CN116497146B - Molecular marker, primer and method for identifying purity of 'Jinsong 75' loose cauliflower hybrid - Google Patents
Molecular marker, primer and method for identifying purity of 'Jinsong 75' loose cauliflower hybrid Download PDFInfo
- Publication number
- CN116497146B CN116497146B CN202310371641.7A CN202310371641A CN116497146B CN 116497146 B CN116497146 B CN 116497146B CN 202310371641 A CN202310371641 A CN 202310371641A CN 116497146 B CN116497146 B CN 116497146B
- Authority
- CN
- China
- Prior art keywords
- hybrid
- molecular marker
- sample
- purity
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 235000011299 Brassica oleracea var botrytis Nutrition 0.000 title claims abstract description 32
- 240000003259 Brassica oleracea var. botrytis Species 0.000 title claims abstract description 32
- 238000000034 method Methods 0.000 title claims abstract description 31
- 239000003147 molecular marker Substances 0.000 title claims abstract description 30
- 235000017647 Brassica oleracea var italica Nutrition 0.000 claims abstract description 17
- 238000001917 fluorescence detection Methods 0.000 claims abstract description 6
- 238000001514 detection method Methods 0.000 claims description 35
- 230000003321 amplification Effects 0.000 claims description 10
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 10
- 238000007862 touchdown PCR Methods 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 4
- 210000000349 chromosome Anatomy 0.000 claims description 4
- 238000005516 engineering process Methods 0.000 abstract description 10
- 108020004414 DNA Proteins 0.000 description 12
- 238000003752 polymerase chain reaction Methods 0.000 description 12
- 238000012163 sequencing technique Methods 0.000 description 8
- 238000001962 electrophoresis Methods 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 5
- 239000000463 material Substances 0.000 description 4
- 108010044467 Isoenzymes Proteins 0.000 description 3
- 238000009395 breeding Methods 0.000 description 3
- 230000001488 breeding effect Effects 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 230000035772 mutation Effects 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 102000004169 proteins and genes Human genes 0.000 description 3
- 238000012216 screening Methods 0.000 description 3
- 241000894007 species Species 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 235000013339 cereals Nutrition 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000000877 morphologic effect Effects 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 235000008331 Pinus X rigitaeda Nutrition 0.000 description 1
- 235000011613 Pinus brutia Nutrition 0.000 description 1
- 241000018646 Pinus brutia Species 0.000 description 1
- 108091081062 Repeated sequence (DNA) Proteins 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 1
- 208000005652 acute fatty liver of pregnancy Diseases 0.000 description 1
- 238000007622 bioinformatic analysis Methods 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- OGQYPPBGSLZBEG-UHFFFAOYSA-N dimethyl(dioctadecyl)azanium Chemical compound CCCCCCCCCCCCCCCCCC[N+](C)(C)CCCCCCCCCCCCCCCCCC OGQYPPBGSLZBEG-UHFFFAOYSA-N 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 235000013312 flour Nutrition 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000012268 genome sequencing Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 230000035784 germination Effects 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000011065 in-situ storage Methods 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 210000001161 mammalian embryo Anatomy 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 1
- 230000007226 seed germination Effects 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
Abstract
The invention discloses a molecular marker, a primer and a method for identifying the purity of loose broccoli hybrid of 'Jinsong 75', wherein the method is based on the resequencing data of parents of the broccoli hybrid, finds out the SNP of the difference between the parents, develops 2 pairs of KASP primers, adopts 2 SNP markers, and utilizes a fluorescence detection technology to rapidly distinguish male parent, female parent and hybrid, can be directly used for identifying the purity of loose broccoli variety of 'Jinsong 75', further relies on the molecular marker to evaluate the true and false hybrid of the commodity variety, and can effectively protect the rights and interests of the variety. The purity of the variety can be rapidly identified by using the molecular marker in early stage, so that the loss caused by false hybrid is effectively reduced, the possible dispute is reduced, the identification efficiency and accuracy are improved, and evidence is provided for the protection of the variety. Therefore, the invention has great application value in the identification and variety protection of the loose cauliflower 'Jinsong 75' hybrid.
