0.371 SEQ ID NO: 17
F: TGGTCTGAGGGTCAACTAATGA
SEQ ID NO: 18
R: GGTTGAGCCGAAATTTTCAA LEOH174 InDel 2 52.6 55.0 0.366 SEQ ID NO: 19
F: CGAGTCCGAGGAAGACTGAT
SEQ ID NO: 20
R: TCAAGACAGACACGGATTGC SL10279i InDel 2 43.9 55.0 0.375 SEQ ID NO: 21
F: TGATGCCGCAATTACTTTTAG
SEQ ID NO: 22
R: GAAAGCCAAACCAGGATTTTC sli2495 InDel 3 12.4 55.0 0.278 SEQ ID NO: 23
F: ACTTGCTAGACCAAGGGGGT
SEQ ID NO: 24
R: TCTCCATGCAAGTTGGTCTG sli2569 InDel 3 41.3 53.4 0.281 SEQ ID NO: 25
F: CACTGAACTCGCATTCTTTTCA
SEQ ID NO: 26
R: ATTGGCAGTTTCTTCATGCC sli2645 InDel 3 64.4 55.4 0.262 SEQ ID NO: 27
F: GGGTCTCTTTGGTTTTAAGACTTC
SEQ ID NO: 28
R: CAAATAGATGAAAGGGGCCA SL10480i InDel 3 60.5 55.0 0.342 SEQ ID NO: 29
F: TCGCATCAATTGCAACACAC
SEQ ID NO: 30
R: AAACGCAAGGTGATCAGTCC SL10689i InDel 3 60.6 55.0 0.343 SEQ ID NO: 31
F: AGCCCAATACCCTCTCACAC
SEQ ID NO: 32
R: ACCAAACCTCGGTGTTCTTC sli2215 InDel 4 7.2 55.0 0.374 SEQ ID NO: 33
F: ACACCTTTCGAAATCGGTTG
SEQ ID NO: 34
R: GGGGATATACATTGGAGCACA sli2238 InDel 4 2.9 55.9 0.366 SEQ ID NO: 35
F: CGTTGTACAGAATCACTCATCACA
SEQ ID NO: 36
R: GGGATGAATTCCGACCAAAT sli2311 InDel 4 36.1 55.0 0.375 SEQ ID NO: 37
F: AACACCAGATGAACCGAAGC
SEQ ID NO: 38
R: GCCATAAAAGTCAAATGCCG SL10888 InDel 4 6.6 55.0 0.359 SEQ ID NO: 39
F: AAGCCTCCTTTACCAATCAGC
SEQ ID NO: 40
R: GCCATGAAAGTGAACTGAAGC sli555 InDel 5 53.1 53.4 0.363 SEQ ID NO: 41
F: TAGGTCAACCTACGCCTGCT
SEQ ID NO: 42
R: AGGACCCTTCCATTTTAGCC sli583 InDel 5 6.1 53.4 0.375 SEQ ID NO: 43
F: TTCTGCAACGTGTCTTCCTG
SEQ ID NO: 44
R: GGAAACATTCACTCAGCCAAA SL10151i InDel 5 8.4 55.0 0.366 SEQ ID NO: 45
F: GCTACAGGCAGACAGCATAGAC
SEQ ID NO: 46
R: CTGCATTCCCTTGTGTTTT SL10373i InDel 5 5.2 55.0 0.366 SEQ ID NO: 47
F: CCGGAAAGCATTGTTGTAGC
SEQ ID NO: 48
R: ACAGTTGAAATTGCCTGAGC sli608 InDel 6 1.7 55.0 0.349 SEQ ID NO: 49
F: TGGGTCACATTCTCCAACAA
SEQ ID NO: 50
R: ATGCAGATTGAGTTGCGTGA sli1019 InDel 7 65.2 55.0 0.267 SEQ ID NO: 51
F: GTATCGCGTAATTTGCCGTT
SEQ ID NO: 52
R: TCTGAAAGCAACCATTTCCC sli1285 InDel 9 2.4 55.0 0.375 SEQ ID NO: 53
F: CGTTGGTTGAGGAAATGGTT
SEQ ID NO: 54
R: GCAGCTGAATAACATGCACAG sli1275 InDel 9 4.1 55.0 0.362 SEQ ID NO: 55
F: ACATTCAAGGTGCATTTCGT
SEQ ID NO: 56
R: GCGCCATTGCCAAGATATTA sli3013 InDel 11 5.4 55.0 0.375 SEQ ID NO: 57
F: TCAAACGAAGATAGGAGTAAGAT
SEQ ID NO: 58
R: TGGAACATTGAAGAACAGGT sli1847 InDel 11 43.6 55.0 0.372 SEQ ID NO: 59
F: GGGCTTGGTTCTCTTGATGA
SEQ ID NO: 60
R: GATGGCACATTTCCTTGGAT sli1864 InDel 11 38.3 55.0 0.351 SEQ ID NO: 61
F: AGGAAGTGTTGAAAGCCCCT
SEQ ID NO: 62
R: CAGATGCAACACACACACTCA sli1817 InDel 11 11.2 55.0 0.243 SEQ ID NO: 63
F: CCATTCGTTGACCTTCCAAC
SEQ ID NO: 64
R: TGGGCGAGTTAATGGGTCTA sli1820 InDel 11 12.9 55.0 0.367 SEQ ID NO: 65
F: CAACCGTCCTCTCGAACATT
SEQ ID NO: 66
R: TGCAACCCTTGACTTGAGAA sli1920 InDel 11 55.1 55.0 0.345 SEQ ID NO: 67
F: AAGAAGGTCCTTGAGGAGGG
SEQ ID NO: 68
R: CCTAGTGGCCTTCTGCTTGA sli3018 InDel 11 5.5 55.0 0.374 SEQ ID NO: 69
F: CTGCAAAATTTCAACCAACCA
SEQ ID NO: 70
R: TCCGAGTAGAGGGCAATGATAAGT sli1809 InDel 11 8.6 55.0 0.354 SEQ ID NO: 71
F: CGGCAAAAGCATCAATATCC
SEQ ID NO: 72
R: TGAAGCATATAGCCCTTCCG SL10737i InDel 11 50.4 57.5 0.360 SEQ ID NO: 73
F: CCACTCCTGGGACTCAAATC
SEQ ID NO: 74
R: TGGACCCACAGGTAATGAGG sli1962 InDel 12 7.2 55.0 0.369 SEQ ID NO: 75
F: GAAGCAGATGATGTTTTGGCT
SEQ ID NO: 76
R: AGCCTTCTGCGCTTTATTCA sli2009 InDel 12 27.4 55.0 0.368 SEQ ID NO: 77
F: TCTTTAGCGCCTCAATCGTT
SEQ ID NO: 78
R: GAATGGGTTGCAAGGGTAGA sli2112 InDel 12 17.8 55.0 0.364 SEQ ID NO: 79
F: GAAGAACAAGGCAACCTCCA
SEQ ID NO: 80
R: ACCTACGCTTCAAGCACGTT LEOH301 InDel 12 63.6 53.1 0.337 SEQ ID NO: 81
F: TGCTGTTTTGTTTGGCTCAC
SEQ ID NO: 82
R: TGTTCATATCTTTGATGGCATGT