Description
Technical Field
The invention belongs to the technical field of molecular breeding, and particularly relates to a molecular marker, a primer and a method for identifying the purity of a 'Jinsong 75' loose cauliflower hybrid.
Background
The country uses the agriculture as the root and the agriculture uses the seed as the first. Seed quality is the life of seed production and sales, is the basis of seed sales, and is the key to controlling production risk. The four general indicators of seed quality are: seed purity, germination rate and water content, and the purity is the measurement index of the core of the quality of the seeds. Because of this, seed purity detection is an important link for seed quality internal control and is also a main quality index for market supervision.
Common methods for purity identification of general varieties include seed morphology identification, seedling morphology identification, protein (isozyme) electrophoresis method, DNA molecular marker identification and field cell planting identification. The seed morphology identification is carried out according to morphological characteristics of corn seeds such as grain shape, grain color, shape, size, embryo size, endosperm flour quality and the like. The standard sample or the map of the variety and related data must be prepared during the identification, and the accuracy of the identification is low; (2) The identification of the seedling morphology is carried out according to the color (green, red, purple), leaf color, leaf shape, growth vigor and the like of the seedling bud sheath. The color of the bud sheath is generally used as the main morphological characteristic of purity identification. The method has long identification time. (3) The different varieties of seeds of the protein (isoenzyme) electrophoresis method have different genetic bases, so that the synthesized protein (isoenzyme) has different varieties and numbers, the bands formed after electrophoresis separation are different, the number of the seeds of other varieties can be judged after the comparison with the comparison (standard) varieties, and finally, the purpose of identifying the purity of the seeds is achieved. The method has complicated electrophoresis time and operation; (4) Identification of DNA molecular marker the identification of DNA molecular marker uses variety DNA fragment as detection object, and utilizes electrophoresis method to detect variety genome DNA structure and composition, and utilizes analysis of polymorphism of variety DNA, i.e. DNA base sequence difference to identify different varieties. The DNA molecular markers used in the current identification of variety authenticity and variety purity mainly comprise SSR, AFLP, RAPD technology based on PCR amplification and RFLP technology based on molecular hybridization. The method is based on electrophoresis to distinguish bands so as to distinguish true species from false species, and large-scale operation is not utilized. (5) The field community planting identification method is the most reliable method for identifying the authenticity and purity of the current variety, is particularly suitable for identifying the hybrid seeds, has accurate and reliable result, and is the detection method with legal effectiveness most in solving the seed quality disputes at present. The method can observe and compare more characters. The method has the defects of labor and time consumption, long identification period and high cost, and is greatly influenced by environment and human factors, and the accuracy of identification is limited by the observation experience of an identifier.
With the development of genome sequencing technology, researchers can develop SNP marker loci for parents, and at present, SNP detection is used as the latest molecular marker detection method, and is recommended by a plurality of international organizations, such as International Seed Testing Association (ISTA), international new variety protection Association (UPOV), international seed Union (ISF), and the like, as a method for identifying varieties at the DNA level. Mainly comprises SNP chip platform, sample high-flux in-situ scanning platform (LGC company KASP technology, life company Taqman technology), site and sample high-flux target sequencing technology, etc., and the cost of the technology platforms is high. According to the invention, the amphiphilic polymorphism KASP primer is developed through amphiphilic heavy sequencing and combined with F1 to rapidly seed germination, DNA extraction and laboratory fluorescence quantitative detection are carried out, so that the purity identification work is rapidly and accurately completed.
Disclosure of Invention
The invention aims at providing a molecular marker and a primer for identifying the purity of a loose broccoli hybrid of 'Jinsong 75'.
The second purpose of the invention is to provide a method for identifying the purity of the loose broccoli hybrid of 'Jinsong 75'.
The invention also aims to provide the application of the molecular marker and the primer in the identification of the purity or variety of the loose broccoli hybrid of 'Jinsong 75'.