In 62 tomato varieties, the PIC values of 41 markers ranged from 0.243 to 0.375, with an average of 0.350. The PIC values of the six SSR markers ranged from 0.301 (TG12-13) to 0.374 (TOM196), with an average of 0.355. The SSR markers were distributed on chromosomes (Chr) 7 (TG7-18), 9 (TG9-11), 11 (TOM196 and TOM144) and 12 (TG12-5 and TG12-13). The PIC values of 35 InDel markers ranged from 0.243 (sli1817) to 0.375 (SL10279i, sli2311, sli583, sli1285 and sli3013), and the average of the InDel markers was 0.349, Were distributed on chromosomes.

4. Analysis of the relationship between cultivars

Genotyping of tomato varieties was carried out by PCA analysis using a marker complementary to the primer set according to the present invention. The Principal component (PC) used in the PCA analysis is an index that maximizes the change of the data, and it can reduce the dimension of the data by identifying it. PC1 and PC2 used in this study are the indicators that account for 49.57% and 12.11% of total data change, respectively. Since the two PCs used in the PCA analysis correspond to indicators that account for less than 70% of the total data change, the following PCA analysis data may be valid data.

According to the above PC1 and PC2, 62 kinds of tomato varieties were separated into three clusters according to the market classification, except for the rootstock varieties, such as major species, jujube type, and drop type varieties (Fig. 2). PC1 showed that the jujube - type and the drop - type varieties were separated from the major species varieties (cluster I). PC2 was able to separate the drop - type varieties (cluster III) and jujube varieties (cluster II). However, in the PCA analysis, one type of jujube varieties, "TY Tiny", was similar to other major varieties (Fig. 2). Similarly, the two-drop varieties "Blackrich" and "TY Miracle" showed a closer genetic relationship to the major and the juvenile varieties than the other drop varieties (FIG. 2).