In order to achieve the above object, the technical scheme of the present invention is summarized as follows:
A molecular marker for identifying the purity of loose broccoli hybrid of 'Jinsong 75', wherein the molecular marker 1 is the variation of A to G at 54613788bp position on chromosome 4 of the broccoli genome; marker 2 is the T-to-A variation that occurs at the 51360028bp position on the broccoli genome chromosome 5.
The primers corresponding to the molecular markers are shown in Table 1.
TABLE 1 molecular marker primers and sequences
Preferably, the 5 'ends of the primers Chr4-54613788-F1 and Chr5-51360028-F1 are respectively connected with FAM fluorescent joints, the 5' ends of the primers Chr4-54613788-F2 and Chr5-51360028-F2 are respectively connected with HEX fluorescent joints, and the FAM and HEX fluorescent joints have the sequences as follows:
FAM：GAAGGTGACCAAGTTCATGCT；
HEX：GAAGGTCGGAGTCAACGGATT。
the invention also protects the application of the molecular marker in identifying the true and false hybrid seeds of the loose broccoli of 'Jinsong 75'.
Specifically, the method for identifying the true and false hybrid seeds of the loose broccoli of 'Jinsong 75' is as follows:
(1) Taking genomic DNA of a sample to be detected as a template, and amplifying by using two groups of primers corresponding to the molecular markers to obtain an amplified product;
(2) Carrying out fluorescence detection on the amplified products, and if the sample PCR products detect FAM fluorescence signals corresponding to the primers Chr4-54613788 and Chr5-51360028, the corresponding detection sites are A: a, T: the T genotype is judged to be a male parent type false hybrid; if the sample PCR product detects HEX fluorescent signals corresponding to the primers Chu 4-54613788 and Chu 5-51360028, the corresponding detection site is G: g, A: genotype A, judging as female parent false hybrid; if both FAM and HEX fluorescent signals are detected at the same time, the detection site is G: a, T: genotype A, true hybrid.
In addition, the invention also provides a method for identifying the purity of the loose broccoli hybrid of 'Jinsong 75', which comprises the following steps:
(1) Taking genomic DNA of a sample to be detected as a template, and carrying out PCR (polymerase chain reaction) amplification by using the primers corresponding to the molecular markers to obtain an amplification product;
(2) Carrying out fluorescence detection on the amplified products, and if the sample PCR products detect FAM fluorescence signals corresponding to the primers Chr4-54613788 and Chr5-51360028, the corresponding detection sites are A: a, T: the T genotype is judged to be a male parent type false hybrid; if the sample PCR product detects HEX fluorescent signals corresponding to the primers Chu 4-54613788 and Chu 5-51360028, the corresponding detection site is G: g, A: genotype A, judging as female parent false hybrid; if both FAM and HEX fluorescent signals are detected at the same time, the detection site is G: a, T: the genotype A is judged to be true hybrid, if no fluorescent signal is detected, the genotype A is combined with other genotypes, and the genotype A is judged to be other hybrid;
(3) And counting the ratio of the true hybrid seeds to the total detection sample, and calculating the seed purity of the cauliflower hybrid seeds.
Preferably, touchdown PCR is used for PCR amplification; touchdown PCR amplification procedure was: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s; the components and amounts used for PCR amplification at 57℃for 60s,26 cycles are shown in Table 2.
TABLE 2 PCR Components and amounts used for amplification
The molecular marker can be used for the purity of the hybrid seeds of the single variety 'Jinsong 75' seeds, and can also effectively distinguish the variety 'Jinsong 75' loose cauliflower from other varieties.
The invention has the advantages that:
According to the invention, 2 SNP loci different between two parents are screened by using a whole genome resequencing variation detection method, SNP markers are successfully developed, two pairs of KASP primers are developed, a fluorescence detection technology is utilized to rapidly distinguish male parent, female parent and hybrid seeds, namely loose cauliflower 'Jinsong 75' varieties, the method can be directly used for identifying the loose cauliflower 'jin song 75' varieties of commodity varieties, and further the molecular markers are relied for evaluating true and false hybrid seeds of commodity varieties, so that the rights and interests of the varieties can be effectively protected. The purity of the variety can be rapidly identified by using the molecular marker in early stage, so that the loss caused by false hybrid is effectively reduced, the possible dispute is reduced, the identification efficiency and accuracy are improved, and evidence is provided for the protection of the variety. Therefore, the invention has great application value in the identification and variety protection of the loose cauliflower 'Jinsong 75' hybrid.
Drawings
FIG. 1 is a phenotypic diagram of male parent, female parent, F1 material;
FIG. 2 is a genotyping diagram of the molecular markers of Chr4-54613788 and Chr5-51360028 in the identification of true and false hybrid seeds of Jinsong 75;
In the figure, a represents: the PCR product is a fluorescent signal corresponding to a primer Chur 4-54613788 and Chur 5-51360028, and is a male parent and male parent type false hybrid;
And B represents: the PCR product is a fluorescent signal corresponding to a primer Chur 4-54613788 and Chur 5-51360028, and is a false hybrid of a female parent and a male parent;
And C represents: the PCR product has two fluorescent signals of primer Chur 4-54613788 and Chur 5-51360028, and is hybrid F1.
Detailed Description
The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. However, unless otherwise indicated, all the specific examples described in the examples below were either conventional or were carried out under the conditions recommended by the manufacturer's instructions.
The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise indicated, all reagents and materials used are commercially available.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred methods and materials described herein are presented for illustrative purposes only.
Example 1 acquisition of molecular marker for purity of Loose cauliflower "jin pine 75" variety
1. Whole genome resequencing variation detection
Mutation detection refers to sequencing and differential analysis of genomes of individuals or populations of a certain species by high throughput sequencing technology to obtain a large number of Single Nucleotide Polymorphism Sites (SNPs), inDel sites (InDel, insertion/Deletion), structural mutation sites (SV, structure Variation) sites and copy number mutation sites (CNV, copy number variation). With the great reduction of sequencing cost and the improvement of sequencing efficiency, whole genome resequencing variation detection has become one of the most rapid and effective methods for researching human diseases and breeding of animal and plant molecules. After the sequencing data was taken off the machine, bioinformatic analysis was performed as follows.
(1) Performing quality control on the original off-machine data to obtain CLEAN DATA for analysis; the off-press data is RAW date to obtain CLEAN READS with high quality for subsequent analysis. The sequencing data filtration steps were as follows: (1) removing reads containing an adapter; (2) removing reads with the number of N being greater than 3; (3) Low quality reads were removed (the number of bases with quality value Q <5 accounted for more than 20% of the total read).
(2) Comparing CLEAN DATA to a reference genome; after CLEAN READS is obtained, CLEAN READS is compared with a reference genome by adopting BWA software, the initial comparison result is in a sam format, and the result is converted into a bam format and sequenced by utilizing SAMtools software. If the result of one sample contains a plurality of libraries, combining the bam results of the libraries by using SAMtools, labeling repeated sequences by picard, and carrying out data basic information statistics;
(3) Carrying out SNP variation detection; SNP detection was performed using GATK software (v 3.8 second generation resequencing variation detection software https:// software.broadenstitute.org/GATK /);
(4) Screening SNP, filtering out SNP sites with QUAL value (base quality value) less than 30, MQ quality minimum value less than 30 and DP value less than 2, selecting amphiphile homozygous and different SNP sites as candidate sites.
2. Molecular marker development
Candidate SNP sites were selected based on differences between the parental sequencing sequences, KASP primers were designed using on-line Primer design software SNP PRIMER (www.snpway.com) (as shown in table 1), comprising a pair of specific primers (Primer a and Primer B) containing SNP alleles with different fluorescent linkers and a reverse common Primer (Primer C), primer a being FAM fluorescent linker (GAAGGTGACCAAGTTCATGCT): primer B is HEX fluorescent linker (GAAGGTCGGAGTCAACGGATT). A primer pair with proper specificity and annealing temperature is selected, and the primer is synthesized by Beijing engine company.