In the UPGMA dendrogram, the Jaccarb coefficient was split from 0.29 into cluster I and cluster II (Fig. 3). In cluster I (35 varieties), the Jaccarb coefficients ranged from 0.43 to 0.47 at I-1 (29 species of major species, 1 species of drop type), I-2 (1 species of major species, 2 species of main species ) And I-3 (one major species, one jujube type). Black-rich varieties were clustered in I-1 like 29 major varieties and jujube varieties "TY Tiny" were clustered in I-3 along with major varieties "Cheonggang". Cluster II-1 consisted of 17 jujube varieties and three drop varieties ("TY Miracle", "Yoyo" and "Olleh TY") while cluster II-2 consisted of eight drop varieties. That is, it is possible to distinguish between the cultivars by confirming whether the marker according to the present invention is amplified.

In addition to clustering, the 62 F1 tomato-exposed varieties were differentiated into markers that complementarily complement the primer set according to the present invention.

As a result, "Dotaerang Dia" and "Super Dotaerang" tomato varieties were developed in the same breeding program and could not be distinguished because they were genetically similar. However, the remaining varieties (61 of 62 varieties) (Fig. 3).

In addition, the UPGMA dendrogram was used to determine whether the tomato varieties could be distinguished by using the markers of the following groups (FIGS. 4 and 5):

Group 1: sli2887, sli2792, sli2495, sli2311, sli583, sli608 and sli1920

Group 2: sli2887, SL10126i, sli2792, sli2495, sli2311, sli583, sli608, sli1019, sli1285, sli3013, sli1920, and sli1962

Experiments were conducted on 62 tomato varieties using the markers of each group to determine whether the cultivars could be distinguished from each other, which is shown in FIGS. 4 to 5.

As a result, it was found that among 51 varieties of 62 informative varieties, it was possible to classify the varieties of varieties by the amplification of markers of group 1.

In case of discrimination between the breeds by the amplification of the markers of group 2, it was shown that among the 61 informative varieties of 62 tomatoes, the breeds could be classified.

As a result, it was found that about 84% of the total tomato varieties could be distinguished even if only the marker of Group 1 was used, and when the marker of group 2 was used, most varieties of tomato varieties were classified .

In order to confirm that the genotypes classified by the marker according to the present invention are genetically different from each other, the magnitude of the genetic difference between them was estimated as the standard genetic distance D of bidirectional F _st and Nei (Table 4).

Subgroup Breed variety Jujube varieties Drop-shaped varieties Breed variety - 0.530 * 0.443 ^* Jujube varieties 0.711 - 0.257 ^* Drop-shaped varieties 0.517 0.221 -

The bidirectional prediction of θ appeared on the diagonal line, and the bidirectional prediction of D appeared below the diagonal line. For the bidirectional prediction of F _st, P values were calculated using the Bonferroni correction to 10,000 permutations. ( ^* p < 0.005)

As shown in Table 4, when compared to the jujube cultivars (F _st = 0.530, p <0.005, D = 0.711) and the drop varieties (F _st = 0.443, p <0.005, D = 0.517) (F _st = 0.257, p <0.005; D = 0.221), indicating a significant genetic difference between the jujube-type and drop-type varieties.

In addition, the estimates of the bi - directional F _st and D between jujube - type and drop - type varieties were not larger than those between major species, juvenile - type and drop - type varieties.

Furthermore, the level of genetic diversity in each subgroup (major species, jujube type and bell-shaped varieties) was measured using allelic richness (A) and anticipated heterozygotes (He) 5.

Subgroup Sample size A ^a He ^b Breed variety 31 1.597 0.306 Jujube varieties 17 1.636 0.333 Drop-shaped varieties 12 1.795 0.401 ^a Allelic richness
^b An expected heterozygous conjugate modified to the size of the sample

The highest genetic diversity was found in drop varieties (A = 1.795, He = 0.401). The jujube varieties showed moderate genetic diversity (A = 1.636, He = 0.333), with the lowest genetic diversity estimates in the major species (A = 1.597, He = 0.306).

5. Conclusion

Based on the genotype data of the markers according to the present invention, the genetic distances between 62 different cultivars were calculated and the similarities between the cultivars were analyzed. As a result, it was confirmed that 41 markers of Table 3 distinguish 61 cultivars (FIG. 3) Even if only the markers of group 1 were used without using all 41 markers, it was possible to distinguish among the varieties of 84% or more of the whole tomato varieties. In addition, it was shown that most of the tomato varieties were able to distinguish between the five types of markers.

In other words, genetic mutation detection or breeding can be identified in most F1 tomato varieties by confirming amplification of seven markers (sli2887, sli2792, sli2495, sli2311, sli583, sli608 and sli1920) among the 41 markers of the present invention And the accuracy of the discrimination between cultivars by judging whether or not amplification of more than 12 markers (sli2887, SL10126i, sli2792, sli2495, sli2311, sli583, sli608, sli1019, sli1285, sli3013, sli1920 and sli19620) Respectively. In addition, the accuracy of detection of genetic variation and genetic variation among the 41 markers of the present invention was found to be the highest.

By confirming whether the marker according to the present invention is amplified with the primer set according to the present invention, not only the distinction between genetically distant larvae, droplet and jujube varieties, but also genetically close bell-shaped varieties and jujube varieties , And it was confirmed that the tomatoes with the genetic variation and the varieties with the genetic variation can be distinguished with excellent accuracy.

Thus, the marker &lt; RTI ID = 0.0 & The primer set (or primer) of the present invention, which can be complementarily combined, can discriminate among most species of tomato varieties sold on the market by discriminating between varieties, further discriminating genetic mutations.

The primer set (or primer) of the present invention can be used for sorting breeds due to genetic variation through crossing of commercial F1 tomatoes in order to protect the rights of the breeding stock, and the PIC value of the markers according to the present invention, Through the band pattern generated by the amplification of the marker, it is possible to judge whether the tomato is a varietal or a variant of the different varieties from the disclosed varieties, so that it is possible to discriminate the tomato varieties and the variant tomatoes promptly and inexpensively.

<110> INDUSTRY-ACADEMIA COOPERATION GROUP OF SEJONG UNIV <120> Variant Tomato Discrimination composition <130> 17P02048 <160> 82 <170> KoPatentin 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 1 gtttccccaa attaaagcaa aaa 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 2 caaacaacat gagaagcagc a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 3 ggaccaagcg aagttggata 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 4 cgagtgtttc gcttctcctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 5 cctccaaatc ccaaaactct 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 6 tgtttcatcc actatcacga 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 7 ctgtttactt caagaaggct g 21 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 8 actttaactt tattattgcg acg 23 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 9 gaaacaacaa gtgctgcatg g 21 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 10 cttttccatt tatcccgtaa aa 22 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 11 gaaagaggta aaatcgcggg t 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 12 cctttacgat ttcgcctacg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 13 aagtggcatg gggacagtag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 14 attctctgaa gacccagcca 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 15 atgactgagc atctgcgttc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 16 gccgccactt attgtaggat 20 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 17 tggtctgagg gtcaactaat ga 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 18 ggttgagccg aaattttcaa 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 19 cgagtccgag gaagactgat 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 20 tcaagacaga cacggattgc 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 21 tgatgccgca attactttta g 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 22 gaaagccaaa ccaggatttt c 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 23 acttgctaga ccaagggggt 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 24 tctccatgca agttggtctg 20 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 25 cactgaactc gcattctttt ca 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 26 attggcagtt tcttcatgcc 20 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 27 gggtctcttt ggttttaaga cttc 24 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 28 caaatagatg aaaggggcca 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 29 tcgcatcaat tgcaacacac 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 30 aaacgcaagg tgatcagtcc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 31 agcccaatac cctctcacac 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 32 accaaacctc ggtgttcttc 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 33 acacctttcg aaatcggttg 20 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 34 ggggatatac attggagcac a 21 <210> 35 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 35 cgttgtacag aatcactcat caca 24 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 36 gggatgaatt ccgaccaaat 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 37 aacaccagat gaaccgaagc 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 38 gccataaaag tcaaatgccg 20 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 39 aagcctcctt taccaatcag c 21 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 40 gccatgaaag tgaactgaag c 21 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 41 taggtcaacc tacgcctgct 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 42 aggacccttc cattttagcc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 43 ttctgcaacg tgtcttcctg 20 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 44 ggaaacattc actcagccaa a 21 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 45 gctacaggca gacagcatag ac 22 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 46 ctgcattccc ttgtgtttt 19 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 47 ccggaaagca ttgttgtagc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 48 acagttgaaa ttgcctgagc 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 49 tgggtcacat tctccaacaa 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 50 atgcagattg agttgcgtga 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 51 gtatcgcgta atttgccgtt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 52 tctgaaagca accatttccc 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 53 cgttggttga ggaaatggtt 20 <210> 54 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 54 gcagctgaat aacatgcaca g 21 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 55 acattcaagg tgcatttcgt 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 56 gcgccattgc caagatatta 20 <210> 57 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 57 tcaaacgaag ataggagtaa gat 23 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 58 tggaacattg aagaacaggt 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 59 gggcttggtt ctcttgatga 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 60 gatggcacat ttccttggat 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 61 aggaagtgtt gaaagcccct 20 <210> 62 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 62 cagatgcaac acacacactc a 21 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 63 ccattcgttg accttccaac 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 64 tgggcgagtt aatgggtcta 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 65 caaccgtcct ctcgaacatt 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 66 tgcaaccctt gacttgagaa 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 67 aagaaggtcc ttgaggaggg 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 68 cctagtggcc ttctgcttga 20 <210> 69 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 69 ctgcaaaatt tcaaccaacc a 21 <210> 70 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 70 tccgagtaga gggcaatgat aagt 24 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 71 cggcaaaagc atcaatatcc 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 72 tgaagcatat agcccttccg 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 73 ccactcctgg gactcaaatc 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 74 tggacccaca ggtaatgagg 20 <210> 75 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 75 gaagcagatg atgttttggc t 21 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 76 agccttctgc gctttattca 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 77 tctttagcgc ctcaatcgtt 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 78 gaatgggttg caagggtaga 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 79 gaagaacaag gcaacctcca 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 80 acctacgctt caagcacgtt 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 81 tgctgttttg tttggctcac 20 <210> 82 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer sequence <400> 82 tgttcatatc tttgatggca tgt 23