When the molecular marker is applied, the method specifically comprises the following steps:
(1) Taking genomic DNA of a sample to be detected as a template, and carrying out TouchdownPCR amplification by using a molecular marked amplification primer to obtain an amplification product; using Touchdown PCR, the amplification procedure was: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,26 cycles;
(2) Detection and analysis of amplified products
If the sample PCR product detects FAM fluorescent signals corresponding to the primers Chu 4-54613788 and Chu 5-51360028, the corresponding detection sites are A: a, T: the T genotype is judged to be a male parent type false hybrid; if the sample PCR product detects HEX fluorescent signals corresponding to the primers Chu 4-54613788 and Chu 5-51360028, the corresponding detection site is G: g, A: genotype A, judging as female parent false hybrid; if both FAM and HEX fluorescent signals are detected at the same time, the detection site is G: a, T: genotype A, true hybrid. If the fluorescent signal is not detected, judging that other genotypes are combined, and judging that other types of hybrid seeds are obtained; (in practice, no fluorescent signal is generated, which may be caused by powder stringing in practice);
(2) And counting the ratio of the true hybrid seeds to the total detection sample, and calculating the seed purity of the cauliflower hybrid seeds.
3. Specific application example
And detecting 188 samples to be detected by adopting 2 SNP markers, calculating the true hybrid ratio in the samples to be detected according to the detection result of the SNP markers, mutually correcting the primers, judging the samples to be true hybrid seeds when two pairs of the primers are hybrid seeds during F1 detection, determining that the number of hybrid seeds is the number of single seeds with double-marker locus genotypes consistent with that of the male parent or the female parent, and counting the purity of the seeds (tables 3 and 4). The primer has good stability through field verification test, is relatively consistent with field test results, and can carry out purity identification on the cauliflower hybrid variety. The detection method can finish seed purity identification within 2 hours, and has the advantages of rapidness, low cost, convenience in operation and the like.
TABLE 3 determination of genotypes detected by Chr4-54613788, chr5-51360028 markers and true and false hybrids
TABLE 4 purity characterization results
In summary, the male parent false hybrid can be judged by molecular marker identification and screening in breeding and retaining FAM fluorescent signals corresponding to the primers Chr4-54613788 and Chr 5-51360028; reserving HEX fluorescent signals corresponding to the detected primers Chr4-54613788 and Chr5-51360028 to obtain female parent false hybrids; if two fluorescent signals are detected simultaneously, the detection site is G: a, T: the genotype A is judged to be true hybrid, the purity of the commodity can be identified through screening of early molecular markers, and the variety is protected.
The above-mentioned embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present invention shall be included in the scope of the present invention.
Claims (6)
1. The molecular marker for identifying the purity of the loose broccoli hybrid of 'Jinsong 75', is characterized by comprising a molecular marker 1 and a molecular marker 2, wherein the molecular marker 1 is the A-to-G variation occurring at 54613788bp position on a chromosome 4 of a broccoli genome; the molecular marker 2 is the variation of T to A at 51360028bp position on the cauliflower genome No. 5 chromosome; the primers corresponding to the molecular markers are as follows:
2. The molecular marker according to claim 1, wherein the 5 'ends of the primers Chr4-54613788-F1 and Chr5-51360028-F1 are respectively connected with a FAM fluorescent linker, the 5' ends of Chr4-54613788-F2 and Chr5-51360028-F2 are respectively connected with a HEX fluorescent linker, and the FAM and HEX fluorescent linker sequences are respectively:
FAM：GAAGGTGACCAAGTTCATGCT；
HEX：GAAGGTCGGAGTCAACGGATT。
3. Use of the molecular marker according to claim 1 or 2 for identifying true and false hybrid of "jin song 75" loose cauliflower.