Claims (6)

A primer set of SEQ ID NOS: 13 and 14; A primer set of SEQ ID NOS: 17 and 18; A primer set of SEQ ID NOS: 23 and 24; A primer set of SEQ ID NOS: 37 and 38; A primer set of SEQ ID NOS: 43 and 44; A primer set of SEQ ID NOS: 49 and 50; And a primer set of SEQ ID NOS: 67 and 68.
The method according to claim 1, wherein the primer set of SEQ ID NOs: 15 and 16; A primer set of SEQ ID NOS: 51 and 52; A primer set of SEQ ID NOS: 53 and 54; A primer set of SEQ ID NOS: 57 and 58; And at least one primer set selected from the group consisting of primers set forth in SEQ ID NOs: 75 and 76.
The method according to claim 1, wherein the primer set of SEQ ID NOs: 1 and 2; A primer set of SEQ ID NOS: 3 and 4; A primer set of SEQ ID NOS: 5 and 6; A primer set of SEQ ID NOS: 7 and 8; A primer set of SEQ ID NOS: 9 and 10; A primer set of SEQ ID NOS: 11 and 12; A primer set of SEQ ID NOS: 19 and 20; A primer set of SEQ ID NOS: 21 and 22; A primer set of SEQ ID NOS: 25 and 26; A primer set of SEQ ID NOs: 27 and 28; A primer set of SEQ ID NOs: 29 and 30; A primer set of SEQ ID NOS: 31 and 32; A primer set of SEQ ID NOS: 33 and 34; A primer set of SEQ ID NOS: 35 and 36; A primer set of SEQ ID NOS: 39 and 40; A primer set of SEQ ID NOS: 41 and 42; A primer set of SEQ ID NOs: 45 and 46; A primer set of SEQ ID NOS: 47 and 48; A primer set of SEQ ID NOS: 55 and 56; A primer set of SEQ ID NOS: 59 and 60; A primer set of SEQ ID NOs: 61 and 62; A primer set of SEQ ID NOS: 63 and 64; A primer set of SEQ ID NOs: 65 and 66; A primer set of SEQ ID NOS: 69 and 70; A primer set of SEQ ID NOS: 71 and 72; A primer set of SEQ ID NOS: 73 and 74; A primer set of SEQ ID NOS: 77 and 78; A primer set of SEQ ID NOS: 79 and 80; And at least one primer set selected from the group consisting of primers set forth in SEQ ID NOS: 81 and 82.
The composition according to claim 1, comprising the primers of SEQ ID NOS: 1-82.
A kit for discriminating tomato varieties comprising the composition according to any one of claims 1 to 4.
A method for discriminating tomato varieties comprising amplifying a tomato genome DNA with a composition according to any one of claims 1 to 4.

Images