4. The use according to claim 3, wherein the method for identifying the true and false hybrid of the loose broccoli of "jin song 75" is:
(1) Amplifying by using the genome DNA of the sample to be detected as a template and using two sets of primers corresponding to the molecular markers in claim 2 to obtain an amplified product;
(2) Carrying out fluorescence detection on the amplified products, and judging that the sample PCR products are male parent false hybrids if the sample PCR products detect FAM fluorescence signals corresponding to primers Chur 4-54613788 and Chur 5-51360028, wherein the corresponding detection sites are A, T and T genotypes; if the sample PCR product detects HEX fluorescent signals corresponding to primers Chur 4-54613788 and Chur 5-51360028, the corresponding detection site is G, A is A genotype, and the sample is judged to be a female parent false hybrid; if two fluorescence signals of FAM and HEX are detected at the same time, the detection sites are G: A, T: A genotypes, and the true hybrid is judged.
5. A method for identifying the purity of a loose broccoli hybrid of 'jin song 75', comprising the steps of:
(1) Carrying out PCR amplification by using the primer corresponding to the molecular marker in claim 2 and taking genomic DNA of a sample to be detected as a template to obtain an amplification product;
(2) Carrying out fluorescence detection on the amplified products, and judging that the sample PCR products are male parent false hybrids if the sample PCR products detect FAM fluorescence signals corresponding to primers Chur 4-54613788 and Chur 5-51360028, wherein the corresponding detection sites are A, T and T genotypes; if the sample PCR product detects HEX fluorescent signals corresponding to primers Chur 4-54613788 and Chur 5-51360028, the corresponding detection site is G, A is A genotype, and the sample is judged to be a female parent false hybrid; if two fluorescent signals of FAM and HEX are detected at the same time, the detection sites are the genotypes of G: A and T: A, and the true hybrid is judged, if the fluorescent signals are not detected, the combination of other genotypes is judged, and the other hybrid is judged;
(3) And counting the ratio of the true hybrid seeds to the total detection sample, and calculating the seed purity of the cauliflower hybrid seeds.
6. The method for identifying the purity of the hybrid seeds of the broccoli of 'Jinsong 75' according to claim 5, wherein Touchdown PCR is adopted for PCR amplification; touchdown PCR amplification procedure was: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,26 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310371641.7A CN116497146B (en) | 2023-04-07 | 2023-04-07 | Molecular marker, primer and method for identifying purity of 'Jinsong 75' loose cauliflower hybrid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310371641.7A CN116497146B (en) | 2023-04-07 | 2023-04-07 | Molecular marker, primer and method for identifying purity of 'Jinsong 75' loose cauliflower hybrid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116497146A CN116497146A (en) | 2023-07-28 |
| CN116497146B true CN116497146B (en) | 2024-06-21 |
Family
ID=87317606
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310371641.7A Active CN116497146B (en) | 2023-04-07 | 2023-04-07 | Molecular marker, primer and method for identifying purity of 'Jinsong 75' loose cauliflower hybrid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116497146B (en) |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103131755A (en) * | 2011-11-22 | 2013-06-05 | 上海市农业科学院 | Method for rapidly detecting brassica oleracea var. italic hybrid purity by using SRAP mark |
| CN102443654B (en) * | 2012-01-17 | 2013-11-06 | 天津市农业科学院中心实验室 | Cauliflower hybrid seed purity identification method based on EST-SSR (expressed sequence tag-simple sequence repeat) marker |
| WO2016137029A1 (en) * | 2015-02-25 | 2016-09-01 | 순천대학교 산학협력단 | Primer set for assessing combination purity or discriminating genotype of cabbage classii self-incompatibility factor, and method for assessing purity and discriminating genotype using same |
| AU2015255211B2 (en) * | 2015-08-12 | 2022-02-24 | Vilmorin & Cie | Resistance to australian variant of a. candida race 9 in broccoli |
| CN113631722B (en) * | 2019-03-11 | 2024-05-28 | 先锋国际良种公司 | Methods for identifying, selecting and producing southern corn rust resistant crops |
| CN111793709B (en) * | 2020-07-01 | 2021-05-14 | 浙江省农业科学院 | Primer pair for identifying 88 days of broccoli variety of Zhenong pine pollen and method and application thereof |
| CN111733274B (en) * | 2020-07-01 | 2022-09-16 | 浙江省农业科学院 | SNP locus, primer set and method for identifying cauliflower Zhe nong piny flower 80-day variety |
| CN112280881B (en) * | 2020-10-21 | 2023-09-01 | 浙江省农业科学院 | SNP (Single nucleotide polymorphism) marker combination for identifying broccoli germplasm resources and varieties and application |
| CN112080580B (en) * | 2020-10-21 | 2022-10-14 | 浙江省农业科学院 | SNP marker for identifying broccoli variety Zhe Qing 60 |
| CN112391487B (en) * | 2020-10-21 | 2022-11-08 | 浙江省农业科学院 | SNP marker for identifying broccoli variety Zhe Qing 75 |
| CN112746124B (en) * | 2021-02-02 | 2022-08-26 | 天津市农业科学院 | SSR primer and method for purity identification of cauliflower hybrid seeds |
-
2023
- 2023-04-07 CN CN202310371641.7A patent/CN116497146B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| 分子标记技术在花椰菜品种鉴定上的应用研究进展;宋晓玉等;《中国蔬菜》;20221231;第12卷;30-37 * |
| 青梗松花菜新品种津松75 的选育及栽培要点;刘莉莉等;《长江蔬菜》;20171130;第22卷;41-43 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116497146A (en) | 2023-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108004344B (en) | Corn whole genome SNP chip and application thereof | |
| CN110846429A (en) | Corn whole genome InDel chip and application thereof | |
| CN107338309A (en) | A kind of often SNP marker with cultivar scent gene badh2 and the application of rice | |
| CN110512024B (en) | SNP molecular marker related to low acidity or acidity state of peach fruit and application thereof | |
| CN116790784A (en) | Molecular marker, primer and method for identifying purity of loose broccoli hybrid of' Jinsong 105 | |
| US20210269887A1 (en) | Method and application for rapid and accurate chromosomal location of economic traits in laver | |
| CN113718052A (en) | Application of 5000 SNP site combinations and method for authenticating wheat variety authenticity identity | |
| CN110777216B (en) | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker | |
| CN116497146B (en) | Molecular marker, primer and method for identifying purity of 'Jinsong 75' loose cauliflower hybrid | |
| CN104593510A (en) | Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes | |
| KR101780936B1 (en) | Single nucleotide polymorphism probe for high-throughput genotype analysis of Brassica rapa and use thereof | |
| CN116426681A (en) | Molecular marker, primer and method for identifying purity of loose broccoli hybrid of' Jinsong 90 | |
| KR20220050296A (en) | Novel marker based on Single Nucleotide Polymorphism for identification of line of Brassica rapa ssp. pekinensis | |
| CN117737296B (en) | SNP marker for identifying purity of Qingzao 510 maize hybrid and application thereof | |
| CN114410829B (en) | Application of molecular marker related to purple cauliflower color in purple cauliflower breeding | |
| CN114107555B (en) | SNP molecular marker combination for detecting purity of wheat variety and application thereof | |
| CN114058734B (en) | SNP molecular marker combination for detecting rape varieties and application thereof | |
| CN114736980B (en) | Molecular marker fragment related to yellow cauliflower color and application thereof | |
| CN108486264B (en) | Identification of maize male sterility type C cytoplasm type by chloroplast marker | |
| CN118207349A (en) | SNP molecular marker for rice genotyping and application thereof | |
| US20230187023A1 (en) | Genetic information analysis system and genetic information analysis method | |
| CN117737296A (en) | SNP marker for identifying purity of Qingzao 510 maize hybrid and application thereof | |
| KR20240094132A (en) | Molecular marker to select pumpkin (Cucurbita moschata Duchesne) with lobed leaf trait and its use | |
| CN117721242A (en) | KASP molecular marker for identifying wheat grain weight, primer combination and application thereof | |
| CN116004889A (en) | KASP molecular marker of rice fertility gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